Mutation - TCGA Type Chromosome Start Position End Position Strand Variant Classification Variant Type Reference Allele Tumor_seq Allele 1 Tumor_seq Allele 2 Tumor Sample Barcode Matched Norm Sample Barcode Genome Change cDNA Change Codon Change Protein Change ACC 5 56155597 56155597 + Missense_Mutation SNP C C T TCGA-OR-A5L2-01A-11D-A30A-10 TCGA-OR-A5L2-10A-01D-A30A-10 g.chr5:56155597C>T c.689C>T c.(688-690)gCt>gTt p.A230V ACC 5 56189493 56189493 + Missense_Mutation SNP C C T TCGA-OR-A5J5-01A-11D-A29I-10 TCGA-OR-A5J5-10A-01D-A29L-10 g.chr5:56189493C>T c.4525C>T c.(4525-4527)Cgt>Tgt p.R1509C BLCA 5 56152428 56152428 + Splice_Site SNP C C T TCGA-DK-A1A7-01A-11D-A13W-08 TCGA-DK-A1A7-10A-01D-A13W-08 g.chr5:56152428C>T c.484C>T c.(484-486)Cgt>Tgt p.R162C BLCA 5 56152511 56152511 + Silent SNP G G A TCGA-XF-A9SG-01A-12D-A42E-08 TCGA-XF-A9SG-10A-01D-A42H-08 g.chr5:56152511G>A c.567G>A c.(565-567)ctG>ctA p.L189L BLCA 5 56161654 56161654 + Splice_Site SNP A A T TCGA-G2-AA3F-01A-12D-A42E-08 TCGA-G2-AA3F-10A-01D-A42H-08 g.chr5:56161654A>T c.e6-1 BLCA 5 56171087 56171087 + Silent SNP C C T TCGA-XF-A9T8-01A-11D-A391-08 TCGA-XF-A9T8-10A-01D-A394-08 g.chr5:56171087C>T c.1915C>T c.(1915-1917)Ctg>Ttg p.L639L BLCA 5 56176987 56176987 + Missense_Mutation SNP G G C TCGA-4Z-AA80-01A-11D-A391-08 TCGA-4Z-AA80-10A-01D-A394-08 g.chr5:56176987G>C c.2257G>C c.(2257-2259)Gaa>Caa p.E753Q BLCA 5 56177590 56177590 + Missense_Mutation SNP C C T TCGA-GV-A3JV-01A-11D-A21Z-08 TCGA-GV-A3JV-10B-01D-A21Z-08 g.chr5:56177590C>T c.2563C>T c.(2563-2565)Cgt>Tgt p.R855C BLCA 5 56177617 56177617 + Missense_Mutation SNP G G C TCGA-R3-A69X-01A-22D-A30E-08 TCGA-R3-A69X-10A-01D-A30H-08 g.chr5:56177617G>C c.2590G>C c.(2590-2592)Gaa>Caa p.E864Q BLCA 5 56177626 56177626 + Missense_Mutation SNP G G A TCGA-CU-A3KJ-01A-11D-A21A-08 TCGA-CU-A3KJ-10A-01D-A21A-08 g.chr5:56177626G>A c.2599G>A c.(2599-2601)Gaa>Aaa p.E867K BLCA 5 56177956 56177956 + Nonsense_Mutation SNP C C T TCGA-C4-A0EZ-01A-21D-A10S-08 TCGA-C4-A0EZ-10A-01D-A10S-08 g.chr5:56177956C>T c.2929C>T c.(2929-2931)Caa>Taa p.Q977* BLCA 5 56178162 56178162 + Silent SNP C C T TCGA-DK-A6AW-01A-11D-A30E-08 TCGA-DK-A6AW-10A-01D-A30H-08 g.chr5:56178162C>T c.3135C>T c.(3133-3135)gtC>gtT p.V1045V BLCA 5 56178366 56178366 + Silent SNP C C T TCGA-DK-A2I4-01A-11D-A21A-08 TCGA-DK-A2I4-10A-01D-A21A-08 g.chr5:56178366C>T c.3339C>T c.(3337-3339)ttC>ttT p.F1113F BLCA 5 56178562 56178562 + Missense_Mutation SNP G G A TCGA-4Z-AA7M-01A-11D-A391-08 TCGA-4Z-AA7M-10A-01D-A394-08 g.chr5:56178562G>A c.3535G>A c.(3535-3537)Gag>Aag p.E1179K BLCA 5 56181840 56181840 + Missense_Mutation SNP G G A TCGA-FD-A3SL-01A-21D-A22Z-08 TCGA-FD-A3SL-10A-01D-A22Z-08 g.chr5:56181840G>A c.4064G>A c.(4063-4065)cGt>cAt p.R1355H BLCA 5 56189412 56189412 + Nonsense_Mutation SNP C C T TCGA-DK-A6AW-01A-11D-A30E-08 TCGA-DK-A6AW-10A-01D-A30H-08 g.chr5:56189412C>T c.4444C>T c.(4444-4446)Cga>Tga p.R1482* BRCA 5 56152454 56152455 + Frame_Shift_Ins INS - - A TCGA-E2-A10A-01A-21D-A10Y-09 TCGA-E2-A10A-10A-01D-A110-09 g.chr5:56152454_56152455insA c.510_511insA c.(511-513)aaafs p.K171fs BRCA 5 56152573 56152574 + Frame_Shift_Ins INS - - T TCGA-A8-A09M-01A-11W-A019-09 TCGA-A8-A09M-10A-01W-A021-09 g.chr5:56152573_56152574insT c.629_630insT c.(628-633)cctgtgfs p.V211fs BRCA 5 56155572 56155572 + Frame_Shift_Del DEL G G - TCGA-BH-A0E7-01A-11W-A050-09 TCGA-BH-A0E7-10A-01W-A055-09 g.chr5:56155572delG c.664delG c.(664-666)ggafs p.G222fs BRCA 5 56155605 56155605 + Frame_Shift_Del DEL C C - TCGA-BH-A18P-01A-11D-A12B-09 TCGA-BH-A18P-11A-43D-A12B-09 g.chr5:56155605delC c.697delC c.(697-699)ccafs p.P233fs BRCA 5 56155725 56155726 + Frame_Shift_Del DEL AG AG - TCGA-AN-A0XS-01A-22D-A10G-09 TCGA-AN-A0XS-10A-01D-A10G-09 g.chr5:56155725_56155726delAG c.817_818delAG c.(817-819)agafs p.R273fs BRCA 5 56155725 56155726 + Frame_Shift_Del DEL AG AG - TCGA-BH-A0DV-01A-21D-A12Q-09 TCGA-BH-A0DV-11A-22D-A12Q-09 g.chr5:56155725_56155726delAG c.817_818delAG c.(817-819)agafs p.R273fs BRCA 5 56155725 56155726 + Frame_Shift_Del DEL AG AG - TCGA-D8-A1JU-01A-11D-A13L-09 TCGA-D8-A1JU-10A-01D-A188-09 g.chr5:56155725_56155726delAG c.817_818delAG c.(817-819)agafs p.R273fs BRCA 5 56160565 56160565 + Missense_Mutation SNP A A C TCGA-E2-A15G-01A-11D-A12B-09 TCGA-E2-A15G-10A-01D-A12B-09 g.chr5:56160565A>C c.839A>C c.(838-840)cAg>cCg p.Q280P BRCA 5 56160574 56160574 + Missense_Mutation SNP G G C TCGA-AC-A23H-01A-11D-A159-09 TCGA-AC-A23H-11A-12D-A17G-09 g.chr5:56160574G>C c.848G>C c.(847-849)aGa>aCa p.R283T BRCA 5 56160578 56160579 + Frame_Shift_Del DEL CA CA - TCGA-E2-A15O-01A-11D-A10Y-09 TCGA-E2-A15O-10A-01D-A110-09 g.chr5:56160578_56160579delCA c.852_853delCA c.(850-855)atcacafs p.T285fs BRCA 5 56160594 56160595 + Frame_Shift_Ins INS - - C TCGA-A8-A090-01A-11W-A019-09 TCGA-A8-A090-10A-01W-A021-09 g.chr5:56160594_56160595insC c.868_869insC c.(868-870)gccfs p.A290fs BRCA 5 56160644 56160644 + Frame_Shift_Del DEL C C - TCGA-BH-A1F5-01A-12D-A13L-09 TCGA-BH-A1F5-11A-43D-A13O-09 g.chr5:56160644delC c.918delC c.(916-918)cgcfs p.R307fs BRCA 5 56160679 56160680 + Frame_Shift_Ins INS - - A TCGA-A2-A0EU-01A-22W-A071-09 TCGA-A2-A0EU-10A-01W-A071-09 g.chr5:56160679_56160680insA c.953_954insA c.(952-957)ttactgfs p.L319fs BRCA 5 56160679 56160680 + Frame_Shift_Ins INS - - A TCGA-D8-A1X6-01A-11D-A14K-09 TCGA-D8-A1X6-10A-01D-A14K-09 g.chr5:56160679_56160680insA c.953_954insA c.(952-957)ttactgfs p.L319fs BRCA 5 56160697 56160700 + Frame_Shift_Del DEL CTAA CTAA - TCGA-BH-A0DT-01A-21D-A12B-09 TCGA-BH-A0DT-11A-12D-A12B-09 g.chr5:56160697_56160700delCTAA c.971_974delCTAA c.(970-975)cctaacfs p.PN324fs BRCA 5 56160701 56160701 + Missense_Mutation SNP C C A TCGA-A2-A3Y0-01A-11D-A23C-09 TCGA-A2-A3Y0-10A-01D-A23C-09 g.chr5:56160701C>A c.975C>A c.(973-975)aaC>aaA p.N325K BRCA 5 56160724 56160724 + Missense_Mutation SNP G G T TCGA-BH-A18G-01A-11D-A12B-09 TCGA-BH-A18G-10A-01D-A12B-09 g.chr5:56160724G>T c.998G>T c.(997-999)aGc>aTc p.S333I BRCA 5 56160761 56160761 + Splice_Site SNP G G A TCGA-A8-A09B-01A-11W-A019-09 TCGA-A8-A09B-10A-01W-A021-09 g.chr5:56160761G>A c.1035G>A c.(1033-1035)caG>caA p.Q345Q BRCA 5 56161239 56161240 + Frame_Shift_Ins INS - - CT TCGA-E2-A15C-01A-31D-A12B-09 TCGA-E2-A15C-10A-01D-A12B-09 g.chr5:56161239_56161240insCT c.1108_1109insCT c.(1108-1110)cctfs p.P370fs BRCA 5 56161268 56161269 + Frame_Shift_Del DEL TT TT - TCGA-D8-A3Z6-01A-11D-A23C-09 TCGA-D8-A3Z6-10A-01D-A23C-09 g.chr5:56161268_56161269delTT c.1137_1138delTT c.(1135-1140)actttafs p.L380fs BRCA 5 56161269 56161271 + In_Frame_Del DEL TTA TTA - TCGA-AC-A2FE-01A-11D-A19Y-09 TCGA-AC-A2FE-11B-22D-A19Y-09 g.chr5:56161269_56161271delTTA c.1138_1140delTTA c.(1138-1140)ttadel p.L380del BRCA 5 56161284 56161284 + Splice_Site SNP G G T TCGA-A2-A0CP-01A-11W-A050-09 TCGA-A2-A0CP-10A-01W-A055-09 g.chr5:56161284G>T c.e5+1 BRCA 5 56161678 56161678 + Missense_Mutation SNP A A G TCGA-E9-A22H-01A-11D-A159-09 TCGA-E9-A22H-10A-01D-A17G-09 g.chr5:56161678A>G c.1175A>G c.(1174-1176)tAt>tGt p.Y392C BRCA 5 56161690 56161691 + Frame_Shift_Ins INS - - T TCGA-BH-A0DT-01A-21D-A12B-09 TCGA-BH-A0DT-11A-12D-A12B-09 g.chr5:56161690_56161691insT c.1187_1188insT c.(1186-1191)cgtagcfs p.S397fs BRCA 5 56161795 56161795 + Nonsense_Mutation SNP C C A TCGA-A8-A09B-01A-11W-A019-09 TCGA-A8-A09B-10A-01W-A021-09 g.chr5:56161795C>A c.1292C>A c.(1291-1293)tCa>tAa p.S431* BRCA 5 56167801 56167802 + Frame_Shift_Ins INS - - T TCGA-A7-A0DB-01A-11D-A272-09 TCGA-A7-A0DB-10A-02D-A272-09 g.chr5:56167801_56167802insT c.1366_1367insT c.(1366-1368)cttfs p.L456fs BRCA 5 56167804 56167805 + Frame_Shift_Del DEL AC AC - TCGA-C8-A12N-01A-11D-A10Y-09 TCGA-C8-A12N-10A-01D-A110-09 g.chr5:56167804_56167805delAC c.1369_1370delAC c.(1369-1371)acafs p.T457fs BRCA 5 56168483 56168483 + Frame_Shift_Del DEL G G - TCGA-E2-A156-01A-11D-A12B-09 TCGA-E2-A156-10A-01D-A12B-09 g.chr5:56168483delG c.1439delG c.(1438-1440)agafs p.R481fs BRCA 5 56168489 56168490 + Frame_Shift_Del DEL AT AT - TCGA-JL-A3YX-01A-11D-A22X-09 TCGA-JL-A3YX-10A-01D-A22X-09 g.chr5:56168489_56168490delAT c.1445_1446delAT c.(1444-1446)aatfs p.N482fs BRCA 5 56168490 56168491 + Frame_Shift_Ins INS - - A TCGA-C8-A3M8-01A-11D-A20S-09 TCGA-C8-A3M8-10A-01D-A20S-09 g.chr5:56168490_56168491insA c.1446_1447insA c.(1447-1449)agafs p.R483fs BRCA 5 56168534 56168534 + Frame_Shift_Del DEL C C - TCGA-A2-A04N-01A-11D-A10Y-09 TCGA-A2-A04N-10A-01D-A110-09 g.chr5:56168534delC c.1490delC c.(1489-1491)tctfs p.S497fs BRCA 5 56168740 56168740 + Nonsense_Mutation SNP C C T TCGA-B6-A0IO-01A-11W-A050-09 TCGA-B6-A0IO-10A-01W-A055-09 g.chr5:56168740C>T c.1594C>T c.(1594-1596)Cga>Tga p.R532* BRCA 5 56168740 56168740 + Nonsense_Mutation SNP C C T TCGA-OK-A5Q2-01A-11D-A27P-09 TCGA-OK-A5Q2-10A-01D-A27P-09 g.chr5:56168740C>T c.1594C>T c.(1594-1596)Cga>Tga p.R532* BRCA 5 56170880 56170880 + Frame_Shift_Del DEL G G - TCGA-B6-A0IO-01A-11W-A050-09 TCGA-B6-A0IO-10A-01W-A055-09 g.chr5:56170880delG c.1708delG c.(1708-1710)ggcfs p.G570fs BRCA 5 56170931 56170932 + Frame_Shift_Ins INS - - T TCGA-AN-A0AS-01A-11W-A019-09 TCGA-AN-A0AS-10A-01W-A021-09 g.chr5:56170931_56170932insT c.1759_1760insT c.(1759-1761)cttfs p.L587fs BRCA 5 56170973 56170973 + Nonsense_Mutation SNP G G T TCGA-A2-A0CP-01A-11W-A050-09 TCGA-A2-A0CP-10A-01W-A055-09 g.chr5:56170973G>T c.1801G>T c.(1801-1803)Gag>Tag p.E601* BRCA 5 56171058 56171059 + Frame_Shift_Ins INS - - A TCGA-E9-A1R6-01A-11D-A14G-09 TCGA-E9-A1R6-10A-01D-A14G-09 g.chr5:56171058_56171059insA c.1886_1887insA c.(1885-1890)ggagatfs p.D630fs BRCA 5 56171088 56171088 + Missense_Mutation SNP T T C TCGA-BH-A0DZ-01A-11W-A019-09 TCGA-BH-A0DZ-10A-01W-A021-09 g.chr5:56171088T>C c.1916T>C c.(1915-1917)cTg>cCg p.L639P BRCA 5 56174851 56174852 + Frame_Shift_Ins INS - - GC TCGA-A7-A0DB-01A-11D-A272-09 TCGA-A7-A0DB-10A-02D-A272-09 g.chr5:56174851_56174852insGC c.2010_2011insGC c.(2011-2013)gcgfs p.A671fs BRCA 5 56174909 56174909 + Nonsense_Mutation SNP A A T TCGA-AN-A03X-01A-21W-A019-09 TCGA-AN-A03X-10A-01W-A021-09 g.chr5:56174909A>T c.2068A>T c.(2068-2070)Aaa>Taa p.K690* BRCA 5 56176548 56176548 + Nonsense_Mutation SNP C C T TCGA-B6-A0IM-01A-11W-A050-09 TCGA-B6-A0IM-10A-01W-A055-09 g.chr5:56176548C>T c.2098C>T c.(2098-2100)Cag>Tag p.Q700* BRCA 5 56176593 56176594 + Frame_Shift_Ins INS - - GA TCGA-AC-A2FF-01A-11D-A17D-09 TCGA-AC-A2FF-11A-13D-A17D-09 g.chr5:56176593_56176594insGA c.2143_2144insGA c.(2143-2145)ggafs p.G715fs BRCA 5 56176938 56176938 + Frame_Shift_Del DEL T T - TCGA-B6-A1KI-01A-11D-A14K-09 TCGA-B6-A1KI-10A-01W-A16I-09 g.chr5:56176938delT c.2208delT c.(2206-2208)tatfs p.Y736fs BRCA 5 56177010 56177011 + Frame_Shift_Ins INS - - ATAG TCGA-EW-A1J1-01A-11D-A188-09 TCGA-EW-A1J1-10A-01D-A13O-09 g.chr5:56177010_56177011insATAG c.2280_2281insATAG c.(2281-2283)atafs p.-762fs BRCA 5 56177011 56177014 + Frame_Shift_Del DEL ATAG ATAG - TCGA-BH-A42V-01A-11D-A243-09 TCGA-BH-A42V-10A-01D-A243-09 g.chr5:56177011_56177014delATAG c.2281_2284delATAG c.(2281-2286)atagatfs p.ID761fs BRCA 5 56177011 56177014 + Frame_Shift_Del DEL ATAG ATAG - TCGA-E2-A1BD-01A-11D-A12Q-09 TCGA-E2-A1BD-10A-01D-A12Q-09 g.chr5:56177011_56177014delATAG c.2281_2284delATAG c.(2281-2286)atagatfs p.ID761fs BRCA 5 56177011 56177014 + Frame_Shift_Del DEL ATAG ATAG - TCGA-E9-A1R6-01A-11D-A14G-09 TCGA-E9-A1R6-10A-01D-A14G-09 g.chr5:56177011_56177014delATAG c.2281_2284delATAG c.(2281-2286)atagatfs p.ID761fs BRCA 5 56177035 56177035 + Missense_Mutation SNP C C T TCGA-A2-A1G1-01A-21D-A13L-09 TCGA-A2-A1G1-10A-01D-A13O-09 g.chr5:56177035C>T c.2305C>T c.(2305-2307)Cct>Tct p.P769S BRCA 5 56177058 56177059 + Frame_Shift_Ins INS - - GTCA TCGA-BH-A18N-01A-11D-A12B-09 TCGA-BH-A18N-11A-43D-A12B-09 g.chr5:56177058_56177059insGTCA c.2328_2329insGTCA c.(2329-2331)gtcfs p.-778fs BRCA 5 56177099 56177099 + Splice_Site SNP G G T TCGA-D8-A1XB-01A-11D-A14G-09 TCGA-D8-A1XB-10A-01D-A14G-09 g.chr5:56177099G>T c.2369G>T c.(2368-2370)aGg>aTg p.R790M BRCA 5 56177410 56177411 + Frame_Shift_Ins INS - - T TCGA-E9-A1RD-01A-11D-A159-09 TCGA-E9-A1RD-10A-01D-A159-09 g.chr5:56177410_56177411insT c.2383_2384insT c.(2383-2385)ctgfs p.L795fs BRCA 5 56177500 56177500 + Nonsense_Mutation SNP A A T TCGA-BH-A0W5-01A-11D-A10G-09 TCGA-BH-A0W5-10A-01D-A117-09 g.chr5:56177500A>T c.2473A>T c.(2473-2475)Aga>Tga p.R825* BRCA 5 56177537 56177538 + Frame_Shift_Del DEL TG TG - TCGA-A8-A08Z-01A-21W-A019-09 TCGA-A8-A08Z-10A-01W-A021-09 g.chr5:56177537_56177538delTG c.2510_2511delTG c.(2509-2511)ctgfs p.L838fs BRCA 5 56177598 56177598 + Frame_Shift_Del DEL G G - TCGA-E2-A15G-01A-11D-A12B-09 TCGA-E2-A15G-10A-01D-A12B-09 g.chr5:56177598delG c.2571delG c.(2569-2571)atgfs p.M857fs BRCA 5 56177802 56177802 + Frame_Shift_Del DEL G G - TCGA-A7-A4SB-01A-21D-A25Q-09 TCGA-A7-A4SB-10A-01D-A25Q-09 g.chr5:56177802delG c.2775delG c.(2773-2775)gagfs p.E925fs BRCA 5 56177874 56177875 + Frame_Shift_Del DEL AG AG - TCGA-A8-A086-01A-11W-A019-09 TCGA-A8-A086-10A-01W-A021-09 g.chr5:56177874_56177875delAG c.2847_2848delAG c.(2845-2850)acagagfs p.E950fs BRCA 5 56177954 56177954 + Missense_Mutation SNP C C T TCGA-E9-A1N9-01A-11D-A14G-09 TCGA-E9-A1N9-10A-01D-A14G-09 g.chr5:56177954C>T c.2927C>T c.(2926-2928)tCc>tTc p.S976F BRCA 5 56178024 56178027 + Frame_Shift_Del DEL AGAT AGAT - TCGA-AN-A049-01A-21W-A019-09 TCGA-AN-A049-10A-01W-A021-09 g.chr5:56178024_56178027delAGAT c.2997_3000delAGAT c.(2995-3000)acagatfs p.TD999fs BRCA 5 56178085 56178085 + Nonsense_Mutation SNP C C T TCGA-E2-A1B4-01A-11D-A12Q-09 TCGA-E2-A1B4-10A-01D-A12Q-09 g.chr5:56178085C>T c.3058C>T c.(3058-3060)Caa>Taa p.Q1020* BRCA 5 56178135 56178136 + Frame_Shift_Ins INS - - A TCGA-A1-A0SG-01A-11D-A142-09 TCGA-A1-A0SG-10B-01D-A17G-09 g.chr5:56178135_56178136insA c.3108_3109insA c.(3109-3111)aaafs p.K1037fs BRCA 5 56178143 56178144 + Frame_Shift_Ins INS - - A TCGA-EW-A1P6-01A-11D-A142-09 TCGA-EW-A1P6-10A-01D-A142-09 g.chr5:56178143_56178144insA c.3116_3117insA c.(3115-3120)tcagatfs p.D1040fs BRCA 5 56178146 56178146 + Frame_Shift_Del DEL A A - TCGA-A8-A07F-01A-11W-A019-09 TCGA-A8-A07F-10A-01W-A021-09 g.chr5:56178146delA c.3119delA c.(3118-3120)gatfs p.D1040fs BRCA 5 56178150 56178153 + Frame_Shift_Del DEL ACTT ACTT - TCGA-A8-A07F-01A-11W-A019-09 TCGA-A8-A07F-10A-01W-A021-09 g.chr5:56178150_56178153delACTT c.3123_3126delACTT c.(3121-3126)aaacttfs p.KL1041fs BRCA 5 56178169 56178169 + Nonsense_Mutation SNP C C T TCGA-A8-A08Z-01A-21W-A019-09 TCGA-A8-A08Z-10A-01W-A021-09 g.chr5:56178169C>T c.3142C>T c.(3142-3144)Cag>Tag p.Q1048* BRCA 5 56178169 56178169 + Nonsense_Mutation SNP C C T TCGA-BH-A1F5-01A-12D-A13L-09 TCGA-BH-A1F5-11A-43D-A13O-09 g.chr5:56178169C>T c.3142C>T c.(3142-3144)Cag>Tag p.Q1048* BRCA 5 56178253 56178253 + Frame_Shift_Del DEL C C - TCGA-BH-A0W5-01A-11D-A10G-09 TCGA-BH-A0W5-10A-01D-A117-09 g.chr5:56178253delC c.3226delC c.(3226-3228)cccfs p.P1076fs BRCA 5 56178257 56178257 + Nonsense_Mutation SNP C C G TCGA-A2-A0YK-01A-22D-A117-09 TCGA-A2-A0YK-10A-01D-A117-09 g.chr5:56178257C>G c.3230C>G c.(3229-3231)tCa>tGa p.S1077* BRCA 5 56178399 56178400 + Frame_Shift_Ins INS - - T TCGA-A8-A06P-01A-11W-A019-09 TCGA-A8-A06P-10A-01W-A021-09 g.chr5:56178399_56178400insT c.3372_3373insT c.(3373-3375)aatfs p.N1125fs BRCA 5 56178400 56178400 + Missense_Mutation SNP A A G TCGA-A8-A06P-01A-11W-A019-09 TCGA-A8-A06P-10A-01W-A021-09 g.chr5:56178400A>G c.3373A>G c.(3373-3375)Aat>Gat p.N1125D BRCA 5 56178411 56178411 + Silent SNP C C T TCGA-A8-A08H-01A-21W-A019-09 TCGA-A8-A08H-10A-01W-A021-09 g.chr5:56178411C>T c.3384C>T c.(3382-3384)ctC>ctT p.L1128L BRCA 5 56178459 56178460 + Frame_Shift_Ins INS - - A TCGA-E9-A1RD-01A-11D-A159-09 TCGA-E9-A1RD-10A-01D-A159-09 g.chr5:56178459_56178460insA c.3432_3433insA c.(3433-3435)acafs p.T1145fs BRCA 5 56178466 56178467 + Frame_Shift_Ins INS - - T TCGA-E2-A1B4-01A-11D-A12Q-09 TCGA-E2-A1B4-10A-01D-A12Q-09 g.chr5:56178466_56178467insT c.3439_3440insT c.(3439-3441)gtafs p.V1147fs BRCA 5 56178571 56178571 + Nonsense_Mutation SNP G G T TCGA-BH-A18M-01A-11D-A12B-09 TCGA-BH-A18M-11A-33D-A12B-09 g.chr5:56178571G>T c.3544G>T c.(3544-3546)Gaa>Taa p.E1182* BRCA 5 56178577 56178577 + Nonsense_Mutation SNP G G T TCGA-E9-A1N4-01A-11D-A14K-09 TCGA-E9-A1N4-10A-01D-A14K-09 g.chr5:56178577G>T c.3550G>T c.(3550-3552)Gaa>Taa p.E1184* BRCA 5 56178637 56178638 + Frame_Shift_Del DEL AT AT - TCGA-AO-A0J7-01A-11W-A050-09 TCGA-AO-A0J7-10A-01W-A055-09 g.chr5:56178637_56178638delAT c.3610_3611delAT c.(3610-3612)atafs p.I1204fs BRCA 5 56178672 56178673 + Frame_Shift_Ins INS - - A TCGA-A2-A0YD-01A-11D-A10G-09 TCGA-A2-A0YD-10A-01D-A10G-09 g.chr5:56178672_56178673insA c.3645_3646insA c.(3646-3648)atcfs p.I1216fs BRCA 5 56179396 56179396 + Missense_Mutation SNP T T A TCGA-D8-A1XB-01A-11D-A14G-09 TCGA-D8-A1XB-10A-01D-A14G-09 g.chr5:56179396T>A c.3709T>A c.(3709-3711)Tat>Aat p.Y1237N BRCA 5 56179424 56179425 + Frame_Shift_Ins INS - - T TCGA-E2-A1BD-01A-11D-A12Q-09 TCGA-E2-A1BD-10A-01D-A12Q-09 g.chr5:56179424_56179425insT c.3737_3738insT c.(3736-3741)ggtcaafs p.Q1247fs BRCA 5 56179458 56179458 + Frame_Shift_Del DEL T T - TCGA-A7-A5ZW-01A-12D-A29N-09 TCGA-A7-A5ZW-10A-01D-A29N-09 g.chr5:56179458delT c.3771delT c.(3769-3771)tgtfs p.C1257fs BRCA 5 56180496 56180496 + Frame_Shift_Del DEL T T - TCGA-EW-A1OY-01A-11D-A142-09 TCGA-EW-A1OY-10A-01W-A187-09 g.chr5:56180496delT c.3825delT c.(3823-3825)actfs p.T1275fs BRCA 5 56180503 56180504 + Frame_Shift_Del DEL AG AG - TCGA-AN-A03X-01A-21W-A019-09 TCGA-AN-A03X-10A-01W-A021-09 g.chr5:56180503_56180504delAG c.3832_3833delAG c.(3832-3834)agafs p.R1278fs BRCA 5 56180536 56180537 + Frame_Shift_Ins INS - - A TCGA-D8-A27L-01A-11D-A16D-09 TCGA-D8-A27L-10A-01D-A16D-09 g.chr5:56180536_56180537insA c.3865_3866insA c.(3865-3867)gaafs p.E1289fs BRCA 5 56180586 56180588 + In_Frame_Del DEL CAT CAT - TCGA-D8-A27L-01A-11D-A16D-09 TCGA-D8-A27L-10A-01D-A16D-09 g.chr5:56180586_56180588delCAT c.3915_3917delCAT c.(3913-3918)aacatc>aac p.I1307del BRCA 5 56181765 56181765 + Missense_Mutation SNP C C G TCGA-A2-A0EU-01A-22W-A071-09 TCGA-A2-A0EU-10A-01W-A071-09 g.chr5:56181765C>G c.3989C>G c.(3988-3990)tCg>tGg p.S1330W BRCA 5 56181807 56181807 + Nonsense_Mutation SNP C C G TCGA-JL-A3YX-01A-11D-A22X-09 TCGA-JL-A3YX-10A-01D-A22X-09 g.chr5:56181807C>G c.4031C>G c.(4030-4032)tCa>tGa p.S1344* BRCA 5 56181812 56181814 + In_Frame_Del DEL GTT GTT - TCGA-A2-A04N-01A-11D-A10Y-09 TCGA-A2-A04N-10A-01D-A110-09 g.chr5:56181812_56181814delGTT c.4036_4038delGTT c.(4036-4038)gttdel p.V1346del BRCA 5 56181812 56181814 + In_Frame_Del DEL GTT GTT - TCGA-A2-A0YF-01A-21D-A10G-09 TCGA-A2-A0YF-10A-01D-A10G-09 g.chr5:56181812_56181814delGTT c.4036_4038delGTT c.(4036-4038)gttdel p.V1346del BRCA 5 56183211 56183211 + Missense_Mutation SNP A A G TCGA-A2-A04N-01A-11D-A10Y-09 TCGA-A2-A04N-10A-01D-A110-09 g.chr5:56183211A>G c.4121A>G c.(4120-4122)aAt>aGt p.N1374S BRCA 5 56183240 56183241 + Frame_Shift_Ins INS - - T TCGA-BH-A0BO-01A-23D-A12B-09 TCGA-BH-A0BO-10A-01D-A12B-09 g.chr5:56183240_56183241insT c.4150_4151insT c.(4150-4152)ctafs p.L1384fs BRCA 5 56183240 56183241 + Frame_Shift_Ins INS - - T TCGA-D8-A1XA-01A-11D-A14G-09 TCGA-D8-A1XA-10A-01D-A14G-09 g.chr5:56183240_56183241insT c.4150_4151insT c.(4150-4152)ctafs p.L1384fs BRCA 5 56183296 56183297 + Frame_Shift_Ins INS - - G TCGA-BH-A0BO-01A-23D-A12B-09 TCGA-BH-A0BO-10A-01D-A12B-09 g.chr5:56183296_56183297insG c.4206_4207insG c.(4207-4209)ggafs p.G1403fs BRCA 5 56183311 56183311 + Frame_Shift_Del DEL A A - TCGA-A8-A082-01A-11W-A019-09 TCGA-A8-A082-10A-01W-A021-09 g.chr5:56183311delA c.4221delA c.(4219-4221)ggafs p.G1407fs BRCA 5 56183347 56183347 + Splice_Site SNP G G A TCGA-AO-A0JF-01A-11W-A071-09 TCGA-AO-A0JF-10A-01W-A071-09 g.chr5:56183347G>A c.4257G>A c.(4255-4257)gaG>gaA p.E1419E BRCA 5 56184093 56184093 + Missense_Mutation SNP G G C TCGA-A2-A259-01A-11D-A16D-09 TCGA-A2-A259-10A-01D-A16D-09 g.chr5:56184093G>C c.4298G>C c.(4297-4299)tGg>tCg p.W1433S BRCA 5 56184105 56184105 + Missense_Mutation SNP G G C TCGA-D8-A1JH-01A-11D-A188-09 TCGA-D8-A1JH-10A-01D-A13O-09 g.chr5:56184105G>C c.4310G>C c.(4309-4311)tGt>tCt p.C1437S BRCA 5 56184105 56184105 + Missense_Mutation SNP G G T TCGA-A2-A04N-01A-11D-A10Y-09 TCGA-A2-A04N-10A-01D-A110-09 g.chr5:56184105G>T c.4310G>T c.(4309-4311)tGt>tTt p.C1437F BRCA 5 56189387 56189387 + Frame_Shift_Del DEL C C - TCGA-A8-A06P-01A-11W-A019-09 TCGA-A8-A06P-10A-01W-A021-09 g.chr5:56189387delC c.4419delC c.(4417-4419)atcfs p.I1473fs BRCA 5 56189440 56189440 + Missense_Mutation SNP T T A TCGA-C8-A12N-01A-11D-A10Y-09 TCGA-C8-A12N-10A-01D-A110-09 g.chr5:56189440T>A c.4472T>A c.(4471-4473)cTt>cAt p.L1491H BRCA 5 56189442 56189442 + Frame_Shift_Del DEL C C - TCGA-B6-A0IM-01A-11W-A050-09 TCGA-B6-A0IM-10A-01W-A055-09 g.chr5:56189442delC c.4474delC c.(4474-4476)caafs p.Q1492fs CESC 5 56155681 56155681 + Missense_Mutation SNP C C T TCGA-IR-A3LA-01A-11D-A22X-09 TCGA-IR-A3LA-10A-01D-A22X-09 g.chr5:56155681C>T c.773C>T c.(772-774)tCa>tTa p.S258L CESC 5 56174810 56174810 + Missense_Mutation SNP A A G TCGA-JW-A69B-01A-11D-A32I-09 TCGA-JW-A69B-10A-01D-A32I-09 g.chr5:56174810A>G c.1969A>G c.(1969-1971)Aca>Gca p.T657A CESC 5 56177460 56177460 + Missense_Mutation SNP G G T TCGA-Q1-A73P-01A-11D-A32I-09 TCGA-Q1-A73P-10B-01D-A32I-09 g.chr5:56177460G>T c.2433G>T c.(2431-2433)atG>atT p.M811I CESC 5 56177814 56177814 + Silent SNP G G A TCGA-Q1-A73O-01A-11D-A32I-09 TCGA-Q1-A73O-10B-01D-A32I-09 g.chr5:56177814G>A c.2787G>A c.(2785-2787)gaG>gaA p.E929E CESC 5 56184171 56184171 + Missense_Mutation SNP C C T TCGA-EA-A3HU-01A-11D-A20U-09 TCGA-EA-A3HU-10B-01D-A20U-09 g.chr5:56184171C>T c.4376C>T c.(4375-4377)gCt>gTt p.A1459V CHOL 5 56178366 56178366 + Silent SNP C C T TCGA-3X-AAV9-01A-72D-A417-09 TCGA-3X-AAV9-10A-01D-A41A-09 g.chr5:56178366C>T c.3339C>T c.(3337-3339)ttC>ttT p.F1113F COAD 5 56152566 56152566 + Nonsense_Mutation SNP C C T TCGA-AZ-6598-01A-11D-1771-10 TCGA-AZ-6598-11A-01D-1771-10 g.chr5:56152566C>T c.622C>T c.(622-624)Cga>Tga p.R208* COAD 5 56160643 56160643 + Missense_Mutation SNP G G A TCGA-AA-A022-01A-21W-A096-10 TCGA-AA-A022-11A-11W-A096-10 g.chr5:56160643G>A c.917G>A c.(916-918)cGc>cAc p.R306H COAD 5 56161183 56161183 + Missense_Mutation SNP G G A TCGA-G4-6628-01A-11D-1835-10 TCGA-G4-6628-10A-01D-1835-10 g.chr5:56161183G>A c.1052G>A c.(1051-1053)cGt>cAt p.R351H COAD 5 56161771 56161771 + Nonsense_Mutation SNP C C A TCGA-AA-A010-01A-01W-A00E-09 TCGA-AA-A010-10A-01W-A00E-09 g.chr5:56161771C>A c.1268C>A c.(1267-1269)tCa>tAa p.S423* COAD 5 56170877 56170877 + Missense_Mutation SNP G G A TCGA-AA-A01R-01A-21W-A096-10 TCGA-AA-A01R-11A-12W-A096-10 g.chr5:56170877G>A c.1705G>A c.(1705-1707)Gtt>Att p.V569I COAD 5 56171125 56171125 + Silent SNP C C T TCGA-AA-3715-01A-01W-0900-09 TCGA-AA-3715-10A-01W-0900-09 g.chr5:56171125C>T c.1953C>T c.(1951-1953)taC>taT p.Y651Y COAD 5 56174817 56174817 + Missense_Mutation SNP G G C TCGA-CA-5254-01A-21D-1835-10 TCGA-CA-5254-10A-01D-1835-10 g.chr5:56174817G>C c.1976G>C c.(1975-1977)aGa>aCa p.R659T COAD 5 56174855 56174855 + Missense_Mutation SNP G G A TCGA-CA-5254-01A-21D-1835-10 TCGA-CA-5254-10A-01D-1835-10 g.chr5:56174855G>A c.2014G>A c.(2014-2016)Gaa>Aaa p.E672K COAD 5 56176934 56176934 + Missense_Mutation SNP A A T TCGA-AZ-6598-01A-11D-1771-10 TCGA-AZ-6598-11A-01D-1771-10 g.chr5:56176934A>T c.2204A>T c.(2203-2205)gAt>gTt p.D735V COAD 5 56176939 56176939 + Missense_Mutation SNP G G A TCGA-A6-6654-01A-21D-1835-10 TCGA-A6-6654-10A-01D-1835-10 g.chr5:56176939G>A c.2209G>A c.(2209-2211)Gtc>Atc p.V737I COAD 5 56176980 56176980 + Missense_Mutation SNP T T A TCGA-A6-5661-01A-01D-1650-10 TCGA-A6-5661-10A-01D-1650-10 g.chr5:56176980T>A c.2250T>A c.(2248-2250)aaT>aaA p.N750K COAD 5 56177046 56177046 + Missense_Mutation SNP T T G TCGA-CA-6717-01A-11D-1835-10 TCGA-CA-6717-10A-01D-1835-10 g.chr5:56177046T>G c.2316T>G c.(2314-2316)ttT>ttG p.F772L COAD 5 56177644 56177644 + Missense_Mutation SNP G G A TCGA-AA-3864-01A-01W-0995-10 TCGA-AA-3864-10A-01W-0995-10 g.chr5:56177644G>A c.2617G>A c.(2617-2619)Gta>Ata p.V873I COAD 5 56178055 56178055 + Missense_Mutation SNP A A G TCGA-CK-6746-01A-11D-1835-10 TCGA-CK-6746-10A-01D-1835-10 g.chr5:56178055A>G c.3028A>G c.(3028-3030)Att>Gtt p.I1010V COAD 5 56178351 56178351 + Silent SNP T T C TCGA-AA-3877-01A-01W-0995-10 TCGA-AA-3877-10A-01W-0995-10 g.chr5:56178351T>C c.3324T>C c.(3322-3324)agT>agC p.S1108S COAD 5 56180602 56180602 + Nonsense_Mutation SNP G G T TCGA-A6-5665-01A-01D-1650-10 TCGA-A6-5665-10A-01D-1650-10 g.chr5:56180602G>T c.3931G>T c.(3931-3933)Gga>Tga p.G1311* COAD 5 56180651 56180651 + Missense_Mutation SNP C C T TCGA-AA-A01R-01A-21W-A096-10 TCGA-AA-A01R-11A-12W-A096-10 g.chr5:56180651C>T c.3980C>T c.(3979-3981)gCa>gTa p.A1327V COAD 5 56181765 56181765 + Missense_Mutation SNP C C T TCGA-A6-6141-01A-11D-1771-10 TCGA-A6-6141-10A-01D-1771-10 g.chr5:56181765C>T c.3989C>T c.(3988-3990)tCg>tTg p.S1330L COAD 5 56189359 56189359 + Splice_Site SNP T T G TCGA-AZ-4315-01A-01D-1408-10 TCGA-AZ-4315-10A-01D-1408-10 g.chr5:56189359T>G c.4391T>G c.(4390-4392)aTt>aGt p.I1464S COAD 5 56189427 56189427 + Missense_Mutation SNP C C T TCGA-AA-A010-01A-01W-A00E-09 TCGA-AA-A010-10A-01W-A00E-09 g.chr5:56189427C>T c.4459C>T c.(4459-4461)Cgt>Tgt p.R1487C COADREAD 5 56152566 56152566 + Nonsense_Mutation SNP C C T TCGA-AZ-6598-01A-11D-1771-10 TCGA-AZ-6598-11A-01D-1771-10 g.chr5:56152566C>T c.622C>T c.(622-624)Cga>Tga p.R208* COADREAD 5 56160643 56160643 + Missense_Mutation SNP G G A TCGA-AA-A022-01A-21W-A096-10 TCGA-AA-A022-11A-11W-A096-10 g.chr5:56160643G>A c.917G>A c.(916-918)cGc>cAc p.R306H COADREAD 5 56161183 56161183 + Missense_Mutation SNP G G A TCGA-G4-6628-01A-11D-1835-10 TCGA-G4-6628-10A-01D-1835-10 g.chr5:56161183G>A c.1052G>A c.(1051-1053)cGt>cAt p.R351H COADREAD 5 56161771 56161771 + Nonsense_Mutation SNP C C A TCGA-AA-A010-01A-01W-A00E-09 TCGA-AA-A010-10A-01W-A00E-09 g.chr5:56161771C>A c.1268C>A c.(1267-1269)tCa>tAa p.S423* COADREAD 5 56168531 56168531 + Missense_Mutation SNP G G T TCGA-AG-A002-01A-01W-A00K-09 TCGA-AG-A002-10A-01W-A00K-09 g.chr5:56168531G>T c.1487G>T c.(1486-1488)aGa>aTa p.R496I COADREAD 5 56170877 56170877 + Missense_Mutation SNP G G A TCGA-AA-A01R-01A-21W-A096-10 TCGA-AA-A01R-11A-12W-A096-10 g.chr5:56170877G>A c.1705G>A c.(1705-1707)Gtt>Att p.V569I COADREAD 5 56171125 56171125 + Silent SNP C C T TCGA-AA-3715-01A-01W-0900-09 TCGA-AA-3715-10A-01W-0900-09 g.chr5:56171125C>T c.1953C>T c.(1951-1953)taC>taT p.Y651Y COADREAD 5 56174817 56174817 + Missense_Mutation SNP G G C TCGA-CA-5254-01A-21D-1835-10 TCGA-CA-5254-10A-01D-1835-10 g.chr5:56174817G>C c.1976G>C c.(1975-1977)aGa>aCa p.R659T COADREAD 5 56174855 56174855 + Missense_Mutation SNP G G A TCGA-CA-5254-01A-21D-1835-10 TCGA-CA-5254-10A-01D-1835-10 g.chr5:56174855G>A c.2014G>A c.(2014-2016)Gaa>Aaa p.E672K COADREAD 5 56176934 56176934 + Missense_Mutation SNP A A T TCGA-AZ-6598-01A-11D-1771-10 TCGA-AZ-6598-11A-01D-1771-10 g.chr5:56176934A>T c.2204A>T c.(2203-2205)gAt>gTt p.D735V COADREAD 5 56176939 56176939 + Missense_Mutation SNP G G A TCGA-A6-6654-01A-21D-1835-10 TCGA-A6-6654-10A-01D-1835-10 g.chr5:56176939G>A c.2209G>A c.(2209-2211)Gtc>Atc p.V737I COADREAD 5 56176939 56176939 + Missense_Mutation SNP G G T TCGA-EI-6507-01A-11D-1733-10 TCGA-EI-6507-10A-01D-1733-10 g.chr5:56176939G>T c.2209G>T c.(2209-2211)Gtc>Ttc p.V737F COADREAD 5 56176980 56176980 + Missense_Mutation SNP T T A TCGA-A6-5661-01A-01D-1650-10 TCGA-A6-5661-10A-01D-1650-10 g.chr5:56176980T>A c.2250T>A c.(2248-2250)aaT>aaA p.N750K COADREAD 5 56176993 56176993 + Missense_Mutation SNP C C A TCGA-AG-A002-01A-01W-A00K-09 TCGA-AG-A002-10A-01W-A00K-09 g.chr5:56176993C>A c.2263C>A c.(2263-2265)Ctt>Att p.L755I COADREAD 5 56177046 56177046 + Missense_Mutation SNP T T G TCGA-CA-6717-01A-11D-1835-10 TCGA-CA-6717-10A-01D-1835-10 g.chr5:56177046T>G c.2316T>G c.(2314-2316)ttT>ttG p.F772L COADREAD 5 56177644 56177644 + Missense_Mutation SNP G G A TCGA-AA-3864-01A-01W-0995-10 TCGA-AA-3864-10A-01W-0995-10 g.chr5:56177644G>A c.2617G>A c.(2617-2619)Gta>Ata p.V873I COADREAD 5 56178055 56178055 + Missense_Mutation SNP A A G TCGA-CK-6746-01A-11D-1835-10 TCGA-CK-6746-10A-01D-1835-10 g.chr5:56178055A>G c.3028A>G c.(3028-3030)Att>Gtt p.I1010V COADREAD 5 56178351 56178351 + Silent SNP T T C TCGA-AA-3877-01A-01W-0995-10 TCGA-AA-3877-10A-01W-0995-10 g.chr5:56178351T>C c.3324T>C c.(3322-3324)agT>agC p.S1108S COADREAD 5 56180602 56180602 + Nonsense_Mutation SNP G G T TCGA-A6-5665-01A-01D-1650-10 TCGA-A6-5665-10A-01D-1650-10 g.chr5:56180602G>T c.3931G>T c.(3931-3933)Gga>Tga p.G1311* COADREAD 5 56180651 56180651 + Missense_Mutation SNP C C T TCGA-AA-A01R-01A-21W-A096-10 TCGA-AA-A01R-11A-12W-A096-10 g.chr5:56180651C>T c.3980C>T c.(3979-3981)gCa>gTa p.A1327V COADREAD 5 56181765 56181765 + Missense_Mutation SNP C C T TCGA-A6-6141-01A-11D-1771-10 TCGA-A6-6141-10A-01D-1771-10 g.chr5:56181765C>T c.3989C>T c.(3988-3990)tCg>tTg p.S1330L COADREAD 5 56189359 56189359 + Splice_Site SNP T T G TCGA-AZ-4315-01A-01D-1408-10 TCGA-AZ-4315-10A-01D-1408-10 g.chr5:56189359T>G c.4391T>G c.(4390-4392)aTt>aGt p.I1464S COADREAD 5 56189427 56189427 + Missense_Mutation SNP C C T TCGA-AA-A010-01A-01W-A00E-09 TCGA-AA-A010-10A-01W-A00E-09 g.chr5:56189427C>T c.4459C>T c.(4459-4461)Cgt>Tgt p.R1487C DLBC 5 56155672 56155672 + Missense_Mutation SNP A A G TCGA-G8-6325-01A-11D-2210-10 TCGA-G8-6325-10A-01D-2210-10 g.chr5:56155672A>G c.764A>G c.(763-765)aAc>aGc p.N255S DLBC 5 56155672 56155672 + Missense_Mutation SNP A A G TCGA-G8-6909-01A-11D-2210-10 TCGA-G8-6909-14A-01D-2210-10 g.chr5:56155672A>G c.764A>G c.(763-765)aAc>aGc p.N255S DLBC 5 56177843 56177843 + Missense_Mutation SNP C C G TCGA-G8-6907-01A-11D-2210-10 TCGA-G8-6907-14A-01D-2210-10 g.chr5:56177843C>G c.2816C>G c.(2815-2817)tCt>tGt p.S939C DLBC 5 56178615 56178615 + Silent SNP A A C TCGA-GR-7351-01A-11D-2210-10 TCGA-GR-7351-10A-01D-2210-10 g.chr5:56178615A>C c.3588A>C c.(3586-3588)tcA>tcC p.S1196S ESCA 5 56152526 56152526 + Missense_Mutation SNP G G A TCGA-VR-A8EW-01A-11D-A36J-09 TCGA-VR-A8EW-10A-01D-A36M-09 g.chr5:56152526G>A c.582G>A c.(580-582)atG>atA p.M194I ESCA 5 56161771 56161771 + Nonsense_Mutation SNP C C A TCGA-VR-A8EZ-01A-11D-A36J-09 TCGA-VR-A8EZ-10A-01D-A36M-09 g.chr5:56161771C>A c.1268C>A c.(1267-1269)tCa>tAa p.S423* ESCA 5 56167793 56167793 + Missense_Mutation SNP A A T TCGA-M9-A5M8-01A-11D-A28B-09 TCGA-M9-A5M8-10A-01D-A28E-09 g.chr5:56167793A>T c.1358A>T c.(1357-1359)gAa>gTa p.E453V ESCA 5 56174810 56174810 + Missense_Mutation SNP A A G TCGA-LN-A4A4-01A-11D-A27G-09 TCGA-LN-A4A4-10A-01D-A27G-09 g.chr5:56174810A>G c.1969A>G c.(1969-1971)Aca>Gca p.T657A ESCA 5 56177702 56177702 + Missense_Mutation SNP A A G TCGA-L5-A8NM-01A-11D-A37C-09 TCGA-L5-A8NM-11A-12D-A37F-09 g.chr5:56177702A>G c.2675A>G c.(2674-2676)aAc>aGc p.N892S ESCA 5 56177848 56177849 + In_Frame_Ins INS - - CAA TCGA-L5-A4OI-01A-11D-A27G-09 TCGA-L5-A4OI-11A-11D-A27G-09 g.chr5:56177848_56177849insCAA c.2821_2822insCAA c.(2821-2823)tca>tCAAca p.949_950insT ESCA 5 56179413 56179413 + Silent SNP A A G TCGA-VR-A8EZ-01A-11D-A36J-09 TCGA-VR-A8EZ-10A-01D-A36M-09 g.chr5:56179413A>G c.3726A>G c.(3724-3726)gaA>gaG p.E1242E ESCA 5 56180554 56180554 + Frame_Shift_Del DEL A A - TCGA-LN-A49P-01A-11D-A247-09 TCGA-LN-A49P-10A-01D-A247-09 g.chr5:56180554delA c.3883delA c.(3883-3885)atafs p.I1295fs ESCA 5 56181839 56181839 + Missense_Mutation SNP C C T TCGA-JY-A6F8-01A-11D-A33E-09 TCGA-JY-A6F8-10A-01D-A33H-09 g.chr5:56181839C>T c.4063C>T c.(4063-4065)Cgt>Tgt p.R1355C ESCA 5 56189381 56189381 + Silent SNP A A G TCGA-IG-A3I8-01A-11D-A247-09 TCGA-IG-A3I8-10A-01D-A247-09 g.chr5:56189381A>G c.4413A>G c.(4411-4413)ccA>ccG p.P1471P GBM 5 56160697 56160697 + Missense_Mutation SNP C C T TCGA-06-0214-01A-02D-1491-08 TCGA-06-0214-10A-01D-1491-08 g.chr5:56160697C>T c.971C>T c.(970-972)cCt>cTt p.P324L GBM 5 56160697 56160697 + Missense_Mutation SNP C C T TCGA-12-0619-01A-01D-1492-08 TCGA-12-0619-10A-01D-1492-08 g.chr5:56160697C>T c.971C>T c.(970-972)cCt>cTt p.P324L GBM 5 56160697 56160697 + Missense_Mutation SNP C C T TCGA-14-0790-01B-01D-1494-08 TCGA-14-0790-10A-01D-1494-08 g.chr5:56160697C>T c.971C>T c.(970-972)cCt>cTt p.P324L GBM 5 56168506 56168506 + Missense_Mutation SNP T T C TCGA-06-2559-01A-01D-1494-08 TCGA-06-2559-10A-01D-1494-08 g.chr5:56168506T>C c.1462T>C c.(1462-1464)Tgt>Cgt p.C488R GBM 5 56168509 56168509 + Missense_Mutation SNP C C T TCGA-06-0743-01A-01D-1492-08 TCGA-06-0743-10A-01D-1492-08 g.chr5:56168509C>T c.1465C>T c.(1465-1467)Ccc>Tcc p.P489S GBM 5 56176540 56176540 + Missense_Mutation SNP G G A TCGA-26-6173-01A-11D-1845-08 TCGA-26-6173-10A-01D-1845-08 g.chr5:56176540G>A c.2090G>A c.(2089-2091)cGc>cAc p.R697H GBM 5 56177898 56177898 + Silent SNP A A G TCGA-06-2570-01A-01D-1495-08 TCGA-06-2570-10A-01D-1495-08 g.chr5:56177898A>G c.2871A>G c.(2869-2871)caA>caG p.Q957Q GBM 5 56179395 56179395 + Silent SNP G G A TCGA-41-2573-01A-01D-1495-08 TCGA-41-2573-10A-01D-1495-08 g.chr5:56179395G>A c.3708G>A c.(3706-3708)ccG>ccA p.P1236P GBMLGG 5 56160646 56160646 + Missense_Mutation SNP G G A TCGA-DU-6392-01A-11D-1705-08 TCGA-DU-6392-10A-01D-1705-08 g.chr5:56160646G>A c.920G>A c.(919-921)cGt>cAt p.R307H GBMLGG 5 56160697 56160697 + Missense_Mutation SNP C C T TCGA-06-0214-01A-02D-1491-08 TCGA-06-0214-10A-01D-1491-08 g.chr5:56160697C>T c.971C>T c.(970-972)cCt>cTt p.P324L GBMLGG 5 56160697 56160697 + Missense_Mutation SNP C C T TCGA-12-0619-01A-01D-1492-08 TCGA-12-0619-10A-01D-1492-08 g.chr5:56160697C>T c.971C>T c.(970-972)cCt>cTt p.P324L GBMLGG 5 56160697 56160697 + Missense_Mutation SNP C C T TCGA-14-0790-01B-01D-1494-08 TCGA-14-0790-10A-01D-1494-08 g.chr5:56160697C>T c.971C>T c.(970-972)cCt>cTt p.P324L GBMLGG 5 56168506 56168506 + Missense_Mutation SNP T T C TCGA-06-2559-01A-01D-1494-08 TCGA-06-2559-10A-01D-1494-08 g.chr5:56168506T>C c.1462T>C c.(1462-1464)Tgt>Cgt p.C488R GBMLGG 5 56168509 56168509 + Missense_Mutation SNP C C T TCGA-06-0743-01A-01D-1492-08 TCGA-06-0743-10A-01D-1492-08 g.chr5:56168509C>T c.1465C>T c.(1465-1467)Ccc>Tcc p.P489S GBMLGG 5 56176540 56176540 + Missense_Mutation SNP G G A TCGA-26-6173-01A-11D-1845-08 TCGA-26-6173-10A-01D-1845-08 g.chr5:56176540G>A c.2090G>A c.(2089-2091)cGc>cAc p.R697H GBMLGG 5 56177898 56177898 + Silent SNP A A G TCGA-06-2570-01A-01D-1495-08 TCGA-06-2570-10A-01D-1495-08 g.chr5:56177898A>G c.2871A>G c.(2869-2871)caA>caG p.Q957Q GBMLGG 5 56178277 56178277 + Missense_Mutation SNP G G A TCGA-DU-A5TU-01A-11D-A289-08 TCGA-DU-A5TU-10A-01D-A289-08 g.chr5:56178277G>A c.3250G>A c.(3250-3252)Gat>Aat p.D1084N GBMLGG 5 56179395 56179395 + Silent SNP G G A TCGA-41-2573-01A-01D-1495-08 TCGA-41-2573-10A-01D-1495-08 g.chr5:56179395G>A c.3708G>A c.(3706-3708)ccG>ccA p.P1236P GBMLGG 5 56181765 56181765 + Missense_Mutation SNP C C T TCGA-DU-7304-01A-12D-2086-08 TCGA-DU-7304-10A-01D-2086-08 g.chr5:56181765C>T c.3989C>T c.(3988-3990)tCg>tTg p.S1330L GBMLGG 5 56181881 56181881 + Missense_Mutation SNP G G T TCGA-DU-6392-01A-11D-1705-08 TCGA-DU-6392-10A-01D-1705-08 g.chr5:56181881G>T c.4105G>T c.(4105-4107)Gat>Tat p.D1369Y HNSC 5 56152466 56152466 + Silent SNP C C T TCGA-CV-6942-01A-21D-2012-08 TCGA-CV-6942-10A-01D-2013-08 g.chr5:56152466C>T c.522C>T c.(520-522)caC>caT p.H174H HNSC 5 56167806 56167806 + Silent SNP A A T TCGA-CV-7430-01A-11D-2129-08 TCGA-CV-7430-10A-01D-2129-08 g.chr5:56167806A>T c.1371A>T c.(1369-1371)acA>acT p.T457T HNSC 5 56167859 56167859 + Splice_Site SNP G G T TCGA-F7-A61S-01A-11D-A28R-08 TCGA-F7-A61S-10A-01D-A28U-08 g.chr5:56167859G>T c.e7+1 HNSC 5 56168720 56168720 + Missense_Mutation SNP A A T TCGA-CV-7245-01A-11D-2012-08 TCGA-CV-7245-10A-01D-2013-08 g.chr5:56168720A>T c.1574A>T c.(1573-1575)cAg>cTg p.Q525L HNSC 5 56170929 56170929 + Missense_Mutation SNP G G A TCGA-BA-5149-01A-01D-1512-08 TCGA-BA-5149-10A-01D-1512-08 g.chr5:56170929G>A c.1757G>A c.(1756-1758)cGt>cAt p.R586H HNSC 5 56174863 56174863 + Missense_Mutation SNP C C G TCGA-P3-A5QF-01A-11D-A28R-08 TCGA-P3-A5QF-10A-01D-A28U-08 g.chr5:56174863C>G c.2022C>G c.(2020-2022)atC>atG p.I674M HNSC 5 56177591 56177591 + Missense_Mutation SNP G G A TCGA-D6-A6EP-01A-11D-A31L-08 TCGA-D6-A6EP-10A-01D-A31J-08 g.chr5:56177591G>A c.2564G>A c.(2563-2565)cGt>cAt p.R855H HNSC 5 56179360 56179360 + Missense_Mutation SNP G G C TCGA-CR-6484-01A-11D-1870-08 TCGA-CR-6484-10A-01D-1870-08 g.chr5:56179360G>C c.3673G>C c.(3673-3675)Gag>Cag p.E1225Q HNSC 5 56180610 56180610 + Silent SNP G G A TCGA-F7-A624-01A-22D-A30E-08 TCGA-F7-A624-10A-01D-A30H-08 g.chr5:56180610G>A c.3939G>A c.(3937-3939)acG>acA p.T1313T KIPAN 5 56152549 56152549 + Nonsense_Mutation SNP T T A TCGA-CJ-5682-01A-11D-1534-10 TCGA-CJ-5682-11A-01D-1535-10 g.chr5:56152549T>A c.605T>A c.(604-606)tTg>tAg p.L202* KIPAN 5 56160679 56160679 + Nonsense_Mutation SNP T T G TCGA-CJ-4920-01A-01D-1429-08 TCGA-CJ-4920-11A-01D-1429-08 g.chr5:56160679T>G c.953T>G c.(952-954)tTa>tGa p.L318* KIPAN 5 56161247 56161247 + Missense_Mutation SNP C C G TCGA-UZ-A9PO-01A-11D-A382-10 TCGA-UZ-A9PO-10A-01D-A385-10 g.chr5:56161247C>G c.1116C>G c.(1114-1116)gaC>gaG p.D372E KIPAN 5 56161266 56161266 + Missense_Mutation SNP A A C TCGA-UZ-A9PO-01A-11D-A382-10 TCGA-UZ-A9PO-10A-01D-A385-10 g.chr5:56161266A>C c.1135A>C c.(1135-1137)Act>Cct p.T379P KIPAN 5 56170960 56170960 + Silent SNP G G T TCGA-PJ-A5Z9-01A-11D-A28G-10 TCGA-PJ-A5Z9-10A-01D-A28G-10 g.chr5:56170960G>T c.1788G>T c.(1786-1788)ctG>ctT p.L596L KIPAN 5 56177037 56177037 + Silent SNP T T A TCGA-DW-7837-01A-11D-2136-08 TCGA-DW-7837-10A-01D-2136-08 g.chr5:56177037T>A c.2307T>A c.(2305-2307)ccT>ccA p.P769P KIPAN 5 56178606 56178606 + Missense_Mutation SNP G G C TCGA-CZ-4854-01A-01D-1373-10 TCGA-CZ-4854-11A-01D-1373-10 g.chr5:56178606G>C c.3579G>C c.(3577-3579)atG>atC p.M1193I KIPAN 5 56178645 56178645 + Silent SNP T T C TCGA-UZ-A9PX-01A-11D-A42J-10 TCGA-UZ-A9PX-10A-01D-A42M-10 g.chr5:56178645T>C c.3618T>C c.(3616-3618)ccT>ccC p.P1206P KIPAN 5 56183244 56183245 + Frame_Shift_Ins INS - - TA TCGA-P4-A5EA-01A-11D-A28G-10 TCGA-P4-A5EA-11A-11D-A28G-10 g.chr5:56183244_56183245insTA c.4154_4155insTA c.(4153-4158)agaattfs p.RI1385fs KIPAN 5 56184111 56184111 + Missense_Mutation SNP T T G TCGA-B0-5712-01A-11D-1669-08 TCGA-B0-5712-11A-01D-1669-08 g.chr5:56184111T>G c.4316T>G c.(4315-4317)aTt>aGt p.I1439S KIRC 5 56152549 56152549 + Nonsense_Mutation SNP T T A TCGA-CJ-5682-01A-11D-1534-10 TCGA-CJ-5682-11A-01D-1535-10 g.chr5:56152549T>A c.605T>A c.(604-606)tTg>tAg p.L202* KIRC 5 56160679 56160679 + Nonsense_Mutation SNP T T G TCGA-CJ-4920-01A-01D-1429-08 TCGA-CJ-4920-11A-01D-1429-08 g.chr5:56160679T>G c.953T>G c.(952-954)tTa>tGa p.L318* KIRC 5 56178606 56178606 + Missense_Mutation SNP G G C TCGA-CZ-4854-01A-01D-1373-10 TCGA-CZ-4854-11A-01D-1373-10 g.chr5:56178606G>C c.3579G>C c.(3577-3579)atG>atC p.M1193I KIRC 5 56184111 56184111 + Missense_Mutation SNP T T G TCGA-B0-5712-01A-11D-1669-08 TCGA-B0-5712-11A-01D-1669-08 g.chr5:56184111T>G c.4316T>G c.(4315-4317)aTt>aGt p.I1439S KIRP 5 56161247 56161247 + Missense_Mutation SNP C C G TCGA-UZ-A9PO-01A-11D-A382-10 TCGA-UZ-A9PO-10A-01D-A385-10 g.chr5:56161247C>G c.1116C>G c.(1114-1116)gaC>gaG p.D372E KIRP 5 56161266 56161266 + Missense_Mutation SNP A A C TCGA-UZ-A9PO-01A-11D-A382-10 TCGA-UZ-A9PO-10A-01D-A385-10 g.chr5:56161266A>C c.1135A>C c.(1135-1137)Act>Cct p.T379P KIRP 5 56170960 56170960 + Silent SNP G G T TCGA-PJ-A5Z9-01A-11D-A28G-10 TCGA-PJ-A5Z9-10A-01D-A28G-10 g.chr5:56170960G>T c.1788G>T c.(1786-1788)ctG>ctT p.L596L KIRP 5 56177037 56177037 + Silent SNP T T A TCGA-DW-7837-01A-11D-2136-08 TCGA-DW-7837-10A-01D-2136-08 g.chr5:56177037T>A c.2307T>A c.(2305-2307)ccT>ccA p.P769P KIRP 5 56178645 56178645 + Silent SNP T T C TCGA-UZ-A9PX-01A-11D-A42J-10 TCGA-UZ-A9PX-10A-01D-A42M-10 g.chr5:56178645T>C c.3618T>C c.(3616-3618)ccT>ccC p.P1206P KIRP 5 56183244 56183245 + Frame_Shift_Ins INS - - TA TCGA-P4-A5EA-01A-11D-A28G-10 TCGA-P4-A5EA-11A-11D-A28G-10 g.chr5:56183244_56183245insTA c.4154_4155insTA c.(4153-4158)agaattfs p.RI1385fs LGG 5 56160646 56160646 + Missense_Mutation SNP G G A TCGA-DU-6392-01A-11D-1705-08 TCGA-DU-6392-10A-01D-1705-08 g.chr5:56160646G>A c.920G>A c.(919-921)cGt>cAt p.R307H LGG 5 56178277 56178277 + Missense_Mutation SNP G G A TCGA-DU-A5TU-01A-11D-A289-08 TCGA-DU-A5TU-10A-01D-A289-08 g.chr5:56178277G>A c.3250G>A c.(3250-3252)Gat>Aat p.D1084N LGG 5 56181765 56181765 + Missense_Mutation SNP C C T TCGA-DU-7304-01A-12D-2086-08 TCGA-DU-7304-10A-01D-2086-08 g.chr5:56181765C>T c.3989C>T c.(3988-3990)tCg>tTg p.S1330L LGG 5 56181881 56181881 + Missense_Mutation SNP G G T TCGA-DU-6392-01A-11D-1705-08 TCGA-DU-6392-10A-01D-1705-08 g.chr5:56181881G>T c.4105G>T c.(4105-4107)Gat>Tat p.D1369Y LIHC 5 56161727 56161727 + Missense_Mutation SNP C C G TCGA-ZP-A9CY-01A-11D-A382-10 TCGA-ZP-A9CY-10B-01D-A385-10 g.chr5:56161727C>G c.1224C>G c.(1222-1224)atC>atG p.I408M LIHC 5 56170970 56170970 + Frame_Shift_Del DEL G G - TCGA-DD-A1EG-01A-11D-A20W-10 TCGA-DD-A1EG-10A-01D-A20W-10 g.chr5:56170970delG c.1798delG c.(1798-1800)gggfs p.G600fs LIHC 5 56178151 56178151 + Missense_Mutation SNP C C G TCGA-FV-A2QQ-01A-11D-A22F-10 TCGA-FV-A2QQ-10B-01D-A22F-10 g.chr5:56178151C>G c.3124C>G c.(3124-3126)Ctt>Gtt p.L1042V LIHC 5 56178549 56178549 + Silent SNP T T C TCGA-BC-A3KF-01A-11D-A20W-10 TCGA-BC-A3KF-10A-01D-A20W-10 g.chr5:56178549T>C c.3522T>C c.(3520-3522)aaT>aaC p.N1174N LUAD 5 56160759 56160759 + Nonsense_Mutation SNP C C T TCGA-44-6777-01A-11D-1855-08 TCGA-44-6777-10A-01D-1855-08 g.chr5:56160759C>T c.1033C>T c.(1033-1035)Cag>Tag p.Q345* LUAD 5 56168498 56168498 + Missense_Mutation SNP C C A TCGA-62-8394-01A-11D-2323-08 TCGA-62-8394-10A-01D-2323-08 g.chr5:56168498C>A c.1454C>A c.(1453-1455)cCt>cAt p.P485H LUAD 5 56171006 56171006 + Missense_Mutation SNP A A T TCGA-95-7567-01A-11D-2063-08 TCGA-95-7567-10A-01D-2063-08 g.chr5:56171006A>T c.1834A>T c.(1834-1836)Agc>Tgc p.S612C LUAD 5 56177500 56177500 + Missense_Mutation SNP A A G TCGA-MP-A4TI-01A-21D-A24P-08 TCGA-MP-A4TI-10A-01D-A24P-08 g.chr5:56177500A>G c.2473A>G c.(2473-2475)Aga>Gga p.R825G LUAD 5 56177585 56177585 + Missense_Mutation SNP G G T TCGA-05-4250-01A-01D-1105-08 TCGA-05-4250-10A-01D-1105-08 g.chr5:56177585G>T c.2558G>T c.(2557-2559)cGt>cTt p.R853L LUAD 5 56189376 56189376 + Missense_Mutation SNP G G T TCGA-73-4658-01A-01D-1753-08 TCGA-73-4658-11A-01D-1753-08 g.chr5:56189376G>T c.4408G>T c.(4408-4410)Gct>Tct p.A1470S LUSC 5 56161203 56161203 + Silent SNP C C T TCGA-22-5489-01A-01D-1632-08 TCGA-22-5489-11A-01D-1632-08 g.chr5:56161203C>T c.1072C>T c.(1072-1074)Ctg>Ttg p.L358L LUSC 5 56168787 56168787 + Missense_Mutation SNP G G T TCGA-33-4586-01A-01D-1441-08 TCGA-33-4586-11A-01D-1441-08 g.chr5:56168787G>T c.1641G>T c.(1639-1641)caG>caT p.Q547H LUSC 5 56177701 56177701 + Missense_Mutation SNP A A T TCGA-63-5128-01A-01D-1441-08 TCGA-63-5128-10A-01D-1441-08 g.chr5:56177701A>T c.2674A>T c.(2674-2676)Aac>Tac p.N892Y LUSC 5 56177955 56177955 + Silent SNP C C T TCGA-22-4593-01A-21D-1817-08 TCGA-22-4593-11A-01D-1817-08 g.chr5:56177955C>T c.2928C>T c.(2926-2928)tcC>tcT p.S976S LUSC 5 56184162 56184162 + Missense_Mutation SNP A A G TCGA-66-2787-01A-01D-0983-08 TCGA-66-2787-11A-01D-0983-08 g.chr5:56184162A>G c.4367A>G c.(4366-4368)aAt>aGt p.N1456S OV 5 56176578 56176578 + Missense_Mutation SNP T T C TCGA-61-1738-01A-01W-0639-09 TCGA-61-1738-11A-01W-0639-09 g.chr5:56176578T>C c.2128T>C c.(2128-2130)Tgc>Cgc p.C710R OV 5 56181765 56181765 + Missense_Mutation SNP C C T TCGA-61-2088-01A-01W-0722-08 TCGA-61-2088-11A-01W-0722-08 g.chr5:56181765C>T c.3989C>T c.(3988-3990)tCg>tTg p.S1330L PAAD 5 56155658 56155658 + Silent SNP T T C TCGA-IB-7651-01A-11D-2154-08 TCGA-IB-7651-10A-01D-2154-08 g.chr5:56155658T>C c.750T>C c.(748-750)agT>agC p.S250S PAAD 5 56171053 56171053 + Silent SNP C C A TCGA-IB-7651-01A-11D-2154-08 TCGA-IB-7651-10A-01D-2154-08 g.chr5:56171053C>A c.1881C>A c.(1879-1881)atC>atA p.I627I PAAD 5 56177726 56177726 + Missense_Mutation SNP G G T TCGA-IB-7651-01A-11D-2154-08 TCGA-IB-7651-10A-01D-2154-08 g.chr5:56177726G>T c.2699G>T c.(2698-2700)aGt>aTt p.S900I PAAD 5 56177918 56177918 + Missense_Mutation SNP G G T TCGA-IB-7651-01A-11D-2154-08 TCGA-IB-7651-10A-01D-2154-08 g.chr5:56177918G>T c.2891G>T c.(2890-2892)aGt>aTt p.S964I PAAD 5 56181885 56181885 + Missense_Mutation SNP T T C TCGA-IB-7651-01A-11D-2154-08 TCGA-IB-7651-10A-01D-2154-08 g.chr5:56181885T>C c.4109T>C c.(4108-4110)gTc>gCc p.V1370A PRAD 5 56160643 56160643 + Missense_Mutation SNP G G A TCGA-VN-A88O-01A-11D-A34U-08 TCGA-VN-A88O-10A-01D-A34X-08 g.chr5:56160643G>A c.917G>A c.(916-918)cGc>cAc p.R306H PRAD 5 56168713 56168713 + Missense_Mutation SNP G G A TCGA-YL-A8SI-01A-11D-A41K-08 TCGA-YL-A8SI-10A-01D-A41N-08 g.chr5:56168713G>A c.1567G>A c.(1567-1569)Gta>Ata p.V523I PRAD 5 56171129 56171129 + Missense_Mutation SNP G G A TCGA-XK-AAIW-01A-11D-A41K-08 TCGA-XK-AAIW-10A-01D-A41N-08 g.chr5:56171129G>A c.1957G>A c.(1957-1959)Gct>Act p.A653T PRAD 5 56176631 56176631 + Splice_Site SNP T T C TCGA-XK-AAIW-01A-11D-A41K-08 TCGA-XK-AAIW-10A-01D-A41N-08 g.chr5:56176631T>C c.e12+2 PRAD 5 56177976 56177976 + Silent SNP G G A TCGA-XK-AAIW-01A-11D-A41K-08 TCGA-XK-AAIW-10A-01D-A41N-08 g.chr5:56177976G>A c.2949G>A c.(2947-2949)ttG>ttA p.L983L PRAD 5 56183331 56183331 + Missense_Mutation SNP C C T TCGA-XK-AAIW-01A-11D-A41K-08 TCGA-XK-AAIW-10A-01D-A41N-08 g.chr5:56183331C>T c.4241C>T c.(4240-4242)gCa>gTa p.A1414V READ 5 56168531 56168531 + Missense_Mutation SNP G G T TCGA-AG-A002-01A-01W-A00K-09 TCGA-AG-A002-10A-01W-A00K-09 g.chr5:56168531G>T c.1487G>T c.(1486-1488)aGa>aTa p.R496I READ 5 56176939 56176939 + Missense_Mutation SNP G G T TCGA-EI-6507-01A-11D-1733-10 TCGA-EI-6507-10A-01D-1733-10 g.chr5:56176939G>T c.2209G>T c.(2209-2211)Gtc>Ttc p.V737F READ 5 56176993 56176993 + Missense_Mutation SNP C C A TCGA-AG-A002-01A-01W-A00K-09 TCGA-AG-A002-10A-01W-A00K-09 g.chr5:56176993C>A c.2263C>A c.(2263-2265)Ctt>Att p.L755I SKCM 5 56152577 56152577 + Splice_Site SNP G G A TCGA-ER-A198-06A-11D-A196-08 TCGA-ER-A198-10A-01D-A198-08 g.chr5:56152577G>A c.633G>A c.(631-633)gtG>gtA p.V211V SKCM 5 56161183 56161183 + Missense_Mutation SNP G G A TCGA-FS-A4F8-06A-11D-A25O-08 TCGA-FS-A4F8-10B-01D-A25O-08 g.chr5:56161183G>A c.1052G>A c.(1051-1053)cGt>cAt p.R351H SKCM 5 56174881 56174881 + Silent SNP C C T TCGA-DA-A1HV-06A-21D-A196-08 TCGA-DA-A1HV-10A-01D-A198-08 g.chr5:56174881C>T c.2040C>T c.(2038-2040)ctC>ctT p.L680L SKCM 5 56177863 56177864 + Frame_Shift_Del DEL AC AC - TCGA-EE-A3JI-06A-11D-A21A-08 TCGA-EE-A3JI-10A-01D-A21A-08 g.chr5:56177863_56177864delAC c.2836_2837delAC c.(2836-2838)acafs p.T949fs SKCM 5 56178115 56178115 + Missense_Mutation SNP C C T TCGA-FS-A1YY-06A-11D-A197-08 TCGA-FS-A1YY-10A-01D-A199-08 g.chr5:56178115C>T c.3088C>T c.(3088-3090)Cac>Tac p.H1030Y SKCM 5 56178417 56178417 + Silent SNP C C T TCGA-EE-A29D-06A-11D-A197-08 TCGA-EE-A29D-10A-01D-A199-08 g.chr5:56178417C>T c.3390C>T c.(3388-3390)tcC>tcT p.S1130S

Mutation - ICGC Project Code Chromosome Chromosome Start Chromosome End Mutation Type Mutated from Allele Mutated to Allele Consequence Type AA Mutation CDS Mutation BLCA-CN 5 56177537 56177537 single base substitution T A missense_variant L837Q 2510T>A BLCA-CN 5 56177537 56177537 single base substitution T A upstream_gene_variant BLCA-CN 5 56177995 56177995 single base substitution A T missense_variant T990S 2968A>T BLCA-CN 5 56177995 56177995 single base substitution A T upstream_gene_variant BLCA-US 5 56152428 56152428 single base substitution C T missense_variant R162C 484C>T BLCA-US 5 56177590 56177590 single base substitution C T missense_variant R855C 2563C>T BLCA-US 5 56177590 56177590 single base substitution C T upstream_gene_variant BLCA-US 5 56178366 56178366 single base substitution C T synonymous_variant F1113F 3339C>T BLCA-US 5 56178366 56178366 single base substitution C T upstream_gene_variant BLCA-US 5 56181840 56181840 single base substitution G A exon_variant BLCA-US 5 56181840 56181840 single base substitution G A missense_variant R1355H 4064G>A BRCA-EU 5 56106819 56106819 single base substitution C G upstream_gene_variant BRCA-EU 5 56106913 56106913 deletion of <=200bp A - upstream_gene_variant BRCA-EU 5 56107722 56107722 single base substitution C A upstream_gene_variant BRCA-EU 5 56108273 56108273 single base substitution T C upstream_gene_variant BRCA-EU 5 56109070 56109070 single base substitution C A upstream_gene_variant BRCA-EU 5 56111422 56111422 insertion of <=200bp - C frameshift_variant R8P? BRCA-EU 5 56112705 56112705 single base substitution A T intron_variant BRCA-EU 5 56113895 56113895 single base substitution G C intron_variant BRCA-EU 5 56114963 56114963 single base substitution T G intron_variant BRCA-EU 5 56117817 56117817 deletion of <=200bp T - intron_variant BRCA-EU 5 56117909 56117909 single base substitution G A intron_variant BRCA-EU 5 56119843 56119843 single base substitution C G intron_variant BRCA-EU 5 56121134 56121134 single base substitution C T intron_variant BRCA-EU 5 56121335 56121335 single base substitution C G intron_variant BRCA-EU 5 56121645 56121645 single base substitution T C intron_variant BRCA-EU 5 56121729 56121729 single base substitution C G intron_variant BRCA-EU 5 56123066 56123066 single base substitution C A intron_variant BRCA-EU 5 56126194 56126195 deletion of <=200bp TC - intron_variant BRCA-EU 5 56126714 56126714 single base substitution T G intron_variant BRCA-EU 5 56127289 56127289 deletion of <=200bp T - intron_variant BRCA-EU 5 56128677 56128677 single base substitution G C intron_variant BRCA-EU 5 56129602 56129602 single base substitution C G intron_variant BRCA-EU 5 56129622 56129622 single base substitution G A intron_variant BRCA-EU 5 56131199 56131199 single base substitution A T intron_variant BRCA-EU 5 56131264 56131264 single base substitution G T intron_variant BRCA-EU 5 56133489 56133489 single base substitution C T intron_variant BRCA-EU 5 56134296 56134296 single base substitution G C intron_variant BRCA-EU 5 56134820 56134820 single base substitution G T intron_variant BRCA-EU 5 56136476 56136476 single base substitution C G intron_variant BRCA-EU 5 56136860 56136860 single base substitution G A intron_variant BRCA-EU 5 56141010 56141010 single base substitution A C intron_variant BRCA-EU 5 56141463 56141467 deletion of <=200bp TGTTT - intron_variant BRCA-EU 5 56141662 56141662 deletion of <=200bp T - intron_variant BRCA-EU 5 56142235 56142235 single base substitution C A intron_variant BRCA-EU 5 56142916 56142916 single base substitution G T intron_variant BRCA-EU 5 56143036 56143044 multiple base substitution (>=2bp and <=200bp) CTGAAAGTT CTGGG intron_variant BRCA-EU 5 56145811 56145811 insertion of <=200bp - G intron_variant BRCA-EU 5 56145956 56145956 insertion of <=200bp - T intron_variant BRCA-EU 5 56146242 56146242 single base substitution C T intron_variant BRCA-EU 5 56146824 56146824 single base substitution A T intron_variant BRCA-EU 5 56146832 56146832 single base substitution G A intron_variant BRCA-EU 5 56147953 56147953 single base substitution C T intron_variant BRCA-EU 5 56148417 56148417 single base substitution C T intron_variant BRCA-EU 5 56149671 56149671 single base substitution G A intron_variant BRCA-EU 5 56151587 56151587 single base substitution G C intron_variant BRCA-EU 5 56153396 56153396 single base substitution C G intron_variant BRCA-EU 5 56154260 56154260 single base substitution G A intron_variant BRCA-EU 5 56155420 56155420 insertion of <=200bp - G intron_variant BRCA-EU 5 56155715 56155716 deletion of <=200bp AA - frameshift_variant VR269 BRCA-EU 5 56155721 56155722 deletion of <=200bp AA - frameshift_variant RK271 BRCA-EU 5 56155871 56155871 insertion of <=200bp - G intron_variant BRCA-EU 5 56156680 56156680 single base substitution C G intron_variant BRCA-EU 5 56156709 56156709 single base substitution T A intron_variant BRCA-EU 5 56156768 56156768 single base substitution G T intron_variant BRCA-EU 5 56156930 56156930 single base substitution C A intron_variant BRCA-EU 5 56156956 56156956 single base substitution C T intron_variant BRCA-EU 5 56157174 56157174 single base substitution G A intron_variant BRCA-EU 5 56157596 56157596 single base substitution G A intron_variant BRCA-EU 5 56157722 56157722 deletion of <=200bp T - intron_variant BRCA-EU 5 56159357 56159357 single base substitution G A intron_variant BRCA-EU 5 56160542 56160542 deletion of <=200bp A - intron_variant BRCA-EU 5 56160617 56160617 deletion of <=200bp A - frameshift_variant S297 BRCA-EU 5 56160664 56160664 insertion of <=200bp - A frameshift_variant R313Q? BRCA-EU 5 56160675 56160678 deletion of <=200bp TACT - frameshift_variant YL317 BRCA-EU 5 56160696 56160696 insertion of <=200bp - T frameshift_variant P324S? BRCA-EU 5 56160749 56160749 insertion of <=200bp - G frameshift_variant F341L? BRCA-EU 5 56161196 56161199 deletion of <=200bp TATT - frameshift_variant CI355 BRCA-EU 5 56161230 56161230 single base substitution C T stop_gained Q367* 1099C>T BRCA-EU 5 56161456 56161469 deletion of <=200bp CTAGCTTGAAAAAA - intron_variant BRCA-EU 5 56161832 56161832 deletion of <=200bp T - intron_variant BRCA-EU 5 56162296 56162296 insertion of <=200bp - GT intron_variant BRCA-EU 5 56165362 56165364 deletion of <=200bp AAA - intron_variant BRCA-EU 5 56165495 56165495 deletion of <=200bp T - intron_variant BRCA-EU 5 56166221 56166221 single base substitution C T intron_variant BRCA-EU 5 56167804 56167804 insertion of <=200bp - A frameshift_variant T457N? BRCA-EU 5 56169801 56169801 single base substitution C G intron_variant BRCA-EU 5 56171036 56171043 deletion of <=200bp TCTTCCCA - frameshift_variant SSQ622 BRCA-EU 5 56171040 56171040 deletion of <=200bp C - frameshift_variant S623 BRCA-EU 5 56171069 56171069 single base substitution G T stop_gained E633* 1897G>T BRCA-EU 5 56171091 56171091 single base substitution C A stop_gained S640* 1919C>A BRCA-EU 5 56171124 56171124 insertion of <=200bp - A frameshift_variant Y651*? BRCA-EU 5 56173447 56173447 single base substitution C G intron_variant BRCA-EU 5 56173522 56173522 single base substitution C A intron_variant BRCA-EU 5 56173915 56173915 single base substitution A G intron_variant BRCA-EU 5 56174928 56174928 insertion of <=200bp - G frameshift_variant S696R? BRCA-EU 5 56176014 56176014 single base substitution T G intron_variant BRCA-EU 5 56176708 56176708 single base substitution C T intron_variant BRCA-EU 5 56176976 56176977 deletion of <=200bp AC - frameshift_variant N749 BRCA-EU 5 56176976 56176977 deletion of <=200bp AC - upstream_gene_variant BRCA-EU 5 56176977 56176977 single base substitution C A missense_variant N749K 2247C>A BRCA-EU 5 56176977 56176977 single base substitution C A upstream_gene_variant BRCA-EU 5 56177016 56177016 single base substitution T C synonymous_variant D762D 2286T>C BRCA-EU 5 56177016 56177016 single base substitution T C upstream_gene_variant BRCA-EU 5 56177017 56177017 single base substitution A T stop_gained R763* 2287A>T BRCA-EU 5 56177017 56177017 single base substitution A T upstream_gene_variant BRCA-EU 5 56177054 56177055 deletion of <=200bp AT - frameshift_variant H775 BRCA-EU 5 56177054 56177055 deletion of <=200bp AT - upstream_gene_variant BRCA-EU 5 56177564 56177564 deletion of <=200bp C - frameshift_variant S846 BRCA-EU 5 56177564 56177564 deletion of <=200bp C - upstream_gene_variant BRCA-EU 5 56177655 56177655 deletion of <=200bp T - frameshift_variant T876 BRCA-EU 5 56177655 56177655 deletion of <=200bp T - upstream_gene_variant BRCA-EU 5 56177763 56177763 deletion of <=200bp A - frameshift_variant G912 BRCA-EU 5 56177763 56177763 deletion of <=200bp A - upstream_gene_variant BRCA-EU 5 56177785 56177785 insertion of <=200bp - T frameshift_variant L920F? BRCA-EU 5 56177785 56177785 insertion of <=200bp - T upstream_gene_variant BRCA-EU 5 56178258 56178258 insertion of <=200bp - A frameshift_variant S1077S? BRCA-EU 5 56178258 56178258 insertion of <=200bp - A upstream_gene_variant BRCA-EU 5 56178434 56178434 deletion of <=200bp T - frameshift_variant L1136 BRCA-EU 5 56178434 56178434 deletion of <=200bp T - upstream_gene_variant BRCA-EU 5 56178475 56178475 deletion of <=200bp A - frameshift_variant K1150 BRCA-EU 5 56178475 56178475 deletion of <=200bp A - upstream_gene_variant BRCA-EU 5 56178529 56178541 deletion of <=200bp AAAGATGATGTGA - frameshift_variant KDDVN1168 BRCA-EU 5 56178529 56178541 deletion of <=200bp AAAGATGATGTGA - upstream_gene_variant BRCA-EU 5 56178618 56178618 single base substitution G A synonymous_variant A1197A 3591G>A BRCA-EU 5 56178618 56178618 single base substitution G A upstream_gene_variant BRCA-EU 5 56179204 56179204 single base substitution T G intron_variant BRCA-EU 5 56179204 56179204 single base substitution T G upstream_gene_variant BRCA-EU 5 56179439 56179439 insertion of <=200bp - T frameshift_variant L1251L? BRCA-EU 5 56179439 56179439 insertion of <=200bp - T upstream_gene_variant BRCA-EU 5 56179451 56179451 single base substitution C T missense_variant S1255F 3764C>T BRCA-EU 5 56179451 56179451 single base substitution C T upstream_gene_variant BRCA-EU 5 56179455 56179457 deletion of <=200bp TTG - inframe_deletion SC1256S BRCA-EU 5 56179455 56179457 deletion of <=200bp TTG - upstream_gene_variant BRCA-EU 5 56179501 56179501 insertion of <=200bp - A frameshift_variant K1272K? BRCA-EU 5 56179501 56179501 insertion of <=200bp - A upstream_gene_variant BRCA-EU 5 56180418 56180418 single base substitution T G intron_variant BRCA-EU 5 56180418 56180418 single base substitution T G upstream_gene_variant BRCA-EU 5 56180551 56180555 deletion of <=200bp GAGAT - frameshift_variant EI1294 BRCA-EU 5 56180551 56180555 deletion of <=200bp GAGAT - upstream_gene_variant BRCA-EU 5 56180614 56180614 single base substitution G T stop_gained E1315* 3943G>T BRCA-EU 5 56180614 56180614 single base substitution G T upstream_gene_variant BRCA-EU 5 56180834 56180834 single base substitution G A intron_variant BRCA-EU 5 56180834 56180834 single base substitution G A upstream_gene_variant BRCA-EU 5 56180842 56180842 single base substitution G T intron_variant BRCA-EU 5 56180842 56180842 single base substitution G T upstream_gene_variant BRCA-EU 5 56181191 56181191 single base substitution G T intron_variant BRCA-EU 5 56181191 56181191 single base substitution G T upstream_gene_variant BRCA-EU 5 56181765 56181765 single base substitution C T missense_variant S1330L 3989C>T BRCA-EU 5 56181765 56181765 single base substitution C T upstream_gene_variant BRCA-EU 5 56181792 56181792 single base substitution G A exon_variant BRCA-EU 5 56181792 56181792 single base substitution G A missense_variant G1339E 4016G>A BRCA-EU 5 56181841 56181858 deletion of <=200bp TGGCCTTTCGTATCTCCA - exon_variant BRCA-EU 5 56181841 56181858 deletion of <=200bp TGGCCTTTCGTATCTCCA - inframe_deletion RGLSYLH1355R BRCA-EU 5 56181845 56181845 insertion of <=200bp - CTTTCGTATCT exon_variant BRCA-EU 5 56181845 56181845 insertion of <=200bp - CTTTCGTATCT frameshift_variant L1357LSYL? BRCA-EU 5 56182118 56182118 single base substitution C G intron_variant BRCA-EU 5 56182419 56182419 single base substitution G A intron_variant BRCA-EU 5 56182624 56182624 deletion of <=200bp T - intron_variant BRCA-EU 5 56182986 56182986 single base substitution A C intron_variant BRCA-EU 5 56183102 56183102 single base substitution C T intron_variant BRCA-EU 5 56183234 56183234 single base substitution C T exon_variant BRCA-EU 5 56183234 56183234 single base substitution C T stop_gained Q1382* 4144C>T BRCA-EU 5 56183242 56183242 deletion of <=200bp A - exon_variant BRCA-EU 5 56183242 56183242 deletion of <=200bp A - frameshift_variant L1384 BRCA-EU 5 56183331 56183331 deletion of <=200bp C - exon_variant BRCA-EU 5 56183331 56183331 deletion of <=200bp C - frameshift_variant A1414 BRCA-EU 5 56183339 56183339 single base substitution G A exon_variant BRCA-EU 5 56183339 56183339 single base substitution G A missense_variant A1417T 4249G>A BRCA-EU 5 56183347 56183347 insertion of <=200bp - G exon_variant BRCA-EU 5 56183347 56183347 insertion of <=200bp - G frameshift_variant E1419E? BRCA-EU 5 56185392 56185392 single base substitution C T intron_variant BRCA-EU 5 56185758 56185758 single base substitution C G intron_variant BRCA-EU 5 56185891 56185891 single base substitution T G intron_variant BRCA-EU 5 56186131 56186131 single base substitution C G intron_variant BRCA-EU 5 56186246 56186246 single base substitution G A intron_variant BRCA-EU 5 56186803 56186803 single base substitution G C intron_variant BRCA-EU 5 56187237 56187237 single base substitution G T intron_variant BRCA-EU 5 56187794 56187794 single base substitution A G intron_variant BRCA-EU 5 56187797 56187797 single base substitution A G intron_variant BRCA-EU 5 56187842 56187842 single base substitution T C intron_variant BRCA-EU 5 56187902 56187902 single base substitution C T intron_variant BRCA-EU 5 56187990 56187990 single base substitution G A intron_variant BRCA-EU 5 56189416 56189416 insertion of <=200bp - A exon_variant BRCA-EU 5 56189416 56189416 insertion of <=200bp - A frameshift_variant D1483E? BRCA-EU 5 56189490 56189490 single base substitution T A exon_variant BRCA-EU 5 56189490 56189490 single base substitution T A missense_variant F1508I 4522T>A BRCA-EU 5 56190810 56190810 single base substitution G T 3_prime_UTR_variant BRCA-EU 5 56190810 56190810 single base substitution G T exon_variant BRCA-EU 5 56191368 56191368 single base substitution A T 3_prime_UTR_variant BRCA-EU 5 56191368 56191368 single base substitution A T exon_variant BRCA-EU 5 56191740 56191740 single base substitution C T 3_prime_UTR_variant BRCA-EU 5 56191740 56191740 single base substitution C T exon_variant BRCA-EU 5 56193355 56193355 single base substitution G T downstream_gene_variant BRCA-EU 5 56193700 56193700 single base substitution C G downstream_gene_variant BRCA-EU 5 56193722 56193722 single base substitution T A downstream_gene_variant BRCA-EU 5 56194321 56194321 single base substitution C T downstream_gene_variant BRCA-EU 5 56195096 56195096 single base substitution C G downstream_gene_variant BRCA-EU 5 56195693 56195693 single base substitution G C downstream_gene_variant BRCA-EU 5 56196041 56196041 single base substitution A G downstream_gene_variant BRCA-EU 5 56196318 56196318 single base substitution C G downstream_gene_variant BRCA-FR 5 56128677 56128677 single base substitution G C intron_variant BRCA-FR 5 56136393 56136393 single base substitution G A intron_variant BRCA-FR 5 56139508 56139508 single base substitution C T intron_variant BRCA-FR 5 56151033 56151033 single base substitution C G intron_variant BRCA-FR 5 56160184 56160184 single base substitution A C intron_variant BRCA-FR 5 56173915 56173915 single base substitution A G intron_variant BRCA-FR 5 56180270 56180270 single base substitution A C intron_variant BRCA-FR 5 56180270 56180270 single base substitution A C upstream_gene_variant BRCA-FR 5 56180834 56180834 single base substitution G A intron_variant BRCA-FR 5 56180834 56180834 single base substitution G A upstream_gene_variant BRCA-FR 5 56180842 56180842 single base substitution G T intron_variant BRCA-FR 5 56180842 56180842 single base substitution G T upstream_gene_variant BRCA-FR 5 56182419 56182419 single base substitution G A intron_variant BRCA-FR 5 56185392 56185392 single base substitution C T intron_variant BRCA-FR 5 56186131 56186131 single base substitution C G intron_variant BRCA-FR 5 56191740 56191740 single base substitution C T 3_prime_UTR_variant BRCA-FR 5 56191740 56191740 single base substitution C T exon_variant BRCA-FR 5 56192775 56192775 single base substitution C T downstream_gene_variant BRCA-FR 5 56193700 56193700 single base substitution C G downstream_gene_variant BRCA-FR 5 56195693 56195693 single base substitution G C downstream_gene_variant BRCA-UK 5 56146824 56146824 single base substitution A T intron_variant BRCA-UK 5 56160650 56160674 deletion of <=200bp TAACAAAGTGATGCGGGCCAGACTG - frameshift_variant VNKVMRARL308 BRCA-UK 5 56161199 56161199 insertion of <=200bp - GCAGCTGTGCACGTGGAACATTCTGTAT frameshift_variant I356MQLCTWNILY? BRCA-UK 5 56167738 56167738 insertion of <=200bp - A frameshift_variant I435N? BRCA-UK 5 56174872 56174878 deletion of <=200bp GAGACTT - frameshift_variant QRL677 BRCA-UK 5 56179380 56179380 insertion of <=200bp - CAAA frameshift_variant T1231TK? BRCA-UK 5 56179380 56179380 insertion of <=200bp - CAAA upstream_gene_variant BRCA-UK 5 56179454 56179457 deletion of <=200bp CTTG - frameshift_variant SC1256 BRCA-UK 5 56179454 56179457 deletion of <=200bp CTTG - upstream_gene_variant BRCA-UK 5 56181757 56181757 single base substitution A G splice_acceptor_variant BRCA-UK 5 56181757 56181757 single base substitution A G upstream_gene_variant BRCA-UK 5 56181891 56181891 single base substitution G C splice_donor_variant BRCA-UK 5 56183328 56183328 insertion of <=200bp - A exon_variant BRCA-UK 5 56183328 56183328 insertion of <=200bp - A frameshift_variant I1413N? BRCA-UK 5 56187237 56187237 single base substitution G T intron_variant BRCA-UK 5 56189204 56189204 single base substitution C T intron_variant BRCA-UK 5 56189260 56189260 single base substitution C G intron_variant BRCA-UK 5 56189490 56189490 single base substitution T A exon_variant BRCA-UK 5 56189490 56189490 single base substitution T A missense_variant F1508I 4522T>A BRCA-US 5 56152454 56152454 insertion of <=200bp - A frameshift_variant L170L? BRCA-US 5 56152573 56152573 insertion of <=200bp - T frameshift_variant P210L? BRCA-US 5 56155572 56155572 deletion of <=200bp G - frameshift_variant G222 BRCA-US 5 56155605 56155605 deletion of <=200bp C - frameshift_variant P233 BRCA-US 5 56155725 56155726 deletion of <=200bp AG - frameshift_variant R273 BRCA-US 5 56160565 56160565 single base substitution A C missense_variant Q280P 839A>C BRCA-US 5 56160574 56160574 single base substitution G C missense_variant R283T 848G>C BRCA-US 5 56160578 56160579 deletion of <=200bp CA - frameshift_variant IT284 BRCA-US 5 56160594 56160594 insertion of <=200bp - C frameshift_variant A290R? BRCA-US 5 56160644 56160644 deletion of <=200bp C - frameshift_variant R306 BRCA-US 5 56160679 56160679 insertion of <=200bp - A frameshift_variant L318Y? BRCA-US 5 56160697 56160700 deletion of <=200bp CTAA - frameshift_variant PN324 BRCA-US 5 56160701 56160701 single base substitution C A missense_variant N325K 975C>A BRCA-US 5 56160724 56160724 single base substitution G T missense_variant S333I 998G>T BRCA-US 5 56160761 56160761 single base substitution G A splice_region_variant BRCA-US 5 56161239 56161239 insertion of <=200bp - CT frameshift_variant P370L? BRCA-US 5 56161268 56161269 deletion of <=200bp TT - frameshift_variant TL379 BRCA-US 5 56161284 56161284 single base substitution G T splice_donor_variant BRCA-US 5 56161678 56161678 single base substitution A G missense_variant Y392C 1175A>G BRCA-US 5 56161690 56161690 insertion of <=200bp - T frameshift_variant R396L? BRCA-US 5 56161795 56161795 single base substitution C A stop_gained S431* 1292C>A BRCA-US 5 56167801 56167801 insertion of <=200bp - T frameshift_variant L456S? BRCA-US 5 56167804 56167805 deletion of <=200bp AC - frameshift_variant T457 BRCA-US 5 56168483 56168483 deletion of <=200bp G - frameshift_variant R480 BRCA-US 5 56168489 56168490 deletion of <=200bp AT - frameshift_variant N482 BRCA-US 5 56168490 56168490 insertion of <=200bp - A frameshift_variant N482K? BRCA-US 5 56168534 56168534 deletion of <=200bp C - frameshift_variant S497 BRCA-US 5 56168740 56168740 single base substitution C T stop_gained R532* 1594C>T BRCA-US 5 56170880 56170880 deletion of <=200bp G - frameshift_variant G570 BRCA-US 5 56170931 56170931 insertion of <=200bp - T frameshift_variant L587S? BRCA-US 5 56170973 56170973 single base substitution G T stop_gained E601* 1801G>T BRCA-US 5 56171058 56171058 insertion of <=200bp - A frameshift_variant G629E? BRCA-US 5 56171088 56171088 single base substitution T C missense_variant L639P 1916T>C BRCA-US 5 56174851 56174851 insertion of <=200bp - GC frameshift_variant L670L? BRCA-US 5 56174909 56174909 single base substitution A T stop_gained K690* 2068A>T BRCA-US 5 56176548 56176548 single base substitution C T stop_gained Q700* 2098C>T BRCA-US 5 56176593 56176593 insertion of <=200bp - GA frameshift_variant G715E? BRCA-US 5 56176938 56176938 deletion of <=200bp T - frameshift_variant Y736 BRCA-US 5 56176938 56176938 deletion of <=200bp T - upstream_gene_variant BRCA-US 5 56177010 56177010 insertion of <=200bp - ATAG frameshift_variant L760L*? BRCA-US 5 56177010 56177010 insertion of <=200bp - ATAG upstream_gene_variant BRCA-US 5 56177011 56177014 deletion of <=200bp ATAG - frameshift_variant ID761 BRCA-US 5 56177011 56177014 deletion of <=200bp ATAG - upstream_gene_variant BRCA-US 5 56177035 56177035 single base substitution C T missense_variant P769S 2305C>T BRCA-US 5 56177035 56177035 single base substitution C T upstream_gene_variant BRCA-US 5 56177058 56177058 insertion of <=200bp - GTCA frameshift_variant I776MS? BRCA-US 5 56177058 56177058 insertion of <=200bp - GTCA upstream_gene_variant BRCA-US 5 56177099 56177099 single base substitution G T missense_variant R790M 2369G>T BRCA-US 5 56177099 56177099 single base substitution G T upstream_gene_variant BRCA-US 5 56177410 56177410 insertion of <=200bp - T frameshift_variant L795S? BRCA-US 5 56177410 56177410 insertion of <=200bp - T upstream_gene_variant BRCA-US 5 56177500 56177500 single base substitution A T stop_gained R825* 2473A>T BRCA-US 5 56177500 56177500 single base substitution A T upstream_gene_variant BRCA-US 5 56177537 56177538 deletion of <=200bp TG - frameshift_variant L837 BRCA-US 5 56177537 56177538 deletion of <=200bp TG - upstream_gene_variant BRCA-US 5 56177598 56177598 deletion of <=200bp G - frameshift_variant M857 BRCA-US 5 56177598 56177598 deletion of <=200bp G - upstream_gene_variant BRCA-US 5 56177802 56177802 deletion of <=200bp G - frameshift_variant E925 BRCA-US 5 56177802 56177802 deletion of <=200bp G - upstream_gene_variant BRCA-US 5 56177874 56177875 deletion of <=200bp AG - frameshift_variant TE949 BRCA-US 5 56177874 56177875 deletion of <=200bp AG - upstream_gene_variant BRCA-US 5 56177954 56177954 single base substitution C T missense_variant S976F 2927C>T BRCA-US 5 56177954 56177954 single base substitution C T upstream_gene_variant BRCA-US 5 56178024 56178027 deletion of <=200bp AGAT - frameshift_variant TD999 BRCA-US 5 56178024 56178027 deletion of <=200bp AGAT - upstream_gene_variant BRCA-US 5 56178085 56178085 single base substitution C T stop_gained Q1020* 3058C>T BRCA-US 5 56178085 56178085 single base substitution C T upstream_gene_variant BRCA-US 5 56178135 56178135 insertion of <=200bp - A frameshift_variant N1036K? BRCA-US 5 56178135 56178135 insertion of <=200bp - A upstream_gene_variant BRCA-US 5 56178143 56178143 insertion of <=200bp - A frameshift_variant S1039Y? BRCA-US 5 56178143 56178143 insertion of <=200bp - A upstream_gene_variant BRCA-US 5 56178146 56178146 deletion of <=200bp A - frameshift_variant D1040 BRCA-US 5 56178146 56178146 deletion of <=200bp A - upstream_gene_variant BRCA-US 5 56178150 56178153 deletion of <=200bp ACTT - frameshift_variant KL1041 BRCA-US 5 56178150 56178153 deletion of <=200bp ACTT - upstream_gene_variant BRCA-US 5 56178169 56178169 single base substitution C T stop_gained Q1048* 3142C>T BRCA-US 5 56178169 56178169 single base substitution C T upstream_gene_variant BRCA-US 5 56178253 56178253 deletion of <=200bp C - frameshift_variant P1076 BRCA-US 5 56178253 56178253 deletion of <=200bp C - upstream_gene_variant BRCA-US 5 56178257 56178257 single base substitution C G stop_gained S1077* 3230C>G BRCA-US 5 56178257 56178257 single base substitution C G upstream_gene_variant BRCA-US 5 56178399 56178399 insertion of <=200bp - T frameshift_variant V1124V? BRCA-US 5 56178399 56178399 insertion of <=200bp - T upstream_gene_variant BRCA-US 5 56178400 56178400 single base substitution A G missense_variant N1125D 3373A>G BRCA-US 5 56178400 56178400 single base substitution A G upstream_gene_variant BRCA-US 5 56178411 56178411 single base substitution C T synonymous_variant L1128L 3384C>T BRCA-US 5 56178411 56178411 single base substitution C T upstream_gene_variant BRCA-US 5 56178459 56178459 insertion of <=200bp - A frameshift_variant D1144E? BRCA-US 5 56178459 56178459 insertion of <=200bp - A upstream_gene_variant BRCA-US 5 56178466 56178466 insertion of <=200bp - T frameshift_variant V1147C? BRCA-US 5 56178466 56178466 insertion of <=200bp - T upstream_gene_variant BRCA-US 5 56178571 56178571 single base substitution G T stop_gained E1182* 3544G>T BRCA-US 5 56178571 56178571 single base substitution G T upstream_gene_variant BRCA-US 5 56178577 56178577 single base substitution G T stop_gained E1184* 3550G>T BRCA-US 5 56178577 56178577 single base substitution G T upstream_gene_variant BRCA-US 5 56178637 56178638 deletion of <=200bp AT - frameshift_variant I1204 BRCA-US 5 56178637 56178638 deletion of <=200bp AT - upstream_gene_variant BRCA-US 5 56178672 56178672 insertion of <=200bp - A frameshift_variant D1215E? BRCA-US 5 56178672 56178672 insertion of <=200bp - A upstream_gene_variant BRCA-US 5 56179396 56179396 single base substitution T A missense_variant Y1237N 3709T>A BRCA-US 5 56179396 56179396 single base substitution T A upstream_gene_variant BRCA-US 5 56179424 56179424 insertion of <=200bp - T frameshift_variant G1246V? BRCA-US 5 56179424 56179424 insertion of <=200bp - T upstream_gene_variant BRCA-US 5 56179458 56179458 deletion of <=200bp T - frameshift_variant C1257 BRCA-US 5 56179458 56179458 deletion of <=200bp T - upstream_gene_variant BRCA-US 5 56180496 56180496 deletion of <=200bp T - frameshift_variant T1275 BRCA-US 5 56180496 56180496 deletion of <=200bp T - upstream_gene_variant BRCA-US 5 56180503 56180504 deletion of <=200bp AG - frameshift_variant R1278 BRCA-US 5 56180503 56180504 deletion of <=200bp AG - upstream_gene_variant BRCA-US 5 56180536 56180536 insertion of <=200bp - A frameshift_variant E1289R? BRCA-US 5 56180536 56180536 insertion of <=200bp - A upstream_gene_variant BRCA-US 5 56180586 56180588 deletion of <=200bp CAT - inframe_deletion NI1305N BRCA-US 5 56180586 56180588 deletion of <=200bp CAT - upstream_gene_variant BRCA-US 5 56181765 56181765 single base substitution C G missense_variant S1330W 3989C>G BRCA-US 5 56181765 56181765 single base substitution C G upstream_gene_variant BRCA-US 5 56181807 56181807 single base substitution C G exon_variant BRCA-US 5 56181807 56181807 single base substitution C G stop_gained S1344* 4031C>G BRCA-US 5 56181812 56181814 deletion of <=200bp GTT - exon_variant BRCA-US 5 56181812 56181814 deletion of <=200bp GTT - inframe_deletion V1346 BRCA-US 5 56183211 56183211 single base substitution A G exon_variant BRCA-US 5 56183211 56183211 single base substitution A G missense_variant N1374S 4121A>G BRCA-US 5 56183240 56183240 insertion of <=200bp - T exon_variant BRCA-US 5 56183240 56183240 insertion of <=200bp - T frameshift_variant L1384S? BRCA-US 5 56183296 56183296 insertion of <=200bp - G exon_variant BRCA-US 5 56183296 56183296 insertion of <=200bp - G frameshift_variant A1402A? BRCA-US 5 56183311 56183311 deletion of <=200bp A - exon_variant BRCA-US 5 56183311 56183311 deletion of <=200bp A - frameshift_variant G1407 BRCA-US 5 56183347 56183347 single base substitution G A exon_variant BRCA-US 5 56183347 56183347 single base substitution G A splice_region_variant BRCA-US 5 56184093 56184093 single base substitution G C exon_variant BRCA-US 5 56184093 56184093 single base substitution G C missense_variant W1433S 4298G>C BRCA-US 5 56184105 56184105 single base substitution G C exon_variant BRCA-US 5 56184105 56184105 single base substitution G C missense_variant C1437S 4310G>C BRCA-US 5 56184105 56184105 single base substitution G T exon_variant BRCA-US 5 56184105 56184105 single base substitution G T missense_variant C1437F 4310G>T BRCA-US 5 56189387 56189387 deletion of <=200bp C - exon_variant BRCA-US 5 56189387 56189387 deletion of <=200bp C - frameshift_variant I1473 BRCA-US 5 56189440 56189440 single base substitution T A exon_variant BRCA-US 5 56189440 56189440 single base substitution T A missense_variant L1491H 4472T>A BRCA-US 5 56189442 56189442 deletion of <=200bp C - exon_variant BRCA-US 5 56189442 56189442 deletion of <=200bp C - frameshift_variant Q1492 BTCA-JP 5 56160542 56160542 deletion of <=200bp A - intron_variant BTCA-JP 5 56161609 56161609 single base substitution A G intron_variant BTCA-JP 5 56177591 56177591 single base substitution G A missense_variant R855H 2564G>A BTCA-JP 5 56177591 56177591 single base substitution G A upstream_gene_variant BTCA-JP 5 56183321 56183321 single base substitution G A exon_variant BTCA-JP 5 56183321 56183321 single base substitution G A missense_variant G1411R 4231G>A CESC-US 5 56155681 56155681 single base substitution C T missense_variant S258L 773C>T CESC-US 5 56174810 56174810 single base substitution A G missense_variant T657A 1969A>G CESC-US 5 56177460 56177460 single base substitution G T missense_variant M811I 2433G>T CESC-US 5 56177460 56177460 single base substitution G T upstream_gene_variant CESC-US 5 56177814 56177814 single base substitution G A synonymous_variant E929E 2787G>A CESC-US 5 56177814 56177814 single base substitution G A upstream_gene_variant CESC-US 5 56184171 56184171 single base substitution C T exon_variant CESC-US 5 56184171 56184171 single base substitution C T missense_variant A1459V 4376C>T CLLE-ES 5 56119791 56119791 single base substitution A G intron_variant CLLE-ES 5 56130913 56130913 single base substitution A G intron_variant CLLE-ES 5 56154627 56154627 insertion of <=200bp - A intron_variant CLLE-ES 5 56167767 56167767 single base substitution T G synonymous_variant P444P 1332T>G CLLE-ES 5 56181418 56181418 single base substitution A C intron_variant CLLE-ES 5 56181418 56181418 single base substitution A C upstream_gene_variant COAD-US 5 56152566 56152566 single base substitution C T stop_gained R208* 622C>T COAD-US 5 56161183 56161183 single base substitution G A missense_variant R351H 1052G>A COAD-US 5 56176934 56176934 single base substitution A T missense_variant D735V 2204A>T COAD-US 5 56176934 56176934 single base substitution A T upstream_gene_variant COAD-US 5 56176980 56176980 single base substitution T A missense_variant N750K 2250T>A COAD-US 5 56176980 56176980 single base substitution T A upstream_gene_variant COAD-US 5 56177046 56177046 single base substitution T G missense_variant F772L 2316T>G COAD-US 5 56177046 56177046 single base substitution T G upstream_gene_variant COAD-US 5 56180602 56180602 single base substitution G T stop_gained G1311* 3931G>T COAD-US 5 56180602 56180602 single base substitution G T upstream_gene_variant COAD-US 5 56181765 56181765 single base substitution C T missense_variant S1330L 3989C>T COAD-US 5 56181765 56181765 single base substitution C T upstream_gene_variant COAD-US 5 56189359 56189359 single base substitution T G missense_variant I1464S 4391T>G COAD-US 5 56189359 56189359 single base substitution T G splice_region_variant COCA-CN 5 56122140 56122140 single base substitution G A intron_variant COCA-CN 5 56147911 56147911 single base substitution A G intron_variant COCA-CN 5 56161161 56161161 single base substitution C A splice_region_variant COCA-CN 5 56161182 56161182 single base substitution C T missense_variant R351C 1051C>T COCA-CN 5 56161845 56161845 single base substitution A G intron_variant COCA-CN 5 56177148 56177148 single base substitution A G intron_variant COCA-CN 5 56177148 56177148 single base substitution A G upstream_gene_variant COCA-CN 5 56178649 56178649 single base substitution C T synonymous_variant L1208L 3622C>T COCA-CN 5 56178649 56178649 single base substitution C T upstream_gene_variant COCA-CN 5 56179508 56179508 single base substitution T C splice_donor_variant COCA-CN 5 56179508 56179508 single base substitution T C upstream_gene_variant COCA-CN 5 56181719 56181719 single base substitution C T intron_variant COCA-CN 5 56181719 56181719 single base substitution C T upstream_gene_variant COCA-CN 5 56181864 56181864 single base substitution A C exon_variant COCA-CN 5 56181864 56181864 single base substitution A C missense_variant N1363T 4088A>C COCA-CN 5 56183384 56183384 single base substitution T G exon_variant COCA-CN 5 56183384 56183384 single base substitution T G intron_variant COCA-CN 5 56184023 56184023 single base substitution T G exon_variant COCA-CN 5 56184023 56184023 single base substitution T G intron_variant COCA-CN 5 56184209 56184209 single base substitution C A intron_variant ESAD-UK 5 56106913 56106913 insertion of <=200bp - A upstream_gene_variant ESAD-UK 5 56107207 56107207 single base substitution T C upstream_gene_variant ESAD-UK 5 56107656 56107656 single base substitution A G upstream_gene_variant ESAD-UK 5 56112273 56112273 single base substitution G A intron_variant ESAD-UK 5 56116676 56116676 single base substitution C T intron_variant ESAD-UK 5 56119023 56119023 single base substitution C T intron_variant ESAD-UK 5 56120141 56120141 single base substitution A T intron_variant ESAD-UK 5 56120761 56120761 insertion of <=200bp - A intron_variant ESAD-UK 5 56124797 56124797 single base substitution G T intron_variant ESAD-UK 5 56126988 56126988 single base substitution G A intron_variant ESAD-UK 5 56127580 56127580 single base substitution A T intron_variant ESAD-UK 5 56132034 56132034 single base substitution C T intron_variant ESAD-UK 5 56134563 56134563 single base substitution C T intron_variant ESAD-UK 5 56136206 56136206 single base substitution T C intron_variant ESAD-UK 5 56138691 56138691 single base substitution T G intron_variant ESAD-UK 5 56140092 56140092 single base substitution C T intron_variant ESAD-UK 5 56143005 56143005 single base substitution A T intron_variant ESAD-UK 5 56145493 56145493 single base substitution A T intron_variant ESAD-UK 5 56148922 56148922 single base substitution A G intron_variant ESAD-UK 5 56149556 56149556 single base substitution A G intron_variant ESAD-UK 5 56150909 56150909 single base substitution C T intron_variant ESAD-UK 5 56152398 56152398 single base substitution C A intron_variant ESAD-UK 5 56152882 56152882 single base substitution A T intron_variant ESAD-UK 5 56152884 56152884 single base substitution A T intron_variant ESAD-UK 5 56155871 56155871 deletion of <=200bp G - intron_variant ESAD-UK 5 56156419 56156419 single base substitution T C intron_variant ESAD-UK 5 56163334 56163334 insertion of <=200bp - A intron_variant ESAD-UK 5 56164506 56164506 single base substitution C T intron_variant ESAD-UK 5 56165631 56165631 single base substitution T C intron_variant ESAD-UK 5 56166305 56166305 single base substitution G T intron_variant ESAD-UK 5 56167553 56167553 single base substitution G A intron_variant ESAD-UK 5 56170892 56170892 single base substitution T G missense_variant S574A 1720T>G ESAD-UK 5 56174635 56174635 single base substitution T G intron_variant ESAD-UK 5 56175399 56175399 single base substitution T A intron_variant ESAD-UK 5 56181840 56181840 single base substitution G A exon_variant ESAD-UK 5 56181840 56181840 single base substitution G A missense_variant R1355H 4064G>A ESAD-UK 5 56182375 56182375 single base substitution A G intron_variant ESAD-UK 5 56183291 56183291 single base substitution G A exon_variant ESAD-UK 5 56183291 56183291 single base substitution G A missense_variant G1401S 4201G>A ESAD-UK 5 56183941 56183941 single base substitution C G exon_variant ESAD-UK 5 56183941 56183941 single base substitution C G intron_variant ESAD-UK 5 56185269 56185269 single base substitution G A intron_variant ESAD-UK 5 56187984 56187984 single base substitution A G intron_variant ESAD-UK 5 56188653 56188654 deletion of <=200bp TT - intron_variant ESAD-UK 5 56189974 56189974 insertion of <=200bp - GTAT 3_prime_UTR_variant ESAD-UK 5 56189974 56189974 insertion of <=200bp - GTAT exon_variant ESAD-UK 5 56190111 56190111 single base substitution T G 3_prime_UTR_variant ESAD-UK 5 56190111 56190111 single base substitution T G exon_variant ESAD-UK 5 56192693 56192693 single base substitution G A downstream_gene_variant ESAD-UK 5 56195411 56195411 single base substitution C T downstream_gene_variant ESCA-CN 5 56171051 56171051 single base substitution A G missense_variant I627V 1879A>G ESCA-CN 5 56171079 56171079 single base substitution G A missense_variant C636Y 1907G>A ESCA-CN 5 56177567 56177567 single base substitution C T missense_variant T847I 2540C>T ESCA-CN 5 56177567 56177567 single base substitution C T upstream_gene_variant GBM-US 5 56160697 56160697 single base substitution C T missense_variant P324L 971C>T GBM-US 5 56168506 56168506 single base substitution T C missense_variant C488R 1462T>C GBM-US 5 56168509 56168509 single base substitution C T missense_variant P489S 1465C>T GBM-US 5 56176540 56176540 single base substitution G A missense_variant R697H 2090G>A GBM-US 5 56177898 56177898 single base substitution A G synonymous_variant Q957Q 2871A>G GBM-US 5 56177898 56177898 single base substitution A G upstream_gene_variant GBM-US 5 56179395 56179395 single base substitution G A synonymous_variant P1236P 3708G>A GBM-US 5 56179395 56179395 single base substitution G A upstream_gene_variant KIRC-US 5 56152549 56152549 single base substitution T A stop_gained L202* 605T>A KIRC-US 5 56160679 56160679 single base substitution T G stop_gained L318* 953T>G KIRC-US 5 56177851 56177851 single base substitution A T missense_variant T942S 2824A>T KIRC-US 5 56177851 56177851 single base substitution A T upstream_gene_variant KIRC-US 5 56178013 56178013 single base substitution G T missense_variant G996C 2986G>T KIRC-US 5 56178013 56178013 single base substitution G T upstream_gene_variant KIRC-US 5 56178606 56178606 single base substitution G C missense_variant M1193I 3579G>C KIRC-US 5 56178606 56178606 single base substitution G C upstream_gene_variant KIRP-US 5 56177037 56177037 single base substitution T A synonymous_variant P769P 2307T>A KIRP-US 5 56177037 56177037 single base substitution T A upstream_gene_variant LAML-KR 5 56127030 56127030 single base substitution A T intron_variant LAML-KR 5 56150278 56150278 single base substitution G A intron_variant LAML-KR 5 56183941 56183941 single base substitution C G exon_variant LAML-KR 5 56183941 56183941 single base substitution C G intron_variant LGG-US 5 56178277 56178277 single base substitution G A missense_variant D1084N 3250G>A LGG-US 5 56178277 56178277 single base substitution G A upstream_gene_variant LGG-US 5 56181765 56181765 single base substitution C T missense_variant S1330L 3989C>T LGG-US 5 56181765 56181765 single base substitution C T upstream_gene_variant LIAD-FR 5 56155725 56155726 deletion of <=200bp AG - frameshift_variant R273 LICA-CN 5 56174873 56174873 single base substitution A T stop_gained R678* 2032A>T LICA-FR 5 56114938 56114938 single base substitution C T intron_variant LICA-FR 5 56127681 56127681 single base substitution A T intron_variant LICA-FR 5 56133294 56133294 single base substitution C T intron_variant LICA-FR 5 56140057 56140057 single base substitution C T intron_variant LICA-FR 5 56145181 56145182 deletion of <=200bp AA - intron_variant LICA-FR 5 56150260 56150260 insertion of <=200bp - AA intron_variant LICA-FR 5 56150260 56150260 insertion of <=200bp - A intron_variant LICA-FR 5 56160206 56160206 deletion of <=200bp T - intron_variant LICA-FR 5 56161222 56161222 single base substitution G A missense_variant R364Q 1091G>A LICA-FR 5 56165699 56165699 single base substitution A T intron_variant LICA-FR 5 56171089 56171089 single base substitution G A synonymous_variant L639L 1917G>A LICA-FR 5 56179361 56179361 single base substitution A C missense_variant E1225A 3674A>C LICA-FR 5 56179361 56179361 single base substitution A C upstream_gene_variant LIHC-US 5 56176951 56176951 single base substitution A G missense_variant I741V 2221A>G LIHC-US 5 56176951 56176951 single base substitution A G upstream_gene_variant LIHC-US 5 56178151 56178151 single base substitution C G missense_variant L1042V 3124C>G LIHC-US 5 56178151 56178151 single base substitution C G upstream_gene_variant LINC-JP 5 56106664 56106664 single base substitution G A upstream_gene_variant LINC-JP 5 56107326 56107326 single base substitution T C upstream_gene_variant LINC-JP 5 56111000 56111000 single base substitution C G upstream_gene_variant LINC-JP 5 56111789 56111789 single base substitution C A missense_variant A130E 389C>A LINC-JP 5 56122451 56122451 single base substitution A G intron_variant LINC-JP 5 56127872 56127872 single base substitution C T intron_variant LINC-JP 5 56150610 56150610 single base substitution T G intron_variant LINC-JP 5 56152321 56152321 single base substitution A G intron_variant LINC-JP 5 56153962 56153962 single base substitution A C intron_variant LINC-JP 5 56159076 56159076 single base substitution A G intron_variant LINC-JP 5 56160949 56160949 single base substitution A G intron_variant LINC-JP 5 56169383 56169383 single base substitution G T intron_variant LINC-JP 5 56170059 56170059 single base substitution T C intron_variant LINC-JP 5 56176633 56176633 single base substitution A G splice_region_variant LINC-JP 5 56178253 56178253 single base substitution C T missense_variant P1076S 3226C>T LINC-JP 5 56178253 56178253 single base substitution C T upstream_gene_variant LINC-JP 5 56179441 56179441 single base substitution G T stop_gained G1252* 3754G>T LINC-JP 5 56179441 56179441 single base substitution G T upstream_gene_variant LINC-JP 5 56179442 56179442 single base substitution G T missense_variant G1252V 3755G>T LINC-JP 5 56179442 56179442 single base substitution G T upstream_gene_variant LINC-JP 5 56182869 56182869 single base substitution C T intron_variant LINC-JP 5 56183114 56183114 single base substitution A G intron_variant LINC-JP 5 56187869 56187869 single base substitution T C intron_variant LINC-JP 5 56189373 56189373 single base substitution A T exon_variant LINC-JP 5 56189373 56189373 single base substitution A T missense_variant T1469S 4405A>T LINC-JP 5 56189582 56189582 single base substitution A G 3_prime_UTR_variant LINC-JP 5 56189582 56189582 single base substitution A G exon_variant LINC-JP 5 56193465 56193465 single base substitution C T downstream_gene_variant LIRI-JP 5 56107678 56107678 single base substitution T C upstream_gene_variant LIRI-JP 5 56107867 56107867 single base substitution C T upstream_gene_variant LIRI-JP 5 56108858 56108858 single base substitution G A upstream_gene_variant LIRI-JP 5 56108953 56108953 single base substitution A G upstream_gene_variant LIRI-JP 5 56110292 56110292 single base substitution G A upstream_gene_variant LIRI-JP 5 56114640 56114640 single base substitution A G intron_variant LIRI-JP 5 56115519 56115519 single base substitution G T intron_variant LIRI-JP 5 56116342 56116342 single base substitution A G intron_variant LIRI-JP 5 56116674 56116674 single base substitution A C intron_variant LIRI-JP 5 56117630 56117630 single base substitution T A intron_variant LIRI-JP 5 56118509 56118509 single base substitution A G intron_variant LIRI-JP 5 56124053 56124053 single base substitution A G intron_variant LIRI-JP 5 56126309 56126309 single base substitution A C intron_variant LIRI-JP 5 56128122 56128122 single base substitution A G intron_variant LIRI-JP 5 56130013 56130013 single base substitution T G intron_variant LIRI-JP 5 56130270 56130270 single base substitution T C intron_variant LIRI-JP 5 56131482 56131482 single base substitution A G intron_variant LIRI-JP 5 56132178 56132178 single base substitution G A intron_variant LIRI-JP 5 56132409 56132409 single base substitution C G intron_variant LIRI-JP 5 56135205 56135205 single base substitution A T intron_variant LIRI-JP 5 56136556 56136556 single base substitution A G intron_variant LIRI-JP 5 56136676 56136676 insertion of <=200bp - T intron_variant LIRI-JP 5 56139283 56139283 single base substitution T A intron_variant LIRI-JP 5 56144154 56144154 single base substitution T G intron_variant LIRI-JP 5 56145126 56145126 single base substitution A T intron_variant LIRI-JP 5 56145536 56145536 single base substitution T C intron_variant LIRI-JP 5 56146197 56146197 single base substitution A G intron_variant LIRI-JP 5 56146724 56146724 single base substitution C G intron_variant LIRI-JP 5 56147114 56147114 single base substitution C T intron_variant LIRI-JP 5 56148469 56148469 single base substitution A G intron_variant LIRI-JP 5 56152227 56152227 single base substitution A G intron_variant LIRI-JP 5 56153313 56153313 single base substitution T C intron_variant LIRI-JP 5 56154781 56154781 single base substitution A G intron_variant LIRI-JP 5 56156672 56156672 single base substitution C T intron_variant LIRI-JP 5 56158110 56158110 single base substitution A G intron_variant LIRI-JP 5 56161305 56161305 single base substitution G T intron_variant LIRI-JP 5 56163715 56163715 single base substitution C T intron_variant LIRI-JP 5 56164401 56164401 single base substitution C G intron_variant LIRI-JP 5 56164662 56164662 single base substitution A G intron_variant LIRI-JP 5 56168661 56168661 single base substitution G A synonymous_variant L505L 1515G>A LIRI-JP 5 56171281 56171281 single base substitution A G intron_variant LIRI-JP 5 56171721 56171721 single base substitution A G intron_variant LIRI-JP 5 56174380 56174380 single base substitution A G intron_variant LIRI-JP 5 56176970 56176970 deletion of <=200bp A - frameshift_variant E747 LIRI-JP 5 56176970 56176970 deletion of <=200bp A - upstream_gene_variant LIRI-JP 5 56177158 56177158 single base substitution C A intron_variant LIRI-JP 5 56177158 56177158 single base substitution C A upstream_gene_variant LIRI-JP 5 56178078 56178078 single base substitution A G synonymous_variant A1017A 3051A>G LIRI-JP 5 56178078 56178078 single base substitution A G upstream_gene_variant LIRI-JP 5 56178708 56178708 insertion of <=200bp - T intron_variant LIRI-JP 5 56178708 56178708 insertion of <=200bp - T upstream_gene_variant LIRI-JP 5 56178953 56178953 single base substitution G C intron_variant LIRI-JP 5 56178953 56178953 single base substitution G C upstream_gene_variant LIRI-JP 5 56180828 56180828 single base substitution A G intron_variant LIRI-JP 5 56180828 56180828 single base substitution A G upstream_gene_variant LIRI-JP 5 56181413 56181413 single base substitution T A intron_variant LIRI-JP 5 56181413 56181413 single base substitution T A upstream_gene_variant LIRI-JP 5 56182524 56182524 single base substitution A G intron_variant LIRI-JP 5 56183286 56183286 single base substitution G A exon_variant LIRI-JP 5 56183286 56183286 single base substitution G A missense_variant G1399E 4196G>A LIRI-JP 5 56183654 56183657 deletion of <=200bp TCTC - exon_variant LIRI-JP 5 56183654 56183657 deletion of <=200bp TCTC - intron_variant LIRI-JP 5 56185073 56185073 single base substitution A G intron_variant LIRI-JP 5 56185496 56185496 single base substitution T A intron_variant LIRI-JP 5 56189363 56189363 single base substitution T C exon_variant LIRI-JP 5 56189363 56189363 single base substitution T C synonymous_variant A1465A 4395T>C LIRI-JP 5 56191283 56191283 single base substitution C T 3_prime_UTR_variant LIRI-JP 5 56191283 56191283 single base substitution C T exon_variant LIRI-JP 5 56193951 56193951 single base substitution A T downstream_gene_variant LIRI-JP 5 56194194 56194194 single base substitution T G downstream_gene_variant LIRI-JP 5 56194370 56194370 single base substitution A C downstream_gene_variant LUSC-KR 5 56109636 56109636 single base substitution G T upstream_gene_variant LUSC-KR 5 56109817 56109817 single base substitution G C upstream_gene_variant LUSC-KR 5 56110300 56110300 single base substitution G A upstream_gene_variant LUSC-KR 5 56110739 56110739 single base substitution C A upstream_gene_variant LUSC-KR 5 56119896 56119896 single base substitution G T intron_variant LUSC-KR 5 56121262 56121262 single base substitution G T intron_variant LUSC-KR 5 56125924 56125924 single base substitution G A intron_variant LUSC-KR 5 56133871 56133871 single base substitution C T intron_variant LUSC-KR 5 56134534 56134534 single base substitution A T intron_variant LUSC-KR 5 56135834 56135834 single base substitution G A intron_variant LUSC-KR 5 56137713 56137713 single base substitution A T intron_variant LUSC-KR 5 56141629 56141629 single base substitution G C intron_variant LUSC-KR 5 56142287 56142287 single base substitution G C intron_variant LUSC-KR 5 56145905 56145905 single base substitution A G intron_variant LUSC-KR 5 56152647 56152647 single base substitution G T intron_variant LUSC-KR 5 56156960 56156960 single base substitution G A intron_variant LUSC-KR 5 56160666 56160666 single base substitution G T missense_variant A314S 940G>T LUSC-KR 5 56163926 56163926 single base substitution A T intron_variant LUSC-KR 5 56170861 56170861 single base substitution G T splice_region_variant LUSC-KR 5 56173750 56173750 single base substitution G A intron_variant LUSC-KR 5 56177611 56177611 single base substitution G A missense_variant E862K 2584G>A LUSC-KR 5 56177611 56177611 single base substitution G A upstream_gene_variant LUSC-KR 5 56177617 56177617 single base substitution G T stop_gained E864* 2590G>T LUSC-KR 5 56177617 56177617 single base substitution G T upstream_gene_variant LUSC-KR 5 56188324 56188324 single base substitution G T intron_variant LUSC-KR 5 56191611 56191611 single base substitution G T 3_prime_UTR_variant LUSC-KR 5 56191611 56191611 single base substitution G T exon_variant LUSC-US 5 56161203 56161203 single base substitution C T synonymous_variant L358L 1072C>T LUSC-US 5 56168787 56168787 single base substitution G T missense_variant Q547H 1641G>T LUSC-US 5 56177701 56177701 single base substitution A T missense_variant N892Y 2674A>T LUSC-US 5 56177701 56177701 single base substitution A T upstream_gene_variant LUSC-US 5 56177955 56177955 single base substitution C T synonymous_variant S976S 2928C>T LUSC-US 5 56177955 56177955 single base substitution C T upstream_gene_variant LUSC-US 5 56184162 56184162 single base substitution A G exon_variant LUSC-US 5 56184162 56184162 single base substitution A G missense_variant N1456S 4367A>G MALY-DE 5 56107186 56107186 single base substitution T G upstream_gene_variant MALY-DE 5 56119712 56119712 single base substitution G A intron_variant MALY-DE 5 56123848 56123848 single base substitution A C intron_variant MALY-DE 5 56141463 56141463 insertion of <=200bp - TGTTT intron_variant MALY-DE 5 56145166 56145166 single base substitution A C intron_variant MALY-DE 5 56151828 56151828 single base substitution C T intron_variant MALY-DE 5 56164540 56164540 single base substitution G C intron_variant MALY-DE 5 56172004 56172004 single base substitution T G intron_variant MALY-DE 5 56174487 56174487 single base substitution C T intron_variant MALY-DE 5 56176238 56176238 single base substitution T C intron_variant MALY-DE 5 56185357 56185357 single base substitution T A intron_variant MALY-DE 5 56191409 56191409 single base substitution T C 3_prime_UTR_variant MALY-DE 5 56191409 56191409 single base substitution T C exon_variant MELA-AU 5 56106493 56106493 single base substitution C T upstream_gene_variant MELA-AU 5 56107525 56107525 single base substitution A T upstream_gene_variant MELA-AU 5 56107540 56107540 single base substitution G A upstream_gene_variant MELA-AU 5 56108043 56108043 single base substitution C A upstream_gene_variant MELA-AU 5 56108950 56108950 single base substitution G A upstream_gene_variant MELA-AU 5 56109591 56109591 single base substitution C T upstream_gene_variant MELA-AU 5 56109755 56109755 single base substitution C T upstream_gene_variant MELA-AU 5 56112239 56112239 single base substitution C A intron_variant MELA-AU 5 56113000 56113000 single base substitution A T intron_variant MELA-AU 5 56113027 56113027 single base substitution A G intron_variant MELA-AU 5 56113307 56113307 single base substitution C T intron_variant MELA-AU 5 56114170 56114170 single base substitution C T intron_variant MELA-AU 5 56114338 56114338 single base substitution A G intron_variant MELA-AU 5 56114356 56114356 single base substitution T C intron_variant MELA-AU 5 56114474 56114474 insertion of <=200bp - T intron_variant MELA-AU 5 56114910 56114910 single base substitution C T intron_variant MELA-AU 5 56115059 56115059 single base substitution C T intron_variant MELA-AU 5 56115256 56115256 single base substitution C T intron_variant MELA-AU 5 56115721 56115721 single base substitution A T intron_variant MELA-AU 5 56116105 56116105 single base substitution G A intron_variant MELA-AU 5 56117232 56117232 single base substitution G A intron_variant MELA-AU 5 56117720 56117720 single base substitution C T intron_variant MELA-AU 5 56117840 56117840 single base substitution C T intron_variant MELA-AU 5 56118786 56118786 single base substitution C T intron_variant MELA-AU 5 56118802 56118802 single base substitution C T intron_variant MELA-AU 5 56120637 56120637 single base substitution C A intron_variant MELA-AU 5 56120748 56120748 single base substitution T C intron_variant MELA-AU 5 56121065 56121065 single base substitution C T intron_variant MELA-AU 5 56121353 56121353 single base substitution C T intron_variant MELA-AU 5 56121689 56121690 multiple base substitution (>=2bp and <=200bp) CC TT intron_variant MELA-AU 5 56121731 56121731 single base substitution G A intron_variant MELA-AU 5 56121934 56121934 single base substitution C T intron_variant MELA-AU 5 56123282 56123282 single base substitution G A intron_variant MELA-AU 5 56123573 56123573 single base substitution C T intron_variant MELA-AU 5 56123699 56123699 single base substitution A T intron_variant MELA-AU 5 56123714 56123714 single base substitution C T intron_variant MELA-AU 5 56123724 56123724 single base substitution A C intron_variant MELA-AU 5 56124637 56124637 insertion of <=200bp - A intron_variant MELA-AU 5 56125352 56125352 single base substitution C T intron_variant MELA-AU 5 56126039 56126039 single base substitution G T intron_variant MELA-AU 5 56126868 56126868 single base substitution C T intron_variant MELA-AU 5 56127928 56127928 single base substitution T G intron_variant MELA-AU 5 56128663 56128663 single base substitution T A intron_variant MELA-AU 5 56130459 56130459 single base substitution C T intron_variant MELA-AU 5 56130776 56130776 single base substitution A G intron_variant MELA-AU 5 56130781 56130781 single base substitution C T intron_variant MELA-AU 5 56132773 56132773 single base substitution C T intron_variant MELA-AU 5 56134427 56134427 single base substitution A T intron_variant MELA-AU 5 56134917 56134917 single base substitution T C intron_variant MELA-AU 5 56135328 56135328 single base substitution A G intron_variant MELA-AU 5 56136540 56136540 single base substitution C T intron_variant MELA-AU 5 56136716 56136716 single base substitution A T intron_variant MELA-AU 5 56137097 56137097 single base substitution T C intron_variant MELA-AU 5 56138048 56138048 single base substitution C T intron_variant MELA-AU 5 56139593 56139593 single base substitution C T intron_variant MELA-AU 5 56139677 56139677 single base substitution C T intron_variant MELA-AU 5 56139864 56139864 single base substitution C T intron_variant MELA-AU 5 56140078 56140078 single base substitution C A intron_variant MELA-AU 5 56141000 56141003 deletion of <=200bp AATT - intron_variant MELA-AU 5 56141714 56141714 single base substitution C T intron_variant MELA-AU 5 56141788 56141789 multiple base substitution (>=2bp and <=200bp) GG TA intron_variant MELA-AU 5 56141951 56141951 single base substitution T C intron_variant MELA-AU 5 56142999 56142999 single base substitution C T intron_variant MELA-AU 5 56143964 56143964 single base substitution G A intron_variant MELA-AU 5 56145284 56145284 single base substitution T A intron_variant MELA-AU 5 56146000 56146000 single base substitution C T intron_variant MELA-AU 5 56146004 56146004 single base substitution C T intron_variant MELA-AU 5 56148087 56148103 deletion of <=200bp ATAGAAGAGTAGAGGAG - intron_variant MELA-AU 5 56148612 56148612 single base substitution C A intron_variant MELA-AU 5 56149376 56149376 single base substitution C A intron_variant MELA-AU 5 56149723 56149724 multiple base substitution (>=2bp and <=200bp) CC TT intron_variant MELA-AU 5 56150520 56150520 single base substitution C T intron_variant MELA-AU 5 56150924 56150924 single base substitution T C intron_variant MELA-AU 5 56151881 56151881 single base substitution C T intron_variant MELA-AU 5 56153364 56153364 single base substitution A G intron_variant MELA-AU 5 56153573 56153573 single base substitution G C intron_variant MELA-AU 5 56155026 56155026 single base substitution A C intron_variant MELA-AU 5 56155789 56155789 single base substitution T C intron_variant MELA-AU 5 56156461 56156461 single base substitution C T intron_variant MELA-AU 5 56156921 56156921 single base substitution C T intron_variant MELA-AU 5 56157480 56157480 single base substitution C T intron_variant MELA-AU 5 56158219 56158219 single base substitution G A intron_variant MELA-AU 5 56158301 56158301 single base substitution C T intron_variant MELA-AU 5 56158302 56158302 single base substitution C T intron_variant MELA-AU 5 56159414 56159414 insertion of <=200bp - A intron_variant MELA-AU 5 56160600 56160600 single base substitution T C missense_variant S292P 874T>C MELA-AU 5 56161807 56161807 single base substitution T C splice_region_variant MELA-AU 5 56161875 56161875 single base substitution C A intron_variant MELA-AU 5 56161994 56161994 single base substitution C A intron_variant MELA-AU 5 56162165 56162165 single base substitution T C intron_variant MELA-AU 5 56164421 56164421 single base substitution C T intron_variant MELA-AU 5 56164947 56164947 single base substitution A T intron_variant MELA-AU 5 56165483 56165483 single base substitution G A intron_variant MELA-AU 5 56166652 56166652 single base substitution A G intron_variant MELA-AU 5 56166742 56166742 single base substitution C T intron_variant MELA-AU 5 56167235 56167235 single base substitution T A intron_variant MELA-AU 5 56168511 56168511 single base substitution C T synonymous_variant P489P 1467C>T MELA-AU 5 56170694 56170694 single base substitution C T intron_variant MELA-AU 5 56171592 56171593 multiple base substitution (>=2bp and <=200bp) TT AA intron_variant MELA-AU 5 56173315 56173315 single base substitution C T intron_variant MELA-AU 5 56174617 56174617 single base substitution C T intron_variant MELA-AU 5 56175429 56175429 single base substitution C T intron_variant MELA-AU 5 56176913 56176913 single base substitution C T missense_variant S728F 2183C>T MELA-AU 5 56176913 56176913 single base substitution C T upstream_gene_variant MELA-AU 5 56176929 56176929 single base substitution T G synonymous_variant G733G 2199T>G MELA-AU 5 56176929 56176929 single base substitution T G upstream_gene_variant MELA-AU 5 56177153 56177153 single base substitution C T intron_variant MELA-AU 5 56177153 56177153 single base substitution C T upstream_gene_variant MELA-AU 5 56177353 56177353 single base substitution C T intron_variant MELA-AU 5 56177353 56177353 single base substitution C T upstream_gene_variant MELA-AU 5 56177635 56177635 single base substitution C T stop_gained Q870* 2608C>T MELA-AU 5 56177635 56177635 single base substitution C T upstream_gene_variant MELA-AU 5 56177745 56177745 single base substitution C T synonymous_variant V906V 2718C>T MELA-AU 5 56177745 56177745 single base substitution C T upstream_gene_variant MELA-AU 5 56178155 56178155 single base substitution C T missense_variant S1043F 3128C>T MELA-AU 5 56178155 56178155 single base substitution C T upstream_gene_variant MELA-AU 5 56178729 56178729 single base substitution C T intron_variant MELA-AU 5 56178729 56178729 single base substitution C T upstream_gene_variant MELA-AU 5 56179218 56179218 single base substitution C G intron_variant MELA-AU 5 56179218 56179218 single base substitution C G upstream_gene_variant MELA-AU 5 56180452 56180452 single base substitution A C intron_variant MELA-AU 5 56180452 56180452 single base substitution A C upstream_gene_variant MELA-AU 5 56181334 56181334 single base substitution T C intron_variant MELA-AU 5 56181334 56181334 single base substitution T C upstream_gene_variant MELA-AU 5 56181549 56181549 single base substitution C T intron_variant MELA-AU 5 56181549 56181549 single base substitution C T upstream_gene_variant MELA-AU 5 56182480 56182480 single base substitution C T intron_variant MELA-AU 5 56182558 56182558 single base substitution C T intron_variant MELA-AU 5 56182567 56182567 single base substitution C T intron_variant MELA-AU 5 56184342 56184342 single base substitution C T intron_variant MELA-AU 5 56185221 56185221 single base substitution C T intron_variant MELA-AU 5 56185489 56185489 single base substitution C T intron_variant MELA-AU 5 56186174 56186174 single base substitution C T intron_variant MELA-AU 5 56187301 56187301 single base substitution C T intron_variant MELA-AU 5 56187704 56187704 single base substitution C T intron_variant MELA-AU 5 56188092 56188093 multiple base substitution (>=2bp and <=200bp) CC TT intron_variant MELA-AU 5 56188707 56188707 single base substitution G A intron_variant MELA-AU 5 56189059 56189059 single base substitution G A intron_variant MELA-AU 5 56189288 56189288 single base substitution C T intron_variant MELA-AU 5 56191198 56191198 single base substitution T A 3_prime_UTR_variant MELA-AU 5 56191198 56191198 single base substitution T A exon_variant MELA-AU 5 56191650 56191650 single base substitution C T 3_prime_UTR_variant MELA-AU 5 56191650 56191650 single base substitution C T exon_variant MELA-AU 5 56192798 56192798 single base substitution C T downstream_gene_variant MELA-AU 5 56192806 56192806 single base substitution C T downstream_gene_variant MELA-AU 5 56192824 56192824 single base substitution C T downstream_gene_variant MELA-AU 5 56193298 56193298 single base substitution T G downstream_gene_variant MELA-AU 5 56194438 56194438 single base substitution A G downstream_gene_variant MELA-AU 5 56194521 56194521 single base substitution C T downstream_gene_variant MELA-AU 5 56196276 56196276 single base substitution G A downstream_gene_variant MELA-AU 5 56196891 56196891 single base substitution C T downstream_gene_variant ORCA-IN 5 56116959 56116959 single base substitution C G intron_variant ORCA-IN 5 56126737 56126737 single base substitution G C intron_variant ORCA-IN 5 56127342 56127342 single base substitution C G intron_variant ORCA-IN 5 56160071 56160071 single base substitution T C intron_variant ORCA-IN 5 56170947 56170947 single base substitution G T missense_variant S592I 1775G>T ORCA-IN 5 56174831 56174831 single base substitution T C missense_variant Y664H 1990T>C ORCA-IN 5 56176540 56176540 single base substitution G T missense_variant R697L 2090G>T OV-AU 5 56112412 56112412 single base substitution C T intron_variant OV-AU 5 56114022 56114022 single base substitution C G intron_variant OV-AU 5 56117823 56117823 single base substitution T A intron_variant OV-AU 5 56118874 56118874 single base substitution G A intron_variant OV-AU 5 56120944 56120944 single base substitution C G intron_variant OV-AU 5 56134566 56134566 single base substitution C G intron_variant OV-AU 5 56155162 56155162 single base substitution A T intron_variant OV-AU 5 56155284 56155284 single base substitution G T intron_variant OV-AU 5 56155693 56155693 single base substitution T G missense_variant V262G 785T>G OV-AU 5 56157522 56157522 single base substitution C T intron_variant OV-AU 5 56157562 56157562 single base substitution G A intron_variant OV-AU 5 56161414 56161414 single base substitution C A intron_variant OV-AU 5 56171020 56171020 single base substitution G A synonymous_variant G616G 1848G>A OV-AU 5 56190359 56190359 single base substitution A G 3_prime_UTR_variant OV-AU 5 56190359 56190359 single base substitution A G exon_variant PACA-AU 5 56106913 56106913 deletion of <=200bp A - upstream_gene_variant PACA-AU 5 56111424 56111424 single base substitution C T synonymous_variant R8R 24C>T PACA-AU 5 56113405 56113405 single base substitution C A intron_variant PACA-AU 5 56114033 56114033 single base substitution A C intron_variant PACA-AU 5 56116786 56116786 single base substitution G T intron_variant PACA-AU 5 56124710 56124714 deletion of <=200bp TTTTT - intron_variant PACA-AU 5 56130429 56130429 single base substitution G A intron_variant PACA-AU 5 56136682 56136682 single base substitution T C intron_variant PACA-AU 5 56139521 56139521 single base substitution C T intron_variant PACA-AU 5 56140469 56140469 single base substitution C A intron_variant PACA-AU 5 56147671 56147671 single base substitution G A intron_variant PACA-AU 5 56155732 56155732 single base substitution C T missense_variant S275F 824C>T PACA-AU 5 56156454 56156454 single base substitution C T intron_variant PACA-AU 5 56165367 56165367 single base substitution T A intron_variant PACA-AU 5 56168079 56168079 single base substitution C T intron_variant PACA-AU 5 56170538 56170538 insertion of <=200bp - T intron_variant PACA-AU 5 56176303 56176303 single base substitution T C intron_variant PACA-AU 5 56179172 56179172 single base substitution C T intron_variant PACA-AU 5 56179172 56179172 single base substitution C T upstream_gene_variant PACA-AU 5 56179592 56179592 single base substitution G A intron_variant PACA-AU 5 56179592 56179592 single base substitution G A upstream_gene_variant PACA-AU 5 56180143 56180143 single base substitution C G intron_variant PACA-AU 5 56180143 56180143 single base substitution C G upstream_gene_variant PACA-AU 5 56183015 56183015 single base substitution A G intron_variant PACA-AU 5 56187392 56187392 deletion of <=200bp G - intron_variant PACA-AU 5 56189469 56189469 single base substitution G A exon_variant PACA-AU 5 56189469 56189469 single base substitution G A missense_variant E1501K 4501G>A PACA-CA 5 56106824 56106824 single base substitution C G upstream_gene_variant PACA-CA 5 56107120 56107120 single base substitution T C upstream_gene_variant PACA-CA 5 56109095 56109095 single base substitution G A upstream_gene_variant PACA-CA 5 56115252 56115252 single base substitution C T intron_variant PACA-CA 5 56115896 56115896 single base substitution C A intron_variant PACA-CA 5 56117270 56117270 single base substitution T C intron_variant PACA-CA 5 56119744 56119747 deletion of <=200bp ACAT - intron_variant PACA-CA 5 56127646 56127646 single base substitution A G intron_variant PACA-CA 5 56137709 56137709 single base substitution G A intron_variant PACA-CA 5 56138050 56138050 insertion of <=200bp - A intron_variant PACA-CA 5 56141054 56141054 single base substitution G A intron_variant PACA-CA 5 56141273 56141273 single base substitution G T intron_variant PACA-CA 5 56143581 56143581 single base substitution A G intron_variant PACA-CA 5 56155870 56155870 insertion of <=200bp - G intron_variant PACA-CA 5 56165566 56165566 single base substitution G T intron_variant PACA-CA 5 56168606 56168606 single base substitution T G intron_variant PACA-CA 5 56168664 56168664 deletion of <=200bp A - frameshift_variant S506 PACA-CA 5 56169079 56169079 single base substitution A G intron_variant PACA-CA 5 56174625 56174625 single base substitution C T intron_variant PACA-CA 5 56177103 56177103 single base substitution A T splice_region_variant PACA-CA 5 56177103 56177103 single base substitution A T upstream_gene_variant PACA-CA 5 56178111 56178111 single base substitution A G synonymous_variant Q1028Q 3084A>G PACA-CA 5 56178111 56178111 single base substitution A G upstream_gene_variant PACA-CA 5 56178925 56178925 single base substitution G C intron_variant PACA-CA 5 56178925 56178925 single base substitution G C upstream_gene_variant PACA-CA 5 56181721 56181721 single base substitution G A intron_variant PACA-CA 5 56181721 56181721 single base substitution G A upstream_gene_variant PACA-CA 5 56183261 56183261 single base substitution G T exon_variant PACA-CA 5 56183261 56183261 single base substitution G T missense_variant A1391S 4171G>T PACA-CA 5 56183941 56183941 single base substitution C G exon_variant PACA-CA 5 56183941 56183941 single base substitution C G intron_variant PACA-CA 5 56183962 56183962 single base substitution C G exon_variant PACA-CA 5 56183962 56183962 single base substitution C G intron_variant PAEN-AU 5 56109927 56109927 single base substitution A G upstream_gene_variant PAEN-AU 5 56116783 56116783 single base substitution C A intron_variant PAEN-AU 5 56162262 56162262 single base substitution C A intron_variant PAEN-AU 5 56173708 56173708 single base substitution C G intron_variant PAEN-AU 5 56191980 56191980 single base substitution T G downstream_gene_variant PAEN-IT 5 56108547 56108547 single base substitution T A upstream_gene_variant PAEN-IT 5 56146563 56146563 single base substitution G T intron_variant PBCA-DE 5 56109047 56109047 single base substitution C T upstream_gene_variant PBCA-DE 5 56109612 56109612 single base substitution G A upstream_gene_variant PBCA-DE 5 56112270 56112270 single base substitution G A intron_variant PBCA-DE 5 56153455 56153455 single base substitution A G intron_variant PBCA-DE 5 56156757 56156757 single base substitution T A intron_variant PBCA-DE 5 56157414 56157414 single base substitution A G intron_variant PBCA-DE 5 56159560 56159560 single base substitution T G intron_variant PRAD-CA 5 56112391 56112391 single base substitution G A intron_variant PRAD-CA 5 56145997 56145997 single base substitution G A intron_variant PRAD-CA 5 56155378 56155378 single base substitution C T intron_variant PRAD-CA 5 56159882 56159882 single base substitution G A intron_variant PRAD-CA 5 56169179 56169179 single base substitution A C intron_variant PRAD-CA 5 56174452 56174452 single base substitution A G intron_variant PRAD-CA 5 56178277 56178277 single base substitution G A missense_variant D1084N 3250G>A PRAD-CA 5 56178277 56178277 single base substitution G A upstream_gene_variant PRAD-UK 5 56109494 56109494 single base substitution A G upstream_gene_variant PRAD-UK 5 56113389 56113390 deletion of <=200bp TA - intron_variant PRAD-UK 5 56116791 56116791 insertion of <=200bp - T intron_variant PRAD-UK 5 56116800 56116800 insertion of <=200bp - T intron_variant PRAD-UK 5 56119159 56119159 single base substitution C T intron_variant PRAD-UK 5 56130221 56130221 single base substitution A T intron_variant PRAD-UK 5 56157421 56157421 insertion of <=200bp - G intron_variant PRAD-UK 5 56194672 56194672 single base substitution G T downstream_gene_variant RECA-EU 5 56116132 56116132 single base substitution C T intron_variant RECA-EU 5 56117302 56117302 single base substitution A G intron_variant RECA-EU 5 56119845 56119845 single base substitution T G intron_variant RECA-EU 5 56121608 56121608 single base substitution G C intron_variant RECA-EU 5 56137641 56137641 single base substitution T C intron_variant RECA-EU 5 56140838 56140838 single base substitution A T intron_variant RECA-EU 5 56154870 56154870 single base substitution G T intron_variant RECA-EU 5 56155454 56155454 single base substitution A G intron_variant RECA-EU 5 56166534 56166534 single base substitution T C intron_variant RECA-EU 5 56181767 56181767 single base substitution G A missense_variant V1331M 3991G>A RECA-EU 5 56181767 56181767 single base substitution G A upstream_gene_variant RECA-EU 5 56185609 56185609 single base substitution C G intron_variant RECA-EU 5 56185833 56185833 single base substitution C A intron_variant RECA-EU 5 56190332 56190332 single base substitution C A 3_prime_UTR_variant RECA-EU 5 56190332 56190332 single base substitution C A exon_variant RECA-EU 5 56194092 56194092 single base substitution C A downstream_gene_variant RECA-EU 5 56194392 56194392 single base substitution G C downstream_gene_variant SKCA-BR 5 56107561 56107561 single base substitution C T upstream_gene_variant SKCA-BR 5 56111768 56111768 single base substitution A C missense_variant H123P 368A>C SKCA-BR 5 56111839 56111839 single base substitution C G missense_variant R147G 439C>G SKCA-BR 5 56111927 56111927 single base substitution C T intron_variant SKCA-BR 5 56114159 56114159 single base substitution C T intron_variant SKCA-BR 5 56123286 56123286 single base substitution C T intron_variant SKCA-BR 5 56123468 56123468 single base substitution A G intron_variant SKCA-BR 5 56125176 56125176 insertion of <=200bp - AT intron_variant SKCA-BR 5 56127006 56127006 single base substitution G T intron_variant SKCA-BR 5 56128939 56128939 single base substitution C T intron_variant SKCA-BR 5 56129490 56129490 single base substitution A G intron_variant SKCA-BR 5 56129517 56129517 single base substitution T A intron_variant SKCA-BR 5 56136697 56136697 insertion of <=200bp - GTT intron_variant SKCA-BR 5 56137522 56137522 single base substitution G A intron_variant SKCA-BR 5 56137787 56137787 single base substitution G A intron_variant SKCA-BR 5 56138215 56138215 single base substitution C T intron_variant SKCA-BR 5 56138873 56138873 single base substitution C T intron_variant SKCA-BR 5 56140010 56140010 insertion of <=200bp - GT intron_variant SKCA-BR 5 56142601 56142601 single base substitution G A intron_variant SKCA-BR 5 56145181 56145181 single base substitution A T intron_variant SKCA-BR 5 56150278 56150278 single base substitution G A intron_variant SKCA-BR 5 56150622 56150622 single base substitution G C intron_variant SKCA-BR 5 56153475 56153475 single base substitution C T intron_variant SKCA-BR 5 56154077 56154077 single base substitution C T intron_variant SKCA-BR 5 56155605 56155605 single base substitution C T missense_variant P233S 697C>T SKCA-BR 5 56157415 56157415 insertion of <=200bp - AG intron_variant SKCA-BR 5 56158630 56158630 single base substitution T A intron_variant SKCA-BR 5 56162189 56162189 single base substitution C T intron_variant SKCA-BR 5 56165607 56165607 single base substitution T A intron_variant SKCA-BR 5 56169235 56169235 single base substitution G A intron_variant SKCA-BR 5 56172646 56172646 single base substitution T C intron_variant SKCA-BR 5 56174855 56174855 single base substitution G C missense_variant E672Q 2014G>C SKCA-BR 5 56176735 56176735 single base substitution T A intron_variant SKCA-BR 5 56177109 56177109 single base substitution C T intron_variant SKCA-BR 5 56177109 56177109 single base substitution C T upstream_gene_variant SKCA-BR 5 56186131 56186131 single base substitution C T intron_variant SKCA-BR 5 56189883 56189883 single base substitution C T 3_prime_UTR_variant SKCA-BR 5 56189883 56189883 single base substitution C T exon_variant SKCA-BR 5 56190685 56190685 single base substitution A T 3_prime_UTR_variant SKCA-BR 5 56190685 56190685 single base substitution A T exon_variant SKCA-BR 5 56191193 56191193 single base substitution G T 3_prime_UTR_variant SKCA-BR 5 56191193 56191193 single base substitution G T exon_variant SKCA-BR 5 56191198 56191198 single base substitution T A 3_prime_UTR_variant SKCA-BR 5 56191198 56191198 single base substitution T A exon_variant SKCA-BR 5 56191803 56191803 insertion of <=200bp - CA 3_prime_UTR_variant SKCA-BR 5 56191803 56191803 insertion of <=200bp - CA exon_variant SKCA-BR 5 56193301 56193301 single base substitution T G downstream_gene_variant SKCA-BR 5 56194768 56194768 single base substitution T C downstream_gene_variant SKCM-US 5 56152577 56152577 single base substitution G A splice_region_variant SKCM-US 5 56161183 56161183 single base substitution G A missense_variant R351H 1052G>A SKCM-US 5 56174881 56174881 single base substitution C T synonymous_variant L680L 2040C>T SKCM-US 5 56177863 56177864 deletion of <=200bp AC - frameshift_variant T946 SKCM-US 5 56177863 56177864 deletion of <=200bp AC - upstream_gene_variant SKCM-US 5 56178115 56178115 single base substitution C T missense_variant H1030Y 3088C>T SKCM-US 5 56178115 56178115 single base substitution C T upstream_gene_variant SKCM-US 5 56178417 56178417 single base substitution C T synonymous_variant S1130S 3390C>T SKCM-US 5 56178417 56178417 single base substitution C T upstream_gene_variant STAD-US 5 56155650 56155650 single base substitution C T stop_gained R248* 742C>T STAD-US 5 56168713 56168713 single base substitution G A missense_variant V523I 1567G>A STAD-US 5 56170909 56170910 deletion of <=200bp GA - frameshift_variant VR579 STAD-US 5 56177584 56177584 single base substitution C T missense_variant R853C 2557C>T STAD-US 5 56177584 56177584 single base substitution C T upstream_gene_variant STAD-US 5 56177588 56177588 single base substitution G A missense_variant R854H 2561G>A STAD-US 5 56177588 56177588 single base substitution G A upstream_gene_variant STAD-US 5 56177984 56177986 deletion of <=200bp CTT - inframe_deletion PS986P STAD-US 5 56177984 56177986 deletion of <=200bp CTT - upstream_gene_variant STAD-US 5 56178088 56178089 deletion of <=200bp AC - frameshift_variant T1021 STAD-US 5 56178088 56178089 deletion of <=200bp AC - upstream_gene_variant STAD-US 5 56178223 56178223 single base substitution A G missense_variant T1066A 3196A>G STAD-US 5 56178223 56178223 single base substitution A G upstream_gene_variant STAD-US 5 56179395 56179395 single base substitution G A synonymous_variant P1236P 3708G>A STAD-US 5 56179395 56179395 single base substitution G A upstream_gene_variant STAD-US 5 56181765 56181765 single base substitution C T missense_variant S1330L 3989C>T STAD-US 5 56181765 56181765 single base substitution C T upstream_gene_variant THCA-SA 5 56111342 56111342 single base substitution G A upstream_gene_variant THCA-SA 5 56191160 56191160 single base substitution A G 3_prime_UTR_variant THCA-SA 5 56191160 56191160 single base substitution A G exon_variant THCA-US 5 56180602 56180602 single base substitution G T stop_gained G1311* 3931G>T THCA-US 5 56180602 56180602 single base substitution G T upstream_gene_variant THCA-US 5 56181836 56181836 single base substitution C G exon_variant THCA-US 5 56181836 56181836 single base substitution C G missense_variant L1354V 4060C>G UCEC-US 5 56152446 56152446 single base substitution G T stop_gained E168* 502G>T UCEC-US 5 56160592 56160592 single base substitution G T missense_variant R289I 866G>T UCEC-US 5 56160643 56160643 single base substitution G A missense_variant R306H 917G>A UCEC-US 5 56161195 56161195 single base substitution G A missense_variant C355Y 1064G>A UCEC-US 5 56161222 56161222 single base substitution G A missense_variant R364Q 1091G>A UCEC-US 5 56161690 56161690 single base substitution G A missense_variant R396H 1187G>A UCEC-US 5 56167786 56167786 single base substitution C T missense_variant L451F 1351C>T UCEC-US 5 56167795 56167795 single base substitution G T stop_gained E454* 1360G>T UCEC-US 5 56167798 56167798 single base substitution A C missense_variant S455R 1363A>C UCEC-US 5 56168494 56168494 single base substitution G T stop_gained E484* 1450G>T UCEC-US 5 56170989 56170989 single base substitution C A missense_variant S606Y 1817C>A UCEC-US 5 56171084 56171084 single base substitution G A missense_variant V638I 1912G>A UCEC-US 5 56174829 56174829 single base substitution T C missense_variant V663A 1988T>C UCEC-US 5 56176545 56176545 single base substitution A G missense_variant S699G 2095A>G UCEC-US 5 56176590 56176590 insertion of <=200bp - C frameshift_variant A714R? UCEC-US 5 56176590 56176590 single base substitution G A missense_variant A714T 2140G>A UCEC-US 5 56177039 56177039 single base substitution C T missense_variant A770V 2309C>T UCEC-US 5 56177039 56177039 single base substitution C T upstream_gene_variant UCEC-US 5 56177505 56177505 single base substitution G T missense_variant M826I 2478G>T UCEC-US 5 56177505 56177505 single base substitution G T upstream_gene_variant UCEC-US 5 56177542 56177542 single base substitution G T stop_gained E839* 2515G>T UCEC-US 5 56177542 56177542 single base substitution G T upstream_gene_variant UCEC-US 5 56177719 56177719 single base substitution G T stop_gained E898* 2692G>T UCEC-US 5 56177719 56177719 single base substitution G T upstream_gene_variant UCEC-US 5 56177811 56177811 insertion of <=200bp - TA frameshift_variant S928S? UCEC-US 5 56177811 56177811 insertion of <=200bp - TA upstream_gene_variant UCEC-US 5 56177887 56177887 single base substitution C A missense_variant P954T 2860C>A UCEC-US 5 56177887 56177887 single base substitution C A upstream_gene_variant UCEC-US 5 56177920 56177920 insertion of <=200bp - AGTG frameshift_variant Q965SA? UCEC-US 5 56177920 56177920 insertion of <=200bp - AGTG upstream_gene_variant UCEC-US 5 56177934 56177934 single base substitution C A synonymous_variant S969S 2907C>A UCEC-US 5 56177934 56177934 single base substitution C A upstream_gene_variant UCEC-US 5 56177968 56177968 single base substitution C G missense_variant P981A 2941C>G UCEC-US 5 56177968 56177968 single base substitution C G upstream_gene_variant UCEC-US 5 56178041 56178041 single base substitution G T missense_variant R1005I 3014G>T UCEC-US 5 56178041 56178041 single base substitution G T upstream_gene_variant UCEC-US 5 56178423 56178423 single base substitution T G missense_variant I1132M 3396T>G UCEC-US 5 56178423 56178423 single base substitution T G upstream_gene_variant UCEC-US 5 56179357 56179357 single base substitution C T missense_variant P1224S 3670C>T UCEC-US 5 56179357 56179357 single base substitution C T upstream_gene_variant UCEC-US 5 56179374 56179374 single base substitution A G synonymous_variant G1229G 3687A>G UCEC-US 5 56179374 56179374 single base substitution A G upstream_gene_variant UCEC-US 5 56179442 56179442 single base substitution G A missense_variant G1252E 3755G>A UCEC-US 5 56179442 56179442 single base substitution G A upstream_gene_variant UCEC-US 5 56180520 56180520 single base substitution G T missense_variant E1283D 3849G>T UCEC-US 5 56180520 56180520 single base substitution G T upstream_gene_variant UCEC-US 5 56181803 56181803 single base substitution G T exon_variant UCEC-US 5 56181803 56181803 single base substitution G T stop_gained E1343* 4027G>T UCEC-US 5 56181859 56181859 single base substitution T G exon_variant UCEC-US 5 56181859 56181859 single base substitution T G missense_variant H1361Q 4083T>G

Mutation - COSMIC Sample Name Mutation ID Mutation CDS Mutation AA Mutation Description Mutation Genome Position Mutation Strand Pat_14_B COSM5868658 c.1823G>A p.G608D Substitution - Missense 5:56875168-56875168 + S02273 COSM5682109 c.861C>T p.P287P Substitution - coding silent 5:56864760-56864760 + TCGA-FS-A1YY-06 COSM3617199 c.3088C>T p.H1030Y Substitution - Missense 5:56882288-56882288 + PD11740a COSM5801377 c.938_939insA p.A314fs*12 Insertion - Frameshift 5:56864837-56864838 + SNUH_G73_S1 COSM4159918 c.3190A>C p.R1064R Substitution - coding silent 5:56882390-56882390 + TCGA-D1-A17Q-01 COSM1069048 c.3014G>T p.R1005I Substitution - Missense 5:56882214-56882214 + PD13757a COSM1437982 c.3989C>T p.S1330L Substitution - Missense 5:56885938-56885938 + TCGA-BG-A0W1-01 COSM1069026 c.2140_2141insC p.G715fs*21 Insertion - Frameshift 5:56880763-56880764 + ESCC_156 COSM5646052 c.4082A>G p.H1361R Substitution - Missense 5:56886031-56886031 + 15919 COSM5029084 c.3775C>T p.Q1259* Substitution - Nonsense 5:56883635-56883635 + PD13755a COSM5752233 c.2537delC p.T847fs*10 Deletion - Frameshift 5:56881737-56881737 + TCGA-AP-A056-01 COSM1069040 c.2860C>A p.P954T Substitution - Missense 5:56882060-56882060 + TCGA-EW-A1OY-01 COSM5231632 c.3825delT p.Y1276fs*12 Deletion - Frameshift 5:56884669-56884669 + ESCC_BICR_008T COSM5428942 c.2540C>T p.T847I Substitution - Missense 5:56881740-56881740 + TCGA-BP-4342-01 COSM3366107 c.2986G>T p.G996C Substitution - Missense 5:56882186-56882186 + UD-SCC-2 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + 8058330 COSM3393615 c.24C>T p.R8R Substitution - coding silent 5:56815597-56815597 + CHC1629T COSM4791798 c.1917G>A p.L639L Substitution - coding silent 5:56875262-56875262 + PD11361a COSM5752164 c.2972_2987del16 p.S992fs*85 Deletion - Frameshift 5:56882172-56882187 + CSCC-62-T COSM4516173 c.1651_1652CC>TT p.P551F Substitution - Missense 5:56872970-56872971 + TCGA-A3-3346-01 COSM1496122 c.3334G>A p.V1112M Substitution - Missense 5:56882534-56882534 + TCGA-A8-A09B-01 COSM449810 c.1292C>A p.S431* Substitution - Nonsense 5:56865968-56865968 + PD13755a COSM5802503 c.2087_2087+1insG p.S696fs*40 Unknown 5:56879101-56879102 + 1057 COSM5730748 c.2220_2221insC p.I741fs*7 Insertion - Frameshift 5:56881123-56881124 + ESCC_BICR_063T COSM5436985 c.1907G>A p.C636Y Substitution - Missense 5:56875252-56875252 + 1292-01-02TD COSM5417358 c.1332T>G p.P444P Substitution - coding silent 5:56871940-56871940 + PD4266a COSM5752339 c.3502_3514del13 p.K1168fs*18 Deletion - Frameshift 5:56882702-56882714 + TCGA-EE-A29D-06 COSM3617201 c.3390C>T p.S1130S Substitution - coding silent 5:56882590-56882590 + ML_50_T_01 COSM5038562 c.439C>G p.R147G Substitution - Missense 5:56816012-56816012 + TCGA-A2-A0YD-01 COSM449877 c.3645_3646insA p.I1216fs*23 Insertion - Frameshift 5:56882845-56882846 + 6T COSM3715217 c.1990T>C p.Y664H Substitution - Missense 5:56879004-56879004 + CSCC-27-T COSM4489422 c.3472C>T p.P1158S Substitution - Missense 5:56882672-56882672 + SH-102782 COSM5019115 c.3084A>G p.Q1028Q Substitution - coding silent 5:56882284-56882284 + SCC-9 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + TCGA-BH-A42V-01 COSM449835 c.2281_2284delATAG p.R763fs*35 Deletion - Frameshift 5:56881184-56881187 + TCGA-D1-A176-01 COSM1069030 c.2328T>C p.I776I Substitution - coding silent 5:56881231-56881231 + PT38 COSM5922448 c.1378G>A p.E460K Substitution - Missense 5:56871986-56871986 + TCGA-AN-A03X-01 COSM449831 c.2068A>T p.K690* Substitution - Nonsense 5:56879082-56879082 + TCGA-33-4586-01 COSM738482 c.1641G>T p.Q547H Substitution - Missense 5:56872960-56872960 + TCGA-41-2573-01 COSM3410332 c.3708G>A p.P1236P Substitution - coding silent 5:56883568-56883568 + B59-Tumor COSM1757135 c.2510T>A p.L837Q Substitution - Missense 5:56881710-56881710 + TCGA-DK-A2I4-01 COSM3776766 c.3339C>T p.F1113F Substitution - coding silent 5:56882539-56882539 + 1023 COSM5730750 c.1388G>C p.C463S Substitution - Missense 5:56871996-56871996 + PD8828a COSM5752447 c.2324_2325delAT p.I776fs*4 Deletion - Frameshift 5:56881227-56881228 + C658 COSM4443521 c.2267G>T p.G756V Substitution - Missense 5:56881170-56881170 + TCGA-CG-4306-01 COSM3410332 c.3708G>A p.P1236P Substitution - coding silent 5:56883568-56883568 + TCGA-AC-A2FF-01 COSM5205426 c.2143_2144insGA p.L717fs*9 Insertion - Frameshift 5:56880766-56880767 + TCGA-A8-A08Z-01 COSM449861 c.3142C>T p.Q1048* Substitution - Nonsense 5:56882342-56882342 + TCGA-B6-A0IO-01 COSM449821 c.1708delG p.G570fs*10 Deletion - Frameshift 5:56875053-56875053 + PD7202a COSM5752408 c.386_404del19 p.A130fs*49 Deletion - Frameshift 5:56815959-56815977 + TCGA-06-2559 COSM2152658 c.1462T>C p.C488R Substitution - Missense 5:56872679-56872679 + TCGA-A2-A0YK-01 COSM449865 c.3230C>G p.S1077* Substitution - Nonsense 5:56882430-56882430 + 1953_T COSM3947619 c.1016G>T p.R339L Substitution - Missense 5:56864915-56864915 + UM-SCC-47 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + TCGA-BH-A0W5-01 COSM449863 c.3226delC p.S1077fs*5 Deletion - Frameshift 5:56882426-56882426 + SNUH_G10_S1 COSM4003564 c.2416G>A p.D806N Substitution - Missense 5:56881616-56881616 + TCGA-BR-4201-01 COSM1192394 c.2557C>T p.R853C Substitution - Missense 5:56881757-56881757 + SNU-C2B COSM3344769 c.1090C>T p.R364W Substitution - Missense 5:56865394-56865394 + PTC-10C COSM4159917 c.351G>C p.A117A Substitution - coding silent 5:56815924-56815924 + TCGA-BH-A0DT-01 COSM449808 c.1187_1188insT p.S397fs*1 Insertion - Frameshift 5:56865863-56865864 + TCGA-BS-A0UM-01 COSM1069038 c.2784_2785insTA p.E929fs*1 Insertion - Frameshift 5:56881984-56881985 + TCGA-ET-A39N-01 COSM1437980 c.3931G>T p.G1311* Substitution - Nonsense 5:56884775-56884775 + TCGA-CC-A7II-01 COSM4937519 c.2221A>G p.I741V Substitution - Missense 5:56881124-56881124 + SH-7166 COSM5019115 c.3084A>G p.Q1028Q Substitution - coding silent 5:56882284-56882284 + HCT15 COSM1671661 c.4421C>A p.P1474H Substitution - Missense 5:56893562-56893562 + PD9570a COSM5802130 c.3768_3770delTTG p.C1257delC Deletion - In frame 5:56883628-56883630 + EGC3 COSM5061131 c.3476delA p.K1160fs*12 Deletion - Frameshift 5:56882676-56882676 + 1166 COSM5730845 c.1910G>C p.S637T Substitution - Missense 5:56875255-56875255 + PD18776a COSM5752609 c.3943G>T p.E1315* Substitution - Nonsense 5:56884787-56884787 + TCGA-IR-A3LA-01 COSM4844994 c.773C>T p.S258L Substitution - Missense 5:56859854-56859854 + TCGA-AX-A05Z-01 COSM1069001 c.866G>T p.R289I Substitution - Missense 5:56864765-56864765 + SH-1362 COSM5019274 c.2177C>T p.A726V Substitution - Missense 5:56880800-56880800 + CSCC-42-T COSM4544361 c.3556G>A p.E1186K Substitution - Missense 5:56882756-56882756 + TCGA-E2-A15G-01 COSM449845 c.2571delG p.A858fs*16 Deletion - Frameshift 5:56881771-56881771 + UM-SCC-2 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + LUAD-B02594 COSM336841 c.1432G>A p.E478K Substitution - Missense 5:56872649-56872649 + TCGA-DU-A5TU-01 COSM3396609 c.3250G>A p.D1084N Substitution - Missense 5:56882450-56882450 + PD13623a COSM5752783 c.3751_3752insT p.G1252fs*21 Insertion - Frameshift 5:56883611-56883612 + PD13792a COSM5024987 c.750_771del22 p.P251fs*5 Deletion - Frameshift 5:56859831-56859852 + TCGA-HC-7080-01 COSM3674469 c.2013G>T p.A671A Substitution - coding silent 5:56879027-56879027 + TCGA-B5-A11N-01 COSM1068999 c.502G>T p.E168* Substitution - Nonsense 5:56856619-56856619 + PD13618a COSM5752781 c.4447_4448insA p.D1483fs*>31 Insertion - Frameshift 5:56893588-56893589 + TCGA-BR-8680-01 COSM1437982 c.3989C>T p.S1330L Substitution - Missense 5:56885938-56885938 + TCGA-AP-A056-01 COSM1069003 c.917G>A p.R306H Substitution - Missense 5:56864816-56864816 + HCC2998 COSM3344841 c.3444T>G p.T1148T Substitution - coding silent 5:56882644-56882644 + C0045T COSM4155845 c.3991G>A p.V1331M Substitution - Missense 5:56885940-56885940 + J83_T COSM3947617 c.940G>T p.A314S Substitution - Missense 5:56864839-56864839 + PD11343a COSM5800959 c.3814_3815insA p.Q1273fs*11 Insertion - Frameshift 5:56883674-56883675 + WSU-HN13 COSM4601394 c.2822_2827delCAACAA p.T948_T949delTT Deletion - In frame 5:56882022-56882027 + TCGA-BH-A18M-01 COSM449875 c.3544G>T p.E1182* Substitution - Nonsense 5:56882744-56882744 + PD18247a COSM5752265 c.891delA p.P298fs*14 Deletion - Frameshift 5:56864790-56864790 + TCGA-FD-A3SL-01 COSM3776768 c.4064G>A p.R1355H Substitution - Missense 5:56886013-56886013 + PD13419a COSM5752200 c.1868delC p.Q624fs*32 Deletion - Frameshift 5:56875213-56875213 + PD13419a COSM5752200 c.1868delC p.Q624fs*32 Deletion - Frameshift 5:56875213-56875213 + PD8828a COSM5752447 c.2324_2325delAT p.I776fs*4 Deletion - Frameshift 5:56881227-56881228 + 18183 COSM5029184 c.4474C>T p.Q1492* Substitution - Nonsense 5:56893615-56893615 + TCGA-D8-A1JH-01 COSM1486868 c.4310G>C p.C1437S Substitution - Missense 5:56888278-56888278 + 8061112 COSM3393616 c.824C>T p.S275F Substitution - Missense 5:56859905-56859905 + TCGA-A7-A5ZW-01 COSM5835060 c.3771delT p.Y1258fs*11 Deletion - Frameshift 5:56883631-56883631 + CHC2141T COSM4790247 c.3674A>C p.E1225A Substitution - Missense 5:56883534-56883534 + TCGA-12-0619 COSM2153645 c.971C>T p.P324L Substitution - Missense 5:56864870-56864870 + TCGA-A8-A086-01 COSM449847 c.2847_2848delAG p.E950fs*53 Deletion - Frameshift 5:56882047-56882048 + 16063 COSM5029148 c.1883C>G p.S628* Substitution - Nonsense 5:56875228-56875228 + DM1 COSM5611324 c.3465_3466CC>TT p.(=) Unknown 5:56882665-56882666 + TCGA-A2-A04N-01 COSM449816 c.1490delC p.S497fs*60 Deletion - Frameshift 5:56872707-56872707 + 17902 COSM5029168 c.3883_3884delAT p.I1295fs*13 Deletion - Frameshift 5:56884727-56884728 + SH-0348 COSM5019115 c.3084A>G p.Q1028Q Substitution - coding silent 5:56882284-56882284 + SH-9248 COSM5019692 c.764A>G p.N255S Substitution - Missense 5:56859845-56859845 + PD13427a COSM5752769 c.910_911insCAAACCGC p.R307fs*8 Insertion - Frameshift 5:56864809-56864810 + PD11756a COSM5752549 c.1897G>T p.E633* Substitution - Nonsense 5:56875242-56875242 + CAL33 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + TCGA-A7-A0DB-01 COSM449829 c.2010_2011insGC p.E672fs*14 Insertion - Frameshift 5:56879024-56879025 + OSCC-GB_00230111 COSM3715215 c.1775G>T p.S592I Substitution - Missense 5:56875120-56875120 + PD11343a COSM5802174 c.4065_4082del18 p.G1356_H1361delGLSYLH Deletion - In frame 5:56886014-56886031 + TCGA-AX-A063-01 COSM1069028 c.2309C>T p.A770V Substitution - Missense 5:56881212-56881212 + TCGA-E2-A15G-01 COSM449792 c.839A>C p.Q280P Substitution - Missense 5:56864738-56864738 + HT55 COSM3344862 c.3946A>T p.K1316* Substitution - Nonsense 5:56884790-56884790 + TCGA-BS-A0TC-01 COSM1069034 c.2515G>T p.E839* Substitution - Nonsense 5:56881715-56881715 + TCGA-A8-A06P-01 COSM449867 c.3372_3373insT p.N1125fs*1 Insertion - Frameshift 5:56882572-56882573 + PD13618a COSM5802311 c.4448_4449insA p.D1483fs*>31 Insertion - Frameshift 5:56893589-56893590 + 1004 COSM5730746 c.935_936insG p.R313fs*13 Insertion - Frameshift 5:56864834-56864835 + 17868 COSM5029164 c.3801delT p.L1268fs*1 Deletion - Frameshift 5:56883661-56883661 + TCGA-AN-A03X-01 COSM449881 c.3832_3833delAG p.R1278fs*5 Deletion - Frameshift 5:56884676-56884677 + 17733 COSM5029166 c.3826_3827insA p.Y1276fs*1 Insertion - Frameshift 5:56884670-56884671 + PT52 COSM5939384 c.698C>T p.P233L Substitution - Missense 5:56859779-56859779 + S00842 COSM5662288 c.450C>T p.A150A Substitution - coding silent 5:56816023-56816023 + 1004 COSM5730966 c.1228delA p.K410fs*26 Deletion - Frameshift 5:56865904-56865904 + 16561 COSM5029078 c.2369_2369+2delGGT p.? Unknown 5:56881272-56881274 + TCGA-A8-A082-01 COSM449894 c.4221delA p.Q1408fs*14 Deletion - Frameshift 5:56887484-56887484 + PD4075a COSM3355776 c.1303_1304insA p.I435fs*4 Insertion - Frameshift 5:56871911-56871912 + HX29T COSM3661858 c.389C>A p.A130E Substitution - Missense 5:56815962-56815962 + Gp2D COSM3344751 c.620G>A p.R207K Substitution - Missense 5:56856737-56856737 + 3N09-VS-3T09 COSM4979270 c.3255G>A p.L1085L Substitution - coding silent 5:56882455-56882455 + TCGA-BH-A0BO-01 COSM449888 c.4150_4151insT p.R1385fs*35 Insertion - Frameshift 5:56887413-56887414 + PD6046a COSM5752386 c.2736delA p.G914fs*7 Deletion - Frameshift 5:56881936-56881936 + TCGA-12-0619-01 COSM2153645 c.971C>T p.P324L Substitution - Missense 5:56864870-56864870 + SNUH_G16_S1 COSM3683862 c.2089C>T p.R697C Substitution - Missense 5:56880712-56880712 + sysucc-311T COSM5466491 c.1036-6C>A p.? Unknown 5:56865334-56865334 + 3 COSM5731981 c.253C>T p.P85S Substitution - Missense 5:56815826-56815826 + HCT-116 COSM1671659 c.1051C>T p.R351C Substitution - Missense 5:56865355-56865355 + HCC120 COSM3661859 c.3754G>T p.G1252* Substitution - Nonsense 5:56883614-56883614 + BRC23 COSM5026313 c.1291_1292delTC p.S431fs*7 Deletion - Frameshift 5:56865967-56865968 + TCGA-DW-7837-01 COSM3994361 c.2307T>A p.P769P Substitution - coding silent 5:56881210-56881210 + CRC-21T COSM5479465 c.4088A>C p.N1363T Substitution - Missense 5:56886037-56886037 + PCSI_0058_Pa_X COSM5019115 c.3084A>G p.Q1028Q Substitution - coding silent 5:56882284-56882284 + TCGA-AP-A0LM-01 COSM1069036 c.2692G>T p.E898* Substitution - Nonsense 5:56881892-56881892 + TCGA-B0-5712-01 COSM1496120 c.4316T>G p.I1439S Substitution - Missense 5:56888284-56888284 + 15694 COSM5029274 c.720G>TT p.A241fs*60 Complex - frameshift 5:56859801-56859801 + BRC33 COSM5026324 c.4031C>A p.S1344* Substitution - Nonsense 5:56885980-56885980 + TCGA-A8-A06P-01 COSM449904 c.4419delC p.P1474fs*16 Deletion - Frameshift 5:56893560-56893560 + PTC-7C COSM5446406 c.2845_2847delACA p.T949delT Deletion - In frame 5:56882045-56882047 + 255 COSM3732076 c.1685A>G p.Q562R Substitution - Missense 5:56873004-56873004 + TCGA-G9-6342-01 COSM3674467 c.1765C>A p.H589N Substitution - Missense 5:56875110-56875110 + TCGA-A2-A0EU-01 COSM449796 c.953_954insA p.L319fs*7 Insertion - Frameshift 5:56864852-56864853 + ESO-153 COSM1257254 c.980T>C p.F327S Substitution - Missense 5:56864879-56864879 + 15894 COSM5029072 c.650_651insC p.V218fs*2 Insertion - Frameshift 5:56859731-56859732 + PD9574a COSM5752873 c.2757_2758insT p.L920fs*10 Insertion - Frameshift 5:56881957-56881958 + TCGA-CZ-4854-01 COSM3366109 c.3579G>C p.M1193I Substitution - Missense 5:56882779-56882779 + PD11359a COSM5802428 c.1952_1953insA p.Y651fs*1 Insertion - Frameshift 5:56875297-56875298 + PD13755a COSM5752233 c.2537delC p.T847fs*10 Deletion - Frameshift 5:56881737-56881737 + PD9842a COSM5752739 c.2287A>T p.R763* Substitution - Nonsense 5:56881190-56881190 + PD9606a COSM5752888 c.3230_3231insA p.N1079fs*2 Insertion - Frameshift 5:56882430-56882431 + OSCC-GB_01380111 COSM5953777 c.2090G>T p.R697L Substitution - Missense 5:56880713-56880713 + TCGA-AX-A05Z-01 COSM1069058 c.3849G>T p.E1283D Substitution - Missense 5:56884693-56884693 + TCGA-D8-A1XA-01 COSM449888 c.4150_4151insT p.R1385fs*35 Insertion - Frameshift 5:56887413-56887414 + TCGA-DA-A1HV-06 COSM3617197 c.2040C>T p.L680L Substitution - coding silent 5:56879054-56879054 + TCGA-BR-6852-01 COSM3855702 c.1567G>A p.V523I Substitution - Missense 5:56872886-56872886 + PD6016a2 COSM5752371 c.949_952delTACT p.L318fs*4 Deletion - Frameshift 5:56864848-56864851 + TCGA-B6-A0IM-01 COSM449833 c.2098C>T p.Q700* Substitution - Nonsense 5:56880721-56880721 + ESO-887 COSM1257258 c.3498C>T p.T1166T Substitution - coding silent 5:56882698-56882698 + TCGA-FS-A4F8-06 COSM1437964 c.1052G>A p.R351H Substitution - Missense 5:56865356-56865356 + TCGA-CG-5733-01 COSM3855706 c.3196A>G p.T1066A Substitution - Missense 5:56882396-56882396 + DM93 COSM5609294 c.1488A>G p.R496R Substitution - coding silent 5:56872705-56872705 + TCGA-E2-A1B4-01 COSM449873 c.3439_3440insT p.T1148fs*3 Insertion - Frameshift 5:56882639-56882640 + HCC142 COSM1620409 c.3226C>T p.P1076S Substitution - Missense 5:56882426-56882426 + TCGA-Q1-A73O-01 COSM4834457 c.2787G>A p.E929E Substitution - coding silent 5:56881987-56881987 + PD13619a COSM5752208 c.2246_2247delAC p.N749fs*14 Deletion - Frameshift 5:56881149-56881150 + PD9570a COSM5752871 c.1764_1765insCATGATGT p.S592fs*67 Insertion - Frameshift 5:56875109-56875110 + TCGA-CJ-5682-01 COSM482915 c.605T>A p.L202* Substitution - Nonsense 5:56856722-56856722 + PD13618a COSM5752779 c.4256_4257insG p.V1420fs*12 Insertion - Frameshift 5:56887519-56887520 + TCGA-BH-A1F5-01 COSM449861 c.3142C>T p.Q1048* Substitution - Nonsense 5:56882342-56882342 + 2492701 COSM3410328 c.1465C>T p.P489S Substitution - Missense 5:56872682-56872682 + PD17994a COSM5752592 c.4144C>T p.Q1382* Substitution - Nonsense 5:56887407-56887407 + WSU-HN6 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + 2492702 COSM3410328 c.1465C>T p.P489S Substitution - Missense 5:56872682-56872682 + TCGA-E9-A1RD-01 COSM1486849 c.2383_2384insT p.S796fs*11 Insertion - Frameshift 5:56881583-56881584 + TCGA-AX-A063-01 COSM1069042 c.2893_2894insAGTG p.C966fs*1 Insertion - Frameshift 5:56882093-56882094 + TCGA-B6-A0IM-01 COSM449910 c.4474delC p.Q1492fs*12 Deletion - Frameshift 5:56893615-56893615 + PD6418a COSM5752398 c.3407delT p.E1137fs*11 Deletion - Frameshift 5:56882607-56882607 + 68 COSM5014485 c.2081C>G p.A694G Substitution - Missense 5:56879095-56879095 + DLD1 COSM1671661 c.4421C>A p.P1474H Substitution - Missense 5:56893562-56893562 + 2011-2360:2012-325-T COSM4604882 c.2544C>A p.H848Q Substitution - Missense 5:56881744-56881744 + PD5961a COSM5802079 c.1369_1370insA p.T457fs*4 Insertion - Frameshift 5:56871977-56871978 + TCGA-E9-A1RD-01 COSM1486857 c.3432_3433insA p.T1145fs*6 Insertion - Frameshift 5:56882632-56882633 + ESO-157 COSM1257256 c.3071A>G p.K1024R Substitution - Missense 5:56882271-56882271 + TCGA-BR-4280-01 COSM1437982 c.3989C>T p.S1330L Substitution - Missense 5:56885938-56885938 + TCGA-E2-A1BD-01 COSM449835 c.2281_2284delATAG p.R763fs*35 Deletion - Frameshift 5:56881184-56881187 + GBM_IV-39 COSM4967272 c.2295G>A p.L765L Substitution - coding silent 5:56881198-56881198 + TCGA-C4-A0EZ-01 COSM420672 c.2929C>T p.Q977* Substitution - Nonsense 5:56882129-56882129 + PD17994a COSM5752592 c.4144C>T p.Q1382* Substitution - Nonsense 5:56887407-56887407 + TCGA-A2-A3Y0-01 COSM3828208 c.975C>A p.N325K Substitution - Missense 5:56864874-56864874 + TCGA-C8-A3M8-01 COSM5835056 c.1446_1447insA p.R483fs*10 Insertion - Frameshift 5:56872663-56872664 + PD9574a COSM5802434 c.2758_2759insT p.L920fs*10 Insertion - Frameshift 5:56881958-56881959 + TCGA-D1-A103-01 COSM1069059 c.4027G>T p.E1343* Substitution - Nonsense 5:56885976-56885976 + 2492703 COSM3410328 c.1465C>T p.P489S Substitution - Missense 5:56872682-56872682 + CSB14 COSM5026309 c.1177_1178insTA p.H393fs*44 Insertion - Frameshift 5:56865853-56865854 + TCGA-A6-5661-01 COSM1437974 c.2250T>A p.N750K Substitution - Missense 5:56881153-56881153 + BRC18 COSM5026328 c.4480C>T p.Q1494* Substitution - Nonsense 5:56893621-56893621 + PD18776a COSM5802079 c.1369_1370insA p.T457fs*4 Insertion - Frameshift 5:56871977-56871978 + PD18776a COSM5752609 c.3943G>T p.E1315* Substitution - Nonsense 5:56884787-56884787 + 15894 COSM5029086 c.4122_4133del12 p.L1375_D1378delLLID Deletion - In frame 5:56887385-56887396 + PD9606a COSM5752513 c.1864_1871delTCTTCCCA p.S622fs*21 Deletion - Frameshift 5:56875209-56875216 + PD18247a COSM5752267 c.3448delA p.K1150fs*22 Deletion - Frameshift 5:56882648-56882648 + PD5961a COSM5752369 c.2628delT p.L877fs*32 Deletion - Frameshift 5:56881828-56881828 + TCGA-JL-A3YX-01 COSM3828214 c.4031C>G p.S1344* Substitution - Nonsense 5:56885980-56885980 + TCGA-DU-7304-01 COSM1437982 c.3989C>T p.S1330L Substitution - Missense 5:56885938-56885938 + SNUH_G76_S1 COSM1311239 c.2563C>T p.R855C Substitution - Missense 5:56881763-56881763 + TCGA-AX-A0J0-01 COSM1069050 c.3396T>G p.I1132M Substitution - Missense 5:56882596-56882596 + SNUH_G73_S1 COSM4416190 c.2716G>A p.V906I Substitution - Missense 5:56881916-56881916 + 17612 COSM5029156 c.2965_2966delTC p.S989fs*14 Deletion - Frameshift 5:56882165-56882166 + EGC15 COSM5061129 c.1911C>T p.S637S Substitution - coding silent 5:56875256-56875256 + TCGA-FV-A2QQ-01 COSM4910779 c.3124C>G p.L1042V Substitution - Missense 5:56882324-56882324 + TCGA-BH-A0DT-01 COSM449798 c.971_974delCTAA p.N325fs*3 Deletion - Frameshift 5:56864870-56864873 + PD3851a COSM5029139 c.1099C>T p.Q367* Substitution - Nonsense 5:56865403-56865403 + CHC689T COSM1486837 c.817_818delAG p.R273fs*27 Deletion - Frameshift 5:56859898-56859899 + 16082 COSM1486865 c.3915_3917delCAT p.I1307delI Deletion - In frame 5:56884759-56884761 + 1034 COSM5730968 c.1604delA p.E536fs*21 Deletion - Frameshift 5:56872923-56872923 + TCGA-CJ-5684-01 COSM482921 c.2277T>C p.C759C Substitution - coding silent 5:56881180-56881180 + WSU-HN8 COSM4601394 c.2822_2827delCAACAA p.T948_T949delTT Deletion - In frame 5:56882022-56882027 + S02-14875-TP COSM4992365 c.3685G>A p.G1229R Substitution - Missense 5:56883545-56883545 + TCGA-CJ-4920-01 COSM482917 c.953T>G p.L318* Substitution - Nonsense 5:56864852-56864852 + TCGA-BH-A0BO-01 COSM449892 c.4206_4207insG p.E1404fs*16 Insertion - Frameshift 5:56887469-56887470 + COLO205 COSM3344778 c.1509C>T p.H503H Substitution - coding silent 5:56872828-56872828 + PD5956a COSM5752367 c.807_808delAA p.R270fs*30 Deletion - Frameshift 5:56859888-56859889 + B59 COSM1757135 c.2510T>A p.L837Q Substitution - Missense 5:56881710-56881710 + PD6418a COSM5752398 c.3407delT p.E1137fs*11 Deletion - Frameshift 5:56882607-56882607 + CHC2141T COSM1069008 c.1091G>A p.R364Q Substitution - Missense 5:56865395-56865395 + OSCC-GB_00060111 COSM3715217 c.1990T>C p.Y664H Substitution - Missense 5:56879004-56879004 + PD9842a COSM5752739 c.2287A>T p.R763* Substitution - Nonsense 5:56881190-56881190 + CAL27 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + PD4225a COSM5752646 c.1919C>A p.S640* Substitution - Nonsense 5:56875264-56875264 + BK0022 COSM4186331 c.2592A>C p.E864D Substitution - Missense 5:56881792-56881792 + TCGA-A8-A07F-01 COSM449857 c.3119delA p.D1040fs*42 Deletion - Frameshift 5:56882319-56882319 + PD11343a COSM5752742 c.3813_3814insA p.Q1273fs*11 Insertion - Frameshift 5:56883673-56883674 + S0004 COSM5884245 c.4384T>G p.F1462V Substitution - Missense 5:56888352-56888352 + SNUH_G16_S1 COSM4003564 c.2416G>A p.D806N Substitution - Missense 5:56881616-56881616 + TCGA-B6-A1KI-01 COSM5214505 c.2208delT p.Y736fs*1 Deletion - Frameshift 5:56881111-56881111 + TCGA-AP-A059-01 COSM1069024 c.2140G>A p.A714T Substitution - Missense 5:56880763-56880763 + LN229 COSM4594439 c.2822_2824delCAA p.T949delT Deletion - In frame 5:56882022-56882024 + SH-0348 COSM5019056 c.1566C>T p.T522T Substitution - coding silent 5:56872885-56872885 + TCGA-A2-A0CP-01 COSM449825 c.1801G>T p.E601* Substitution - Nonsense 5:56875146-56875146 + 9227_T COSM5039878 c.1885G>A p.G629R Substitution - Missense 5:56875230-56875230 + UM-SCC-17B COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + TCGA-66-2787-01 COSM738474 c.4367A>G p.N1456S Substitution - Missense 5:56888335-56888335 + 15977 COSM5029276 c.2738_2744AAGGATT>TC p.K913fs*15 Complex - frameshift 5:56881938-56881944 + AOCS-004-1-5 COSM4142003 c.785T>G p.V262G Substitution - Missense 5:56859866-56859866 + TCGA-BG-A0M7-01 COSM1069063 c.4105G>C p.D1369H Substitution - Missense 5:56886054-56886054 + WSU-HN12 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + BRC8 COSM5026305 c.1090C>G p.R364G Substitution - Missense 5:56865394-56865394 + TCGA-E9-A1N4-01 COSM1486859 c.3550G>T p.E1184* Substitution - Nonsense 5:56882750-56882750 + TCGA-AN-A0XS-01 COSM1486837 c.817_818delAG p.R273fs*27 Deletion - Frameshift 5:56859898-56859899 + PD8982a COSM5752869 c.21_22insC p.R8fs*16 Insertion - Frameshift 5:56815594-56815595 + TCGA-63-5128-01 COSM738478 c.2674A>T p.N892Y Substitution - Missense 5:56881874-56881874 + 23T COSM3715215 c.1775G>T p.S592I Substitution - Missense 5:56875120-56875120 + CRC-19T COSM5481983 c.3622C>T p.L1208L Substitution - coding silent 5:56882822-56882822 + TCGA-A5-A0GQ-01 COSM1069010 c.1187G>A p.R396H Substitution - Missense 5:56865863-56865863 + CCK81 COSM3344866 c.4093A>C p.I1365L Substitution - Missense 5:56886042-56886042 + S01861 COSM3774180 c.2824A>T p.T942S Substitution - Missense 5:56882024-56882024 + 16392 COSM5029088 c.4525C>T p.R1509C Substitution - Missense 5:56893666-56893666 + PD9574a COSM5801345 c.4069_4070ins11 p.L1357fs*24 Insertion - Frameshift 5:56886018-56886019 + TCGA-AO-A0J7-01 COSM5209003 c.3610_3611delAT p.I1204fs*7 Deletion - Frameshift 5:56882810-56882811 + XHDG51C COSM4767603 c.4182G>T p.R1394S Substitution - Missense 5:56887445-56887445 + TCGA-A8-A08Z-01 COSM449843 c.2510_2511delTG p.L838fs*24 Deletion - Frameshift 5:56881710-56881711 + TCGA-D1-A167-01 COSM1069008 c.1091G>A p.R364Q Substitution - Missense 5:56865395-56865395 + TCGA-DK-A1A7-01 COSM420674 c.484C>T p.R162C Substitution - Missense 5:56856601-56856601 + TCGA-EW-A1J1-01 COSM1486845 c.2280_2281insATAG p.L764fs*1 Insertion - Frameshift 5:56881183-56881184 + HCC120T COSM3661859 c.3754G>T p.G1252* Substitution - Nonsense 5:56883614-56883614 + HCC142T COSM1620411 c.4405A>T p.T1469S Substitution - Missense 5:56893546-56893546 + HCC67 COSM1620407 c.2179+4A>G p.? Unknown 5:56880806-56880806 + ESCC-059T COSM3941341 c.1879A>G p.I627V Substitution - Missense 5:56875224-56875224 + TCGA-G4-6628-01 COSM1437964 c.1052G>A p.R351H Substitution - Missense 5:56865356-56865356 + 426 COSM4432942 c.2937G>A p.M979I Substitution - Missense 5:56882137-56882137 + TCGA-A8-A090-01 COSM5200886 c.868_869insC p.S292fs*9 Insertion - Frameshift 5:56864767-56864768 + PD18247a COSM5752267 c.3448delA p.K1150fs*22 Deletion - Frameshift 5:56882648-56882648 + TCGA-D8-A1X6-01 COSM449796 c.953_954insA p.L319fs*7 Insertion - Frameshift 5:56864852-56864853 + UM-SCC-11B COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + TCGA-AP-A059-01 COSM1069056 c.3755G>A p.G1252E Substitution - Missense 5:56883615-56883615 + TCGA-E9-A1R6-01 COSM1486841 c.1886_1887insA p.D630fs*16 Insertion - Frameshift 5:56875231-56875232 + PD4878a COSM5025114 c.1327_1328insG p.C443fs*10 Insertion - Frameshift 5:56871935-56871936 + 16082 COSM5029160 c.3061_3062delAC p.Q1022fs*13 Deletion - Frameshift 5:56882261-56882262 + PD9606a COSM5752513 c.1864_1871delTCTTCCCA p.S622fs*21 Deletion - Frameshift 5:56875209-56875216 + CRC-19T COSM5481985 c.3819+2T>C p.? Unknown 5:56883681-56883681 + TCGA-D1-A17Q-01 COSM1069022 c.2095A>G p.S699G Substitution - Missense 5:56880718-56880718 + TCGA-A2-A0YF-01 COSM449884 c.4036_4038delGTT p.V1346delV Deletion - In frame 5:56885985-56885987 + S04-6933-TP COSM4992361 c.2945C>T p.A982V Substitution - Missense 5:56882145-56882145 + AOCS-109-1-X COSM4142005 c.1848G>A p.G616G Substitution - coding silent 5:56875193-56875193 + S01864 COSM5671800 c.2823A>T p.S941S Substitution - coding silent 5:56882023-56882023 + TCGA-BH-A0W5-01 COSM449841 c.2473A>T p.R825* Substitution - Nonsense 5:56881673-56881673 + PD11394a COSM5801680 c.970_971insT p.P324fs*2 Insertion - Frameshift 5:56864869-56864870 + BD79T COSM5520525 c.2564G>A p.R855H Substitution - Missense 5:56881764-56881764 + 21009 COSM5029150 c.2116_2117insT p.L707fs*29 Insertion - Frameshift 5:56880739-56880740 + 2012-693:2012-1306-T COSM4606304 c.1966-6C>A p.? Unknown 5:56878974-56878974 + PD5956a COSM5752367 c.807_808delAA p.R270fs*30 Deletion - Frameshift 5:56859888-56859889 + PD6046a COSM5752386 c.2736delA p.G914fs*7 Deletion - Frameshift 5:56881936-56881936 + sysucc-783T COSM1671659 c.1051C>T p.R351C Substitution - Missense 5:56865355-56865355 + S04-6933-TP COSM4992363 c.2946C>A p.A982A Substitution - coding silent 5:56882146-56882146 + PD13802a COSM5025047 c.1203_1204insA p.A402fs*5 Insertion - Frameshift 5:56865879-56865880 + HCC67T COSM1620407 c.2179+4A>G p.? Unknown 5:56880806-56880806 + SH-2871 COSM5019692 c.764A>G p.N255S Substitution - Missense 5:56859845-56859845 + PD11756a COSM5752549 c.1897G>T p.E633* Substitution - Nonsense 5:56875242-56875242 + TCGA-BH-A18N-01 COSM449837 c.2328_2329insGTCA p.T779fs*3 Insertion - Frameshift 5:56881231-56881232 + S10-44607-TP COSM4992359 c.675G>A p.M225I Substitution - Missense 5:56859756-56859756 + TCGA-A8-A09M-01 COSM449786 c.629_630insT p.V211fs*9 Insertion - Frameshift 5:56856746-56856747 + 587342 COSM1214386 c.3821T>C p.V1274A Substitution - Missense 5:56884665-56884665 + DM10 COSM5609291 c.484C>A p.R162S Substitution - Missense 5:56856601-56856601 + RK075_C01 COSM1634271 c.2240delA p.E747fs*15 Deletion - Frameshift 5:56881143-56881143 + PD4605a COSM5752341 c.813_814delAA p.R273fs*27 Deletion - Frameshift 5:56859894-56859895 + NOKSI COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + PD13427a COSM5752202 c.4241delC p.A1414fs*8 Deletion - Frameshift 5:56887504-56887504 + PD18776a COSM5752807 c.1368_1369insA p.T457fs*4 Insertion - Frameshift 5:56871976-56871977 + TCGA-C8-A12N-01 COSM449814 c.1369_1370delAC p.T457fs*3 Deletion - Frameshift 5:56871977-56871978 + PD13755a COSM5752786 c.2086_2087insG p.S696fs*40 Insertion - Frameshift 5:56879100-56879101 + ORL-48 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + CSB1 COSM5026315 c.2869C>T p.Q957* Substitution - Nonsense 5:56882069-56882069 + SH-7166 COSM5019056 c.1566C>T p.T522T Substitution - coding silent 5:56872885-56872885 + TCGA-CA-6717-01 COSM1437976 c.2316T>G p.F772L Substitution - Missense 5:56881219-56881219 + TCGA-GV-A3JV-01 COSM1311239 c.2563C>T p.R855C Substitution - Missense 5:56881763-56881763 + 2492729 COSM5729734 c.271C>T p.P91S Substitution - Missense 5:56815844-56815844 + TCGA-EW-A1P6-01 COSM1486855 c.3116_3117insA p.D1040fs*2 Insertion - Frameshift 5:56882316-56882317 + CSCC-27-T COSM4476904 c.2105C>T p.S702F Substitution - Missense 5:56880728-56880728 + RK225_C01 COSM4780297 c.3051A>G p.A1017A Substitution - coding silent 5:56882251-56882251 + 8052570 COSM3393618 c.4501G>A p.E1501K Substitution - Missense 5:56893642-56893642 + TCGA-AX-A063-01 COSM1069032 c.2478G>T p.M826I Substitution - Missense 5:56881678-56881678 + PD13307a COSM5752135 c.1895_1916>CATGCC p.V632fs*19 Complex - frameshift 5:56875240-56875261 + HCC2998 COSM1671657 c.1018G>C p.V340L Substitution - Missense 5:56864917-56864917 + TCGA-14-0790-01 COSM2153645 c.971C>T p.P324L Substitution - Missense 5:56864870-56864870 + pfg029T COSM1642767 c.3983-2A>G p.? Unknown 5:56885930-56885930 + CSB27 COSM5026319 c.3151delC p.L1052fs*30 Deletion - Frameshift 5:56882351-56882351 + Detroit_562 COSM4594439 c.2822_2824delCAA p.T949delT Deletion - In frame 5:56882022-56882024 + PD13427a COSM5752202 c.4241delC p.A1414fs*8 Deletion - Frameshift 5:56887504-56887504 + PT21_2 COSM3344843 c.3508G>T p.D1170Y Substitution - Missense 5:56882708-56882708 + 17733 COSM5029174 c.4056_4057insT p.L1353fs*10 Insertion - Frameshift 5:56886005-56886006 + HCT116 COSM1671659 c.1051C>T p.R351C Substitution - Missense 5:56865355-56865355 + C086 COSM5534245 c.2703C>T p.S901S Substitution - coding silent 5:56881903-56881903 + PD9574a COSM5752875 c.4068_4069ins11 p.H1361fs*20 Insertion - Frameshift 5:56886017-56886018 + TCGA-06-0743-01 COSM3410328 c.1465C>T p.P489S Substitution - Missense 5:56872682-56872682 + TCGA-D8-A1XB-01 COSM1486861 c.3709T>A p.Y1237N Substitution - Missense 5:56883569-56883569 + PD13619a COSM5752210 c.4152delA p.R1385fs*37 Deletion - Frameshift 5:56887415-56887415 + 17818 COSM5029139 c.1099C>T p.Q367* Substitution - Nonsense 5:56865403-56865403 + CSB17 COSM5026326 c.4032_4034delAGT p.V1346delV Deletion - In frame 5:56885981-56885983 + SH-102782 COSM5019056 c.1566C>T p.T522T Substitution - coding silent 5:56872885-56872885 + CSB14 COSM5026311 c.1179C>G p.H393Q Substitution - Missense 5:56865855-56865855 + TCGA-JL-A3YX-01 COSM5835055 c.1445_1446delAT p.N482fs*10 Deletion - Frameshift 5:56872662-56872663 + HCC2998 COSM1671657 c.1018G>C p.V340L Substitution - Missense 5:56864917-56864917 + PD24302a COSM5752828 c.1022_1023insG p.F341fs*44 Insertion - Frameshift 5:56864921-56864922 + CSCC-27-T COSM4492121 c.3918C>T p.I1306I Substitution - coding silent 5:56884762-56884762 + 15906 COSM5029146 c.1621_1624delCTTA p.T542fs*14 Deletion - Frameshift 5:56872940-56872943 + TCGA-C8-A12N-01 COSM449908 c.4472T>A p.L1491H Substitution - Missense 5:56893613-56893613 + PD11394a COSM5752757 c.969_970insT p.P324fs*2 Insertion - Frameshift 5:56864868-56864869 + PD4605a COSM5752341 c.813_814delAA p.R273fs*27 Deletion - Frameshift 5:56859894-56859895 + LN18 COSM4594439 c.2822_2824delCAA p.T949delT Deletion - In frame 5:56882022-56882024 + TCGA-A8-A08H-01 COSM449871 c.3384C>T p.L1128L Substitution - coding silent 5:56882584-56882584 + 17352 COSM5029171 c.3955_3956insA p.Y1319fs*1 Insertion - Frameshift 5:56884799-56884800 + 15510 COSM5029076 c.2280_2284delTATAG p.I761fs*1 Deletion - Frameshift 5:56881183-56881187 + TCGA-A3-3358-01 COSM482919 c.1423+2T>C p.? Unknown 5:56872033-56872033 + CHC2141T COSM4790247 c.3674A>C p.E1225A Substitution - Missense 5:56883534-56883534 + BRC8 COSM5026321 c.3803_3804insA p.M1269fs*4 Insertion - Frameshift 5:56883663-56883664 + 308_T COSM3947621 c.3572T>C p.I1191T Substitution - Missense 5:56882772-56882772 + TCGA-BH-A0E7-01 COSM449788 c.664delG p.G222fs*4 Deletion - Frameshift 5:56859745-56859745 + TCGA-AP-A0LP-01 COSM1069006 c.1064G>A p.C355Y Substitution - Missense 5:56865368-56865368 + DM45 COSM5609292 c.870C>T p.A290A Substitution - coding silent 5:56864769-56864769 + 15770 COSM5029080 c.2370_2371insG p.Y791fs*2 Insertion - Frameshift 5:56881570-56881571 + TCGA-E9-A1N9-01 COSM1486851 c.2927C>T p.S976F Substitution - Missense 5:56882127-56882127 + TCGA-E2-A1B4-01 COSM449855 c.3058C>T p.Q1020* Substitution - Nonsense 5:56882258-56882258 + TCGA-AN-A0AS-01 COSM449823 c.1759_1760insT p.S588fs*3 Insertion - Frameshift 5:56875104-56875105 + TCGA-BR-8360-01 COSM1192394 c.2557C>T p.R853C Substitution - Missense 5:56881757-56881757 + 18183 COSM1486837 c.817_818delAG p.R273fs*27 Deletion - Frameshift 5:56859898-56859899 + TCGA-BH-A1F5-01 COSM5219704 c.918delC p.R307fs*5 Deletion - Frameshift 5:56864817-56864817 + PD11756a COSM5752193 c.3646_3662del17 p.I1216fs*17 Deletion - Frameshift 5:56882846-56882862 + HCC061T COSM5805772 c.2032A>T p.R678* Substitution - Nonsense 5:56879046-56879046 + PD13618a COSM5801844 c.4257_4257+1insG p.V1420fs*12 Unknown 5:56887520-56887521 + PD9842a COSM5772730 c.2286T>C p.D762D Substitution - coding silent 5:56881189-56881189 + BD202T COSM5501338 c.4231G>A p.G1411R Substitution - Missense 5:56887494-56887494 + PD13619a COSM5752210 c.4152delA p.R1385fs*37 Deletion - Frameshift 5:56887415-56887415 + TCGA-A2-A0CP-01 COSM449806 c.1152+1G>T p.? Unknown 5:56865457-56865457 + 17646 COSM5029137 c.978delT p.F327fs*2 Deletion - Frameshift 5:56864877-56864877 + HCT-15 COSM1671661 c.4421C>A p.P1474H Substitution - Missense 5:56893562-56893562 + PD13623a COSM5801848 c.3752_3753insT p.G1252fs*21 Insertion - Frameshift 5:56883612-56883613 + 17327 COSM5029162 c.3100C>T p.P1034S Substitution - Missense 5:56882300-56882300 + 2492700 COSM3410328 c.1465C>T p.P489S Substitution - Missense 5:56872682-56872682 + TCGA-E2-A156-01 COSM449815 c.1439delG p.R480fs*7 Deletion - Frameshift 5:56872656-56872656 + TCGA-22-4593-01 COSM738476 c.2928C>T p.S976S Substitution - coding silent 5:56882128-56882128 + PD13619a COSM5752208 c.2246_2247delAC p.N749fs*14 Deletion - Frameshift 5:56881149-56881150 + PD4225a COSM5752646 c.1919C>A p.S640* Substitution - Nonsense 5:56875264-56875264 + TCGA-A7-A0DB-01 COSM449812 c.1366_1367insT p.T457fs*4 Insertion - Frameshift 5:56871974-56871975 + TCGA-AZ-4315-01 COSM1437984 c.4391T>G p.I1464S Substitution - Missense 5:56893532-56893532 + TCGA-AO-A0JF-01 COSM449896 c.4257G>A p.E1419E Substitution - coding silent 5:56887520-56887520 + TCGA-E2-A15C-01 COSM449804 c.1108_1109insCT p.S371fs*11 Insertion - Frameshift 5:56865412-56865413 + CSB1 COSM5026323 c.3851_3853delAAG p.E1286delE Deletion - In frame 5:56884695-56884697 + 15921 COSM5029152 c.2656C>T p.Q886* Substitution - Nonsense 5:56881856-56881856 + PD11394a COSM5752172 c.1065_1068delTATT p.H357fs*4 Deletion - Frameshift 5:56865369-56865372 + TCGA-BS-A0TC-01 COSM1069015 c.1450G>T p.E484* Substitution - Nonsense 5:56872667-56872667 + TCGA-B0-4816-01 COSM3774180 c.2824A>T p.T942S Substitution - Missense 5:56882024-56882024 + 18161 COSM5029141 c.1214_1215insT p.N406fs*1 Insertion - Frameshift 5:56865890-56865891 + 17586 COSM5029154 c.2816_2857del42 p.S939_K953>* Complex - deletion inframe 5:56882016-56882057 + Gp5D COSM3344751 c.620G>A p.R207K Substitution - Missense 5:56856737-56856737 + RK101_C01 COSM3702826 c.4196G>A p.G1399E Substitution - Missense 5:56887459-56887459 + TCGA-AX-A0J1-01 COSM1069012 c.1351C>T p.L451F Substitution - Missense 5:56871959-56871959 + TCGA-BR-4184-01 COSM3855700 c.742C>T p.R248* Substitution - Nonsense 5:56859823-56859823 + HT55 COSM3344861 c.3945G>T p.E1315D Substitution - Missense 5:56884789-56884789 + TCGA-AX-A063-01 COSM1069061 c.4083T>G p.H1361Q Substitution - Missense 5:56886032-56886032 + PD7201a COSM5752407 c.1428_1437del10 p.C479fs*5 Deletion - Frameshift 5:56872645-56872654 + 17636 COSM5029178 c.4187C>T p.A1396V Substitution - Missense 5:56887450-56887450 + TCGA-D8-A1XB-01 COSM1486847 c.2369G>T p.R790M Substitution - Missense 5:56881272-56881272 + TCGA-AP-A0LD-01 COSM1069046 c.2941C>G p.P981A Substitution - Missense 5:56882141-56882141 + PD13768a COSM5752242 c.3880_3884delGAGAT p.E1294fs*13 Deletion - Frameshift 5:56884724-56884728 + TCGA-D8-A1JU-01 COSM1486837 c.817_818delAG p.R273fs*27 Deletion - Frameshift 5:56859898-56859899 + PD5961a COSM5752369 c.2628delT p.L877fs*32 Deletion - Frameshift 5:56881828-56881828 + B89-12 COSM1757137 c.2968A>T p.T990S Substitution - Missense 5:56882168-56882168 + CHC2141T COSM1069008 c.1091G>A p.R364Q Substitution - Missense 5:56865395-56865395 + TCGA-E2-A15O-01 COSM449794 c.852_853delCA p.P286fs*14 Deletion - Frameshift 5:56864751-56864752 + TCGA-D8-A27L-01 COSM1486863 c.3865_3866insA p.A1290fs*19 Insertion - Frameshift 5:56884709-56884710 + TCGA-A2-A04N-01 COSM449902 c.4310G>T p.C1437F Substitution - Missense 5:56888278-56888278 + 17612 COSM5029135 c.875C>G p.S292* Substitution - Nonsense 5:56864774-56864774 + TCGA-B6-A0IO-01 COSM449819 c.1594C>T p.R532* Substitution - Nonsense 5:56872913-56872913 + TCGA-A8-A09B-01 COSM449800 c.1035G>A p.Q345Q Substitution - coding silent 5:56864934-56864934 + PD3851a COSM5029139 c.1099C>T p.Q367* Substitution - Nonsense 5:56865403-56865403 + TCGA-A2-A259-01 COSM1486866 c.4298G>C p.W1433S Substitution - Missense 5:56888266-56888266 + UPCI:SCC090 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + HCC120 COSM3661861 c.3755G>T p.G1252V Substitution - Missense 5:56883615-56883615 + TCGA-A2-A0EU-01 COSM449882 c.3989C>G p.S1330W Substitution - Missense 5:56885938-56885938 + TCGA-D8-A27L-01 COSM1486865 c.3915_3917delCAT p.I1307delI Deletion - In frame 5:56884759-56884761 + pfg043T COSM4755770 c.986T>G p.I329S Substitution - Missense 5:56864885-56864885 + SH-1679 COSM5019125 c.3588A>C p.S1196S Substitution - coding silent 5:56882788-56882788 + PD11740a COSM5752764 c.937_938insA p.R313fs*13 Insertion - Frameshift 5:56864836-56864837 + TCGA-26-6173-01 COSM3410330 c.2090G>A p.R697H Substitution - Missense 5:56880713-56880713 + PD18247a COSM5752265 c.891delA p.P298fs*14 Deletion - Frameshift 5:56864790-56864790 + 15995 COSM5029074 c.1078delT p.F360fs*2 Deletion - Frameshift 5:56865382-56865382 + U87 COSM4594439 c.2822_2824delCAA p.T949delT Deletion - In frame 5:56882022-56882024 + PTC-7C COSM4159918 c.3190A>C p.R1064R Substitution - coding silent 5:56882390-56882390 + T3024 COSM4700268 c.1705G>A p.V569I Substitution - Missense 5:56875050-56875050 + TP_2009 COSM5571920 c.2490A>G p.V830V Substitution - coding silent 5:56881690-56881690 + RK243_C01 COSM4779833 c.4395T>C p.A1465A Substitution - coding silent 5:56893536-56893536 + SCC-15 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + COLO201 COSM3344778 c.1509C>T p.H503H Substitution - coding silent 5:56872828-56872828 + 122 COSM5029082 c.2993_2994insC p.T999fs*5 Insertion - Frameshift 5:56882193-56882194 + CPCG0003-F1 COSM3396609 c.3250G>A p.D1084N Substitution - Missense 5:56882450-56882450 + TCGA-JW-A69B-01 COSM4829614 c.1969A>G p.T657A Substitution - Missense 5:56878983-56878983 + 16461 COSM5615555 c.2000G>T p.C667F Substitution - Missense 5:56879014-56879014 + TCGA-B5-A0JY-01 COSM1069013 c.1360G>T p.E454* Substitution - Nonsense 5:56871968-56871968 + TCGA-E9-A1R6-01 COSM449835 c.2281_2284delATAG p.R763fs*35 Deletion - Frameshift 5:56881184-56881187 + TCGA-AC-A23H-01 COSM3828206 c.848G>C p.R283T Substitution - Missense 5:56864747-56864747 + DM1 COSM5609289 c.2266G>A p.G756S Substitution - Missense 5:56881169-56881169 + TCGA-A6-6141-01 COSM1437982 c.3989C>T p.S1330L Substitution - Missense 5:56885938-56885938 + TCGA-A2-A04N-01 COSM449886 c.4121A>G p.N1374S Substitution - Missense 5:56887384-56887384 + TCGA-A8-A07F-01 COSM449859 c.3123_3126delACTT p.K1041fs*40 Deletion - Frameshift 5:56882323-56882326 + PD24302a COSM5768283 c.4249G>A p.A1417T Substitution - Missense 5:56887512-56887512 + TCGA-AX-A0J0-01 COSM1069016 c.1817C>A p.S606Y Substitution - Missense 5:56875162-56875162 + TCGA-22-5489-01 COSM738484 c.1072C>T p.L358L Substitution - coding silent 5:56865376-56865376 + HCC142T COSM1620409 c.3226C>T p.P1076S Substitution - Missense 5:56882426-56882426 + PD13802a COSM5025035 c.3758_3766delCATTTTCTT p.F1254_S1256delFSS Deletion - In frame 5:56883618-56883626 + TCGA-BH-A18P-01 COSM449790 c.697delC p.P233fs*30 Deletion - Frameshift 5:56859778-56859778 + LP6005690-DNA_D01 COSM4410188 c.1720T>G p.S574A Substitution - Missense 5:56875065-56875065 + CSCC-45-T COSM4542707 c.3239G>T p.S1080I Substitution - Missense 5:56882439-56882439 + YUQUEST COSM5403663 c.2062C>T p.L688L Substitution - coding silent 5:56879076-56879076 + TCGA-D8-A3Z6-01 COSM5835053 c.1137_1138delTT p.L380fs*4 Deletion - Frameshift 5:56865441-56865442 + TCGA-AN-A049-01 COSM449853 c.2997_3000delAGAT p.D1000fs*81 Deletion - Frameshift 5:56882197-56882200 + PD6016a2 COSM5752371 c.949_952delTACT p.L318fs*4 Deletion - Frameshift 5:56864848-56864851 + PD11361a COSM5752746 c.1403_1404insC p.H469fs*12 Insertion - Frameshift 5:56872011-56872012 + TCGA-61-1738-01 COSM1328749 c.2128T>C p.C710R Substitution - Missense 5:56880751-56880751 + TCGA-A6-5665-01 COSM1437980 c.3931G>T p.G1311* Substitution - Nonsense 5:56884775-56884775 + PD13768a COSM5752242 c.3880_3884delGAGAT p.E1294fs*13 Deletion - Frameshift 5:56884724-56884728 + U373 COSM4594439 c.2822_2824delCAA p.T949delT Deletion - In frame 5:56882022-56882024 + HCC142 COSM1620411 c.4405A>T p.T1469S Substitution - Missense 5:56893546-56893546 + TCGA-E9-A22H-01 COSM1486839 c.1175A>G p.Y392C Substitution - Missense 5:56865851-56865851 + TCGA-BJ-A0Z0-01 COSM3373919 c.4060C>G p.L1354V Substitution - Missense 5:56886009-56886009 + TCGA-06-2570 COSM2153122 c.2871A>G p.Q957Q Substitution - coding silent 5:56882071-56882071 + 1166-FA COSM5730845 c.1910G>C p.S637T Substitution - Missense 5:56875255-56875255 + Pat_41_B COSM5868662 c.4328C>T p.A1443V Substitution - Missense 5:56888296-56888296 + PD24302a COSM5801009 c.1023_1024insG p.I342fs*43 Insertion - Frameshift 5:56864922-56864923 + U343 COSM4594439 c.2822_2824delCAA p.T949delT Deletion - In frame 5:56882022-56882024 + PT37 COSM5918688 c.505A>T p.T169S Substitution - Missense 5:56856622-56856622 + HCC120T COSM3661861 c.3755G>T p.G1252V Substitution - Missense 5:56883615-56883615 + 17611 COSM5029144 c.1330delC p.P444fs*43 Deletion - Frameshift 5:56871938-56871938 + TCGA-AX-A0J1-01 COSM1069052 c.3670C>T p.P1224S Substitution - Missense 5:56883530-56883530 + TCGA-OK-A5Q2-01 COSM449819 c.1594C>T p.R532* Substitution - Nonsense 5:56872913-56872913 + CHC1629T COSM4791798 c.1917G>A p.L639L Substitution - coding silent 5:56875262-56875262 + TCGA-Q1-A73P-01 COSM4826001 c.2433G>T p.M811I Substitution - Missense 5:56881633-56881633 + YUHAMA COSM5403661 c.848G>A p.R283K Substitution - Missense 5:56864747-56864747 + 93VU147T COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + I2L-P7-Tumor-Organoid COSM5356925 c.4054C>T p.Q1352* Substitution - Nonsense 5:56886003-56886003 + 15750 COSM5029182 c.4410_4411insC p.S1472fs*>42 Insertion - Frameshift 5:56893551-56893552 + TCGA-A5-A0GP-01 COSM1069014 c.1363A>C p.S455R Substitution - Missense 5:56871971-56871971 + PT33 COSM5908519 c.1966-6C>T p.? Unknown 5:56878974-56878974 + PD13802a COSM5025033 c.1200_1201insA p.A402fs*5 Insertion - Frameshift 5:56865876-56865877 + TCGA-D1-A101-01 COSM1069004 c.936G>A p.M312I Substitution - Missense 5:56864835-56864835 + TCGA-06-2570-01 COSM2153122 c.2871A>G p.Q957Q Substitution - coding silent 5:56882071-56882071 + SH-0348 COSM5019125 c.3588A>C p.S1196S Substitution - coding silent 5:56882788-56882788 + 15906 COSM5029180 c.4244T>G p.F1415C Substitution - Missense 5:56887507-56887507 + TCGA-AZ-6598-01 COSM1437962 c.622C>T p.R208* Substitution - Nonsense 5:56856739-56856739 + PD5961a COSM5752807 c.1368_1369insA p.T457fs*4 Insertion - Frameshift 5:56871976-56871977 + TCGA-B5-A11E-01 COSM1069054 c.3687A>G p.G1229G Substitution - coding silent 5:56883547-56883547 + TCGA-BH-A18G-01 COSM3828210 c.998G>T p.S333I Substitution - Missense 5:56864897-56864897 + TCGA-BS-A0UV-01 COSM1069044 c.2907C>A p.S969S Substitution - coding silent 5:56882107-56882107 + PD13768a COSM5752240 c.2659_2668del10 p.A887fs*19 Deletion - Frameshift 5:56881859-56881868 + SCC-25 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + TCGA-A7-A4SB-01 COSM5835058 c.2775delG p.D926fs*11 Deletion - Frameshift 5:56881975-56881975 + CSB26 COSM5026317 c.3036_3037insA p.R1013fs*23 Insertion - Frameshift 5:56882236-56882237 + PD4076a COSM5798946 c.4522T>A p.F1508I Substitution - Missense 5:56893663-56893663 + Pat_02_B COSM1437964 c.1052G>A p.R351H Substitution - Missense 5:56865356-56865356 + BRC18 COSM5026307 c.1177_1178insA p.H393fs*3 Insertion - Frameshift 5:56865853-56865854 + TCGA-06-2559-01 COSM2152658 c.1462T>C p.C488R Substitution - Missense 5:56872679-56872679 + ASHPC_0034_Pa_P COSM4807514 c.2369+4A>T p.? Unknown 5:56881276-56881276 + TCGA-ER-A198-06 COSM3617195 c.633G>A p.V211V Substitution - coding silent 5:56856750-56856750 + TCGA-BH-A0DV-01 COSM1486837 c.817_818delAG p.R273fs*27 Deletion - Frameshift 5:56859898-56859899 + CSCC-17-T COSM4487483 c.3198C>T p.T1066T Substitution - coding silent 5:56882398-56882398 + PD11772a COSM5024881 c.4216C>T p.Q1406* Substitution - Nonsense 5:56887479-56887479 + TCGA-BH-A0DZ-01 COSM449827 c.1916T>C p.L639P Substitution - Missense 5:56875261-56875261 + TCGA-A1-A0SG-01 COSM1486853 c.3108_3109insA p.D1038fs*4 Insertion - Frameshift 5:56882308-56882309 + Pat_24_A COSM5868660 c.2975C>T p.S992F Substitution - Missense 5:56882175-56882175 + SJHGG022_D COSM4969449 c.1757G>A p.R586H Substitution - Missense 5:56875102-56875102 + PD4977a COSM5752352 c.4467_4497del31 p.L1491fs*3 Deletion - Frameshift 5:56893608-56893638 + ESCC_27 COSM5627249 c.3047C>T p.S1016F Substitution - Missense 5:56882247-56882247 + TCGA-AP-A051-01 COSM1069018 c.1912G>A p.V638I Substitution - Missense 5:56875257-56875257 + HT55 COSM3344777 c.1481A>T p.K494M Substitution - Missense 5:56872698-56872698 + TCGA-AZ-6598-01 COSM1437970 c.2204A>T p.D735V Substitution - Missense 5:56881107-56881107 + 17774 COSM5029143 c.1302-10_1308del17 p.? Unknown 5:56871900-56871916 + RKO COSM1192394 c.2557C>T p.R853C Substitution - Missense 5:56881757-56881757 + 9227_T COSM5039788 c.845G>A p.G282D Substitution - Missense 5:56864744-56864744 + BICR_22 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + TCGA-B5-A11E-01 COSM1069020 c.1988T>C p.V663A Substitution - Missense 5:56879002-56879002 + PD9606a COSM5801211 c.3231_3232insA p.N1079fs*2 Insertion - Frameshift 5:56882431-56882432 + CPCG_0003_Pr_P_F0 COSM3396609 c.3250G>A p.D1084N Substitution - Missense 5:56882450-56882450 + 17611 COSM5029176 c.4093_4095delATC p.I1366delI Deletion - In frame 5:56886042-56886044 + ccRCC-43 COSM1666053 c.3313_3314insT p.I1106fs*4 Insertion - Frameshift 5:56882513-56882514 + ESCC_68 COSM5633998 c.3068G>A p.R1023H Substitution - Missense 5:56882268-56882268 + TCGA-A2-A1G1-01 COSM3828212 c.2305C>T p.P769S Substitution - Missense 5:56881208-56881208 + TCGA-A2-A04N-01 COSM449884 c.4036_4038delGTT p.V1346delV Deletion - In frame 5:56885985-56885987 + TCGA-E2-A1BD-01 COSM449879 c.3737_3738insT p.Q1247fs*26 Insertion - Frameshift 5:56883597-56883598 + TCGA-06-0214-01 COSM2153645 c.971C>T p.P324L Substitution - Missense 5:56864870-56864870 + UM-SCC-4 COSM4589982 c.2825_2827delCAA p.T949delT Deletion - In frame 5:56882025-56882027 + PD11394a COSM5752172 c.1065_1068delTATT p.H357fs*4 Deletion - Frameshift 5:56865369-56865372 + B89-12-Tumor COSM1757137 c.2968A>T p.T990S Substitution - Missense 5:56882168-56882168 + TCGA-A8-A06P-01 COSM449869 c.3373A>G p.N1125D Substitution - Missense 5:56882573-56882573 + 17868 COSM5029158 c.3005_3006insT p.K1003fs*1 Insertion - Frameshift 5:56882205-56882206 + 18161 COSM5029169 c.3913A>G p.N1305D Substitution - Missense 5:56884757-56884757 + PD11359a COSM5752744 c.1951_1952insA p.Y651fs*1 Insertion - Frameshift 5:56875296-56875297 + PD4266a COSM5752339 c.3502_3514del13 p.K1168fs*18 Deletion - Frameshift 5:56882702-56882714 + PD13619a COSM5783586 c.2247C>A p.N749K Substitution - Missense 5:56881150-56881150 + 17818 COSM5029173 c.3966C>T p.F1322F Substitution - coding silent 5:56884810-56884810 + TCGA-HU-A4GT-01 COSM3855704 c.2561G>A p.R854H Substitution - Missense 5:56881761-56881761 + TCGA-E2-A10A-01 COSM449784 c.510_511insA p.G172fs*7 Insertion - Frameshift 5:56856627-56856628 +

Mutation - CGAP UNIGENE CYTOBAND OMIM SNP Hs.653554;Hs.653562;Hs.653574;Hs.653584;Hs.653586;Hs.653603;Hs.653604;Hs.653607;Hs.653608;Hs.653616;Hs.653622;Hs.653646;Hs.653654 5q11.2 147370;600982

Mutation - IntOGen Mutated from(ref) Mutated to(alt) Consequence Type AA Mutation CDS Mutation Chr Pos Cancer AC - Frameshift p.T457Sfs*3 c.1370_1371delCA 5 56167804 BRCA AC - Frameshift p.T946Nfs*57 c.2837_2838delCA 5 56177863 CM A C Missense p.Q280P c.839A>C 5 56160565 BRCA A C Missense p.S455R c.1363A>C 5 56167798 UCEC ACTT - Frameshift p.K1041Nfs*40 c.3123_3126delACTT 5 56178150 BRCA - A Frameshift p.A1290Sfs*19 c.3867dupA 5 56180537 BRCA - A Frameshift p.A1414Sfs*6 c.4239_4240insA 5 56183329 BRCA - A Frameshift p.D1038Rfs*4 c.3111dupA 5 56178136 BRCA - A Frameshift p.D1040Rfs*2 c.3117dupA 5 56178144 BRCA A - Frameshift p.D1040Vfs*42 c.3119delA 5 56178146 BRCA - A Frameshift p.D437Gfs*2 c.1307dupA 5 56167739 BRCA - A Frameshift p.D630Rfs*16 c.1887dupA 5 56171059 BRCA A - Frameshift p.E747Nfs*15 c.2239delG 5 56176969 HC - A Frameshift p.G172Rfs*7 c.513dupA 5 56152455 BRCA - A Frameshift p.H393Qfs*3 c.1178dupA 5 56161681 BRCA - A Frameshift p.I1216Nfs*23 c.3646dupA 5 56178673 BRCA - A Frameshift p.L319Tfs*7 c.954dupA 5 56160680 BRCA - A Frameshift p.M1269Nfs*4 c.3805dupA 5 56179491 BRCA A - Frameshift p.Q1408Nfs*14 c.4221delA 5 56183311 BRCA - A Frameshift p.R1013Kfs*23 c.3037dupA 5 56178064 BRCA - A Frameshift p.T1145Nfs*6 c.3433dupA 5 56178460 BRCA AGAATT - InFrameDeletion p.R1385_I1386delRI c.4153_4158delAGAATT 5 56183243 BRCA AGAT - Frameshift p.D1000Sfs*81 c.2997_3000delAGAT 5 56178024 BRCA AG - Frameshift p.E950Afs*53 c.2849_2850delAG 5 56177874 BRCA AG - Frameshift p.R1278Kfs*5 c.3833_3834delGA 5 56180503 BRCA AG - Frameshift p.R273Sfs*27 c.819_820delAG 5 56155725 BRCA AGGTAATTTTTCTTCTGAAA - SpliceDonorDeletion . c.2369_2369+19delGGTAATTTTTCTTCTGAAAA 5 56177098 BRCA A G Missense p.N1125D c.3373A>G 5 56178400 BRCA A G Missense p.N1374S c.4121A>G 5 56183211 BRCA A G Missense p.N1456S c.4367A>G 5 56184162 LUSC A G Missense p.S1317G c.3949A>G 5 56180620 CM A G Missense p.T1066A c.3196A>G 5 56178223 STAD A G Missense p.Y392C c.1175A>G 5 56161678 BRCA A G SpliceAcceptorSNV . c.3983-2A>G 5 56181757 BRCA A G SpliceAcceptorSNV . c.3983-2A>G 5 56181757 STAD A G Synonymous p.Q957Q c.2871A>G 5 56177898 GBM - AGTG Frameshift p.C966Vfs*39 c.2894_2895insAGTG 5 56177921 UCEC - ATAG Frameshift p.I761Nfs*4 c.2281_2282insATAG 5 56177011 BRCA ATAG - Frameshift p.R763Cfs*35 c.2286_2289delTAGA 5 56177011 BRCA A T Missense p.N892Y c.2674A>T 5 56177701 LUSC A T Missense p.Q525L c.1574A>T 5 56168720 HNSC A T Missense p.T942S c.2824A>T 5 56177851 RCCC A T Nonsense p.K690* c.2068A>T 5 56174909 BRCA A T Nonsense p.R825* c.2473A>T 5 56177500 BRCA A T Synonymous p.T457T c.1371A>T 5 56167806 HNSC - CAAA Frameshift p.K1232Tfs*8 c.3694_3695insCAAA 5 56179381 BRCA CA - Frameshift p.P286Tfs*14 c.855_856delAC 5 56160578 BRCA C A Nonsense p.S1344* c.4031C>A 5 56181807 BRCA C A Nonsense p.S431* c.1292C>A 5 56161795 BRCA CAT - InFrameDeletion p.I1307delI c.3918_3920delCAT 5 56180586 BRCA CC TT Missense p.A583V c.1748_1749delinsTT 5 56170920 CM CC TT Missense p.P1107L c.3320_3321delinsTT 5 56178347 CM - C Frameshift p.G715Rfs*21 c.2141dupC 5 56176591 UCEC C - Frameshift p.L1052Cfs*30 c.3153delC 5 56178178 BRCA C - Frameshift p.N891Tfs*18 c.2670delC 5 56177695 BRCA C - Frameshift p.P1474Lfs*16 c.4421delC 5 56189387 BRCA C - Frameshift p.Q1492Nfs*12 c.4474delC 5 56189442 BRCA C - Frameshift p.S1077Qfs*5 c.3228delC 5 56178253 BRCA C - Frameshift p.S497Ffs*60 c.1490delC 5 56168534 BRCA C G Missense p.A1393G c.4178C>G 5 56183268 LUAD C G Missense p.H393Q c.1179C>G 5 56161682 BRCA C G Missense p.L1354V c.4060C>G 5 56181836 THCA C G Missense p.P981A c.2941C>G 5 56177968 UCEC C G Missense p.R364G c.1090C>G 5 56161221 BRCA C G Missense p.S1330W c.3989C>G 5 56181765 BRCA C G Nonsense p.S1077* c.3230C>G 5 56178257 BRCA C G Nonsense p.S984* c.2951C>G 5 56177978 BRCA C T 3-UTRSNV . c.4536+13C>T 5 56189517 CM CTAA - Frameshift p.N325Lfs*3 c.973_976delAACT 5 56160697 BRCA - CT Frameshift p.S371Ffs*11 c.1109_1110insCT 5 56161240 BRCA CTGTCTA - Frameshift p.V647Kfs*7 c.1938_1944delTGTCTAC 5 56171109 BRCA C T Missense p.A770V c.2309C>T 5 56177039 UCEC C T Missense p.H1030Y c.3088C>T 5 56178115 CM C T Missense p.P1141L c.3422C>T 5 56178449 CM C T Missense p.P324L c.971C>T 5 56160697 GBM C T Missense p.P489S c.1465C>T 5 56168509 GBM C T Missense p.R162C c.484C>T 5 56152428 BLCA C T Missense p.R853C c.2557C>T 5 56177584 STAD C T Missense p.R855C c.2563C>T 5 56177590 BLCA C T Missense p.S1330L c.3989C>T 5 56181765 LGG C T Missense p.S1330L c.3989C>T 5 56181765 OV C T Missense p.S1330L c.3989C>T 5 56181765 STAD C T Missense p.S1475L c.4424C>T 5 56189392 CM C T Missense p.S976F c.2927C>T 5 56177954 BRCA C T Nonsense p.Q1020* c.3058C>T 5 56178085 BRCA C T Nonsense p.Q1048* c.3142C>T 5 56178169 BRCA C T Nonsense p.Q1494* c.4480C>T 5 56189448 BRCA C T Nonsense p.Q345* c.1033C>T 5 56160759 LUAD C T Nonsense p.Q525* c.1573C>T 5 56168719 BRCA C T Nonsense p.Q700* c.2098C>T 5 56176548 BRCA C T Nonsense p.Q957* c.2869C>T 5 56177896 BRCA C T Nonsense p.Q977* c.2929C>T 5 56177956 BLCA C T Nonsense p.R532* c.1594C>T 5 56168740 BRCA C T Synonymous p.F1113F c.3339C>T 5 56178366 BLCA C T Synonymous p.H174H c.522C>T 5 56152466 HNSC C T Synonymous p.L1128L c.3384C>T 5 56178411 BRCA C T Synonymous p.L358L c.1072C>T 5 56161203 LUSC C T Synonymous p.L680L c.2040C>T 5 56174881 CM C T Synonymous p.S976S c.2928C>T 5 56177955 LUSC CTTG - Frameshift p.S1256Ffs*12 c.3767_3770delCTTG 5 56179454 BRCA GAGACTT - Frameshift p.Q677Hfs*6 c.2031_2037delGAGACTT 5 56174872 BRCA G A Missense p.C355Y c.1064G>A 5 56161195 UCEC G A Missense p.M1442I c.4326G>A 5 56184121 BRCA G A Missense p.R396H c.1187G>A 5 56161690 UCEC G A Missense p.R586H c.1757G>A 5 56170929 HNSC G A Missense p.R697H c.2090G>A 5 56176540 GBM G A Missense p.V523I c.1567G>A 5 56168713 STAD G A Synonymous p.E1419E c.4257G>A 5 56183347 BRCA G A Synonymous p.P1236P c.3708G>A 5 56179395 GBM G A Synonymous p.P1236P c.3708G>A 5 56179395 STAD G A Synonymous p.Q345Q c.1035G>A 5 56160761 BRCA G A Synonymous p.V211V c.633G>A 5 56152577 CM - GCAGCTGTGCACGTGGAACATTCTGTAT Frameshift p.H357Rfs*37 c.1069_1070insGCAGCTGTGCACGTGGAACATTCTGTAT 5 56161200 BRCA - GC Frameshift p.A671Gfs*15 c.2011_2012insGC 5 56174852 BRCA G C Missense p.C1437S c.4310G>C 5 56184105 BRCA G C Missense p.E1225Q c.3673G>C 5 56179360 HNSC G C Missense p.E950Q c.2848G>C 5 56177875 BRCA G C Missense p.M1193I c.3579G>C 5 56178606 RCCC G C Missense p.W1433S c.4298G>C 5 56184093 BRCA G C SpliceDonorSNV . c.4114+1G>C 5 56181891 BRCA G - Frameshift p.A858Lfs*16 c.2572delG 5 56177598 BRCA - G Frameshift p.E1404Rfs*16 c.4208dupG 5 56183297 BRCA G - Frameshift p.G222Dfs*4 c.665delG 5 56155572 BRCA G - Frameshift p.G570Afs*10 c.1709delG 5 56170880 BRCA G - Frameshift p.R480Kfs*7 c.1439delG 5 56168483 BRCA GTATGGAAGGAGCTGTGAT - Frameshift p.R1428Vfs*7 c.4282_4300delAGGAGCTGTGATGTATGGA 5 56184070 BRCA - GTCA Frameshift p.V777Gfs*5 c.2329_2330insGTCA 5 56177059 BRCA G T Missense p.A1470S c.4408G>T 5 56189376 LUAD G T Missense p.C1437F c.4310G>T 5 56184105 BRCA G T Missense p.C667F c.2000G>T 5 56174841 NSCLC G T Missense p.G996C c.2986G>T 5 56178013 RCCC G T Missense p.M826I c.2478G>T 5 56177505 UCEC G T Missense p.Q547H c.1641G>T 5 56168787 LUSC G T Missense p.R790M c.2369G>T 5 56177099 BRCA G T Missense p.R853L c.2558G>T 5 56177585 LUAD G T Missense p.S1131I c.3392G>T 5 56178419 CM G T Nonsense p.E1182* c.3544G>T 5 56178571 BRCA G T Nonsense p.E1184* c.3550G>T 5 56178577 BRCA G T Nonsense p.E484* c.1450G>T 5 56168494 UCEC G T Nonsense p.E601* c.1801G>T 5 56170973 BRCA G T Nonsense p.E839* c.2515G>T 5 56177542 UCEC G T Synonymous p.A671A c.2013G>T 5 56174854 PRAD GTT - InFrameDeletion p.V1346delV c.4036_4038delGTT 5 56181812 BRCA TAACAAAGTGATGCGGGCCAGACTG - Frameshift p.N309Tfs*6 c.926_950delACAAAGTGATGCGGGCCAGACTGTA 5 56160650 BRCA - TA Frameshift p.E929Vfs*9 c.2785_2786insTA 5 56177812 UCEC - TA Frameshift p.S394Tfs*43 c.1178_1179insTA 5 56161681 BRCA T A Missense p.F1508I c.4522T>A 5 56189490 BRCA T A Missense p.L1491H c.4472T>A 5 56189440 BRCA T A Missense p.S1434R c.4302T>A 5 56184097 BRCA T A Missense p.Y1237N c.3709T>A 5 56179396 BRCA T A Nonsense p.L1122* c.3365T>A 5 56178392 BRCA T A Nonsense p.L202* c.605T>A 5 56152549 RCCC TC - Frameshift p.S431Rfs*7 c.1291_1292delTC 5 56161794 BRCA T C Missense p.C488R c.1462T>C 5 56168506 GBM T C Missense p.F327S c.980T>C 5 56160706 ESCA T C Missense p.W201R c.601T>C 5 56152545 BRCA TCTTCGTTGTTTAG - Frameshift p.L1486Tfs*32 c.4455_4468delTCTTCGTTGTTTAG 5 56189423 BRCA T - Frameshift p.F354Sfs*8 c.1061delT 5 56161191 BRCA - T Frameshift p.L738Ffs*10 c.2213dupT 5 56176942 BRCA - T Frameshift p.N1125Ifs*9 c.3373_3374insT 5 56178400 BRCA - T Frameshift p.Q1247Sfs*26 c.3738dupT 5 56179425 BRCA - T Frameshift p.R1385Kfs*35 c.4151dupT 5 56183241 BRCA - T Frameshift p.S588Ffs*3 c.1762dupT 5 56170932 BRCA - T Frameshift p.S796Vfs*11 c.2384dupT 5 56177411 BRCA - T Frameshift p.T1148Nfs*3 c.3440dupT 5 56178467 BRCA - T Frameshift p.T457Yfs*4 c.1368dupT 5 56167802 BRCA - T Frameshift p.V211Cfs*9 c.630dupT 5 56152574 BRCA TG - Frameshift p.L838Rfs*24 c.2511_2512delGT 5 56177537 BRCA T G Missense p.H1361Q c.4083T>G 5 56181859 UCEC T G Nonsense p.L318* c.953T>G 5 56160679 RCCC - T Nonsense p.S397*fs*1 c.1188dupT 5 56161691 BRCA