Mutation - TCGA Type Chromosome Start Position End Position Strand Variant Classification Variant Type Reference Allele Tumor_seq Allele 1 Tumor_seq Allele 2 Tumor Sample Barcode Matched Norm Sample Barcode Genome Change cDNA Change Codon Change Protein Change BLCA 11 64889086 64889086 + 5'Flank SNP G G A TCGA-BT-A42C-01A-11D-A23M-08 TCGA-BT-A42C-10A-01D-A23K-08 g.chr11:64889086G>A BLCA 11 64889260 64889260 + 5'Flank SNP T T A TCGA-K4-A3WS-01A-11D-A22Z-08 TCGA-K4-A3WS-10A-01D-A22Z-08 g.chr11:64889260T>A COAD 11 64888164 64888164 + 5'Flank SNP C C T TCGA-AD-6964-01A-11D-1924-10 TCGA-AD-6964-10A-01D-1924-10 g.chr11:64888164C>T COADREAD 11 64888164 64888164 + 5'Flank SNP C C T TCGA-AD-6964-01A-11D-1924-10 TCGA-AD-6964-10A-01D-1924-10 g.chr11:64888164C>T COADREAD 11 64888220 64888220 + 5'Flank SNP T T C TCGA-AG-3892-01A-01W-1073-09 TCGA-AG-3892-10A-01W-1073-09 g.chr11:64888220T>C DLBC 11 64889115 64889115 + 5'Flank SNP G G C TCGA-GS-A9TQ-01A-11D-A382-10 TCGA-GS-A9TQ-10A-01D-A385-10 g.chr11:64889115G>C DLBC 11 64889279 64889279 + 5'Flank SNP G G C TCGA-FF-8062-01A-11D-2210-10 TCGA-FF-8062-10A-01D-2210-10 g.chr11:64889279G>C GBM 11 64889007 64889007 + 5'Flank SNP A A G TCGA-06-0145-01A-01W-0224-08 TCGA-06-0145-10A-01W-0224-08 g.chr11:64889007A>G GBMLGG 11 64889007 64889007 + 5'Flank SNP A A G TCGA-06-0145-01A-01W-0224-08 TCGA-06-0145-10A-01W-0224-08 g.chr11:64889007A>G KIPAN 11 64888258 64888258 + 5'Flank SNP C C A TCGA-BQ-5885-01A-11D-1589-08 TCGA-BQ-5885-11A-01D-1589-08 g.chr11:64888258C>A KIPAN 11 64889268 64889268 + 5'Flank SNP G G T TCGA-B9-4114-01A-01D-1252-08 TCGA-B9-4114-10A-01D-1252-08 g.chr11:64889268G>T KIRP 11 64888258 64888258 + 5'Flank SNP C C A TCGA-BQ-5885-01A-11D-1589-08 TCGA-BQ-5885-11A-01D-1589-08 g.chr11:64888258C>A KIRP 11 64889268 64889268 + 5'Flank SNP G G T TCGA-B9-4114-01A-01D-1252-08 TCGA-B9-4114-10A-01D-1252-08 g.chr11:64889268G>T LIHC 11 64888161 64888161 + 5'Flank SNP T T A TCGA-ED-A459-01A-11D-A25V-10 TCGA-ED-A459-10A-01D-A25V-10 g.chr11:64888161T>A LIHC 11 64888473 64888473 + 5'Flank DEL C C - TCGA-DD-AAVV-01A-11D-A40R-10 TCGA-DD-AAVV-10A-01D-A40U-10 g.chr11:64888473delC LUAD 11 64888175 64888175 + 5'Flank SNP T T A TCGA-69-7765-01A-11D-2167-08 TCGA-69-7765-10A-01D-2167-08 g.chr11:64888175T>A PAAD 11 64889267 64889267 + 5'Flank SNP C C T TCGA-IB-7651-01A-11D-2154-08 TCGA-IB-7651-10A-01D-2154-08 g.chr11:64889267C>T READ 11 64888220 64888220 + 5'Flank SNP T T C TCGA-AG-3892-01A-01W-1073-09 TCGA-AG-3892-10A-01W-1073-09 g.chr11:64888220T>C

Mutation - ICGC Project Code Chromosome Chromosome Start Chromosome End Mutation Type Mutated from Allele Mutated to Allele Consequence Type AA Mutation CDS Mutation BLCA-CN 11 64884663 64884663 single base substitution C T downstream_gene_variant BLCA-CN 11 64892025 64892025 single base substitution G A upstream_gene_variant BLCA-CN 11 64892989 64892989 single base substitution C T upstream_gene_variant BLCA-US 11 64883439 64883439 single base substitution G C downstream_gene_variant BLCA-US 11 64884048 64884048 single base substitution C T downstream_gene_variant BLCA-US 11 64884237 64884237 single base substitution C A downstream_gene_variant BLCA-US 11 64884581 64884581 single base substitution C T downstream_gene_variant BLCA-US 11 64888248 64888250 deletion of <=200bp TCT - 3_prime_UTR_variant BLCA-US 11 64888248 64888250 deletion of <=200bp TCT - disruptive_inframe_deletion ED83D BLCA-US 11 64888248 64888250 deletion of <=200bp TCT - disruptive_inframe_deletion KT102T BLCA-US 11 64888248 64888250 deletion of <=200bp TCT - disruptive_inframe_deletion KT67T BLCA-US 11 64888248 64888250 deletion of <=200bp TCT - downstream_gene_variant BLCA-US 11 64888248 64888250 deletion of <=200bp TCT - exon_variant BLCA-US 11 64889086 64889086 single base substitution G A exon_variant BLCA-US 11 64889086 64889086 single base substitution G A intron_variant BLCA-US 11 64889086 64889086 single base substitution G A missense_variant P36S 106C>T BLCA-US 11 64889260 64889260 single base substitution T A exon_variant BLCA-US 11 64889260 64889260 single base substitution T A missense_variant E9V 26A>T BRCA-EU 11 64883320 64883320 single base substitution G A downstream_gene_variant BRCA-EU 11 64885575 64885601 deletion of <=200bp GGACACAGACAAATAAAATGCACTAGG - downstream_gene_variant BRCA-EU 11 64885913 64885913 single base substitution C G downstream_gene_variant BRCA-EU 11 64888405 64888405 single base substitution G T 3_prime_UTR_variant BRCA-EU 11 64888405 64888405 single base substitution G T downstream_gene_variant BRCA-EU 11 64888405 64888405 single base substitution G T exon_variant BRCA-EU 11 64888405 64888405 single base substitution G T intron_variant BRCA-EU 11 64889448 64889448 single base substitution G C 5_prime_UTR_variant BRCA-EU 11 64889448 64889448 single base substitution G C exon_variant BRCA-EU 11 64889448 64889448 single base substitution G C intron_variant BRCA-EU 11 64889448 64889448 single base substitution G C upstream_gene_variant BRCA-EU 11 64891107 64891107 single base substitution G A upstream_gene_variant BRCA-EU 11 64891262 64891262 single base substitution G C upstream_gene_variant BRCA-EU 11 64891384 64891384 single base substitution T G upstream_gene_variant BRCA-EU 11 64891388 64891388 single base substitution G C upstream_gene_variant BRCA-EU 11 64892247 64892247 single base substitution C T upstream_gene_variant BRCA-EU 11 64892258 64892258 single base substitution C G upstream_gene_variant BRCA-EU 11 64892713 64892713 single base substitution C A upstream_gene_variant BRCA-FR 11 64891107 64891107 single base substitution G A upstream_gene_variant BRCA-FR 11 64891262 64891262 single base substitution G C upstream_gene_variant BRCA-FR 11 64891388 64891388 single base substitution G C upstream_gene_variant BRCA-FR 11 64892247 64892247 single base substitution C T upstream_gene_variant BRCA-FR 11 64892258 64892258 single base substitution C G upstream_gene_variant BRCA-UK 11 64891829 64891829 single base substitution G C upstream_gene_variant BRCA-US 11 64883379 64883379 single base substitution C T downstream_gene_variant BRCA-US 11 64889852 64889852 single base substitution G C 5_prime_UTR_variant BRCA-US 11 64889852 64889852 single base substitution G C upstream_gene_variant BRCA-US 11 64893553 64893553 single base substitution G A upstream_gene_variant BTCA-JP 11 64883409 64883409 single base substitution G A downstream_gene_variant BTCA-JP 11 64884590 64884590 single base substitution C T downstream_gene_variant CESC-US 11 64889736 64889736 single base substitution G A 5_prime_UTR_premature_start_codon_gain_variant CESC-US 11 64889736 64889736 single base substitution G A upstream_gene_variant CLLE-ES 11 64883186 64883186 single base substitution G C downstream_gene_variant CLLE-ES 11 64888103 64888103 single base substitution G A 3_prime_UTR_variant CLLE-ES 11 64888103 64888103 single base substitution G A downstream_gene_variant CLLE-ES 11 64888499 64888499 single base substitution T C 3_prime_UTR_variant CLLE-ES 11 64888499 64888499 single base substitution T C downstream_gene_variant CLLE-ES 11 64888499 64888499 single base substitution T C exon_variant CLLE-ES 11 64888499 64888499 single base substitution T C intron_variant CLLE-ES 11 64888499 64888499 single base substitution T C missense_variant H42R 125A>G CLLE-ES 11 64888499 64888499 single base substitution T C missense_variant H77R 230A>G COAD-US 11 64888164 64888164 single base substitution C T 3_prime_UTR_variant COAD-US 11 64888164 64888164 single base substitution C T downstream_gene_variant COAD-US 11 64888164 64888164 single base substitution C T exon_variant COAD-US 11 64888164 64888164 single base substitution C T missense_variant A131T 391G>A COAD-US 11 64888164 64888164 single base substitution C T missense_variant A96T 286G>A COAD-US 11 64893024 64893024 single base substitution G T upstream_gene_variant COCA-CN 11 64883205 64883205 single base substitution G A downstream_gene_variant COCA-CN 11 64883864 64883864 single base substitution A G downstream_gene_variant COCA-CN 11 64884157 64884157 single base substitution C A downstream_gene_variant COCA-CN 11 64884334 64884334 single base substitution C T downstream_gene_variant COCA-CN 11 64889311 64889311 single base substitution G T 5_prime_UTR_variant COCA-CN 11 64889311 64889311 single base substitution G T exon_variant COCA-CN 11 64889311 64889311 single base substitution G T intron_variant COCA-CN 11 64889311 64889311 single base substitution G T upstream_gene_variant COCA-CN 11 64889322 64889322 single base substitution G T 5_prime_UTR_variant COCA-CN 11 64889322 64889322 single base substitution G T exon_variant COCA-CN 11 64889322 64889322 single base substitution G T intron_variant COCA-CN 11 64889322 64889322 single base substitution G T upstream_gene_variant COCA-CN 11 64893126 64893126 single base substitution A G upstream_gene_variant EOPC-DE 11 64883462 64883462 single base substitution C T downstream_gene_variant EOPC-DE 11 64889514 64889514 single base substitution G A 5_prime_UTR_premature_start_codon_gain_variant EOPC-DE 11 64889514 64889514 single base substitution G A exon_variant EOPC-DE 11 64889514 64889514 single base substitution G A intron_variant EOPC-DE 11 64889514 64889514 single base substitution G A upstream_gene_variant ESAD-UK 11 64885139 64885139 single base substitution G A downstream_gene_variant ESAD-UK 11 64886940 64886940 single base substitution C T downstream_gene_variant ESAD-UK 11 64893751 64893751 single base substitution C T upstream_gene_variant GBM-US 11 64888248 64888250 deletion of <=200bp TCT - 3_prime_UTR_variant GBM-US 11 64888248 64888250 deletion of <=200bp TCT - disruptive_inframe_deletion ED83D GBM-US 11 64888248 64888250 deletion of <=200bp TCT - disruptive_inframe_deletion KT102T GBM-US 11 64888248 64888250 deletion of <=200bp TCT - disruptive_inframe_deletion KT67T GBM-US 11 64888248 64888250 deletion of <=200bp TCT - downstream_gene_variant GBM-US 11 64888248 64888250 deletion of <=200bp TCT - exon_variant KIRC-US 11 64883959 64883959 deletion of <=200bp G - downstream_gene_variant KIRC-US 11 64888455 64888455 single base substitution T C 3_prime_UTR_variant KIRC-US 11 64888455 64888455 single base substitution T C downstream_gene_variant KIRC-US 11 64888455 64888455 single base substitution T C exon_variant KIRC-US 11 64888455 64888455 single base substitution T C intron_variant KIRC-US 11 64888455 64888455 single base substitution T C missense_variant K57E 169A>G KIRC-US 11 64888455 64888455 single base substitution T C missense_variant K92E 274A>G KIRP-US 11 64883476 64883476 single base substitution A G downstream_gene_variant KIRP-US 11 64888258 64888258 single base substitution C A 3_prime_UTR_variant KIRP-US 11 64888258 64888258 single base substitution C A downstream_gene_variant KIRP-US 11 64888258 64888258 single base substitution C A exon_variant KIRP-US 11 64888258 64888258 single base substitution C A missense_variant K64N 192G>T KIRP-US 11 64888258 64888258 single base substitution C A missense_variant K99N 297G>T KIRP-US 11 64888258 64888258 single base substitution C A stop_gained E81* 241G>T KIRP-US 11 64889268 64889268 single base substitution G T exon_variant KIRP-US 11 64889268 64889268 single base substitution G T synonymous_variant R6R 18C>A KIRP-US 11 64889269 64889269 single base substitution C G exon_variant KIRP-US 11 64889269 64889269 single base substitution C G missense_variant R6P 17G>C LGG-US 11 64888248 64888250 deletion of <=200bp TCT - 3_prime_UTR_variant LGG-US 11 64888248 64888250 deletion of <=200bp TCT - disruptive_inframe_deletion ED83D LGG-US 11 64888248 64888250 deletion of <=200bp TCT - disruptive_inframe_deletion KT102T LGG-US 11 64888248 64888250 deletion of <=200bp TCT - disruptive_inframe_deletion KT67T LGG-US 11 64888248 64888250 deletion of <=200bp TCT - downstream_gene_variant LGG-US 11 64888248 64888250 deletion of <=200bp TCT - exon_variant LICA-FR 11 64890991 64890991 single base substitution G A upstream_gene_variant LIHC-US 11 64888161 64888161 single base substitution T A 3_prime_UTR_variant LIHC-US 11 64888161 64888161 single base substitution T A downstream_gene_variant LIHC-US 11 64888161 64888161 single base substitution T A exon_variant LIHC-US 11 64888161 64888161 single base substitution T A missense_variant N132Y 394A>T LIHC-US 11 64888161 64888161 single base substitution T A missense_variant N97Y 289A>T LIHC-US 11 64889822 64889822 single base substitution G C 5_prime_UTR_variant LIHC-US 11 64889822 64889822 single base substitution G C upstream_gene_variant LINC-JP 11 64884416 64884416 single base substitution A C downstream_gene_variant LINC-JP 11 64888169 64888169 single base substitution G T 3_prime_UTR_variant LINC-JP 11 64888169 64888169 single base substitution G T downstream_gene_variant LINC-JP 11 64888169 64888169 single base substitution G T exon_variant LINC-JP 11 64888169 64888169 single base substitution G T missense_variant P129H 386C>A LINC-JP 11 64888169 64888169 single base substitution G T missense_variant P94H 281C>A LINC-JP 11 64888692 64888692 single base substitution T C 3_prime_UTR_variant LINC-JP 11 64888692 64888692 single base substitution T C downstream_gene_variant LINC-JP 11 64888692 64888692 single base substitution T C exon_variant LINC-JP 11 64888692 64888692 single base substitution T C intron_variant LINC-JP 11 64894283 64894283 single base substitution A C upstream_gene_variant LINC-JP 11 64894788 64894788 single base substitution T G upstream_gene_variant LIRI-JP 11 64883912 64883912 single base substitution G T downstream_gene_variant LIRI-JP 11 64884056 64884056 single base substitution A C downstream_gene_variant LIRI-JP 11 64885245 64885245 single base substitution C G downstream_gene_variant LIRI-JP 11 64885868 64885868 single base substitution C T downstream_gene_variant LIRI-JP 11 64887014 64887014 single base substitution G A downstream_gene_variant LIRI-JP 11 64887760 64887760 single base substitution T C downstream_gene_variant LIRI-JP 11 64887996 64887996 deletion of <=200bp A - downstream_gene_variant LIRI-JP 11 64888111 64888111 single base substitution T A 3_prime_UTR_variant LIRI-JP 11 64888111 64888111 single base substitution T A downstream_gene_variant LIRI-JP 11 64888111 64888111 single base substitution T A exon_variant LIRI-JP 11 64888345 64888345 single base substitution C T 3_prime_UTR_variant LIRI-JP 11 64888345 64888345 single base substitution C T downstream_gene_variant LIRI-JP 11 64888345 64888345 single base substitution C T exon_variant LIRI-JP 11 64888345 64888345 single base substitution C T intron_variant LIRI-JP 11 64889010 64889010 single base substitution G A exon_variant LIRI-JP 11 64889010 64889010 single base substitution G A missense_variant A26V 77C>T LIRI-JP 11 64889010 64889010 single base substitution G A missense_variant A61V 182C>T LIRI-JP 11 64894494 64894494 single base substitution T C upstream_gene_variant LIRI-JP 11 64894511 64894511 single base substitution A G upstream_gene_variant LUSC-KR 11 64887023 64887023 single base substitution G A downstream_gene_variant LUSC-KR 11 64887055 64887055 single base substitution G A downstream_gene_variant LUSC-KR 11 64887544 64887544 single base substitution G A downstream_gene_variant LUSC-KR 11 64889598 64889598 single base substitution G A 5_prime_UTR_premature_start_codon_gain_variant LUSC-KR 11 64889598 64889598 single base substitution G A upstream_gene_variant LUSC-KR 11 64889615 64889615 single base substitution G C 5_prime_UTR_premature_start_codon_gain_variant LUSC-KR 11 64889615 64889615 single base substitution G C upstream_gene_variant LUSC-KR 11 64891005 64891005 single base substitution G C upstream_gene_variant LUSC-KR 11 64893267 64893267 single base substitution G A upstream_gene_variant MALY-DE 11 64885738 64885738 single base substitution C A downstream_gene_variant MALY-DE 11 64886450 64886450 single base substitution C T downstream_gene_variant MALY-DE 11 64889785 64889785 single base substitution T G 5_prime_UTR_variant MALY-DE 11 64889785 64889785 single base substitution T G upstream_gene_variant MELA-AU 11 64883285 64883285 single base substitution G A downstream_gene_variant MELA-AU 11 64884549 64884549 single base substitution G A downstream_gene_variant MELA-AU 11 64885273 64885273 single base substitution C T downstream_gene_variant MELA-AU 11 64886145 64886146 multiple base substitution (>=2bp and <=200bp) GT TG downstream_gene_variant MELA-AU 11 64886817 64886817 single base substitution A T downstream_gene_variant MELA-AU 11 64887055 64887055 single base substitution G A downstream_gene_variant MELA-AU 11 64887370 64887370 single base substitution G A downstream_gene_variant MELA-AU 11 64888053 64888053 single base substitution G A downstream_gene_variant MELA-AU 11 64888139 64888139 single base substitution G A 3_prime_UTR_variant MELA-AU 11 64888139 64888139 single base substitution G A downstream_gene_variant MELA-AU 11 64888139 64888139 single base substitution G A exon_variant MELA-AU 11 64888169 64888169 single base substitution G A 3_prime_UTR_variant MELA-AU 11 64888169 64888169 single base substitution G A downstream_gene_variant MELA-AU 11 64888169 64888169 single base substitution G A exon_variant MELA-AU 11 64888169 64888169 single base substitution G A missense_variant P129L 386C>T MELA-AU 11 64888169 64888169 single base substitution G A missense_variant P94L 281C>T MELA-AU 11 64888264 64888264 single base substitution C T 3_prime_UTR_variant MELA-AU 11 64888264 64888264 single base substitution C T downstream_gene_variant MELA-AU 11 64888264 64888264 single base substitution C T exon_variant MELA-AU 11 64888264 64888264 single base substitution C T missense_variant E79K 235G>A MELA-AU 11 64888264 64888264 single base substitution C T synonymous_variant E62E 186G>A MELA-AU 11 64888264 64888264 single base substitution C T synonymous_variant E97E 291G>A MELA-AU 11 64888361 64888361 single base substitution G A 3_prime_UTR_variant MELA-AU 11 64888361 64888361 single base substitution G A downstream_gene_variant MELA-AU 11 64888361 64888361 single base substitution G A exon_variant MELA-AU 11 64888361 64888361 single base substitution G A intron_variant MELA-AU 11 64888409 64888409 deletion of <=200bp G - 3_prime_UTR_variant MELA-AU 11 64888409 64888409 deletion of <=200bp G - downstream_gene_variant MELA-AU 11 64888409 64888409 deletion of <=200bp G - exon_variant MELA-AU 11 64888409 64888409 deletion of <=200bp G - intron_variant MELA-AU 11 64888486 64888486 single base substitution G A 3_prime_UTR_variant MELA-AU 11 64888486 64888486 single base substitution G A downstream_gene_variant MELA-AU 11 64888486 64888486 single base substitution G A exon_variant MELA-AU 11 64888486 64888486 single base substitution G A intron_variant MELA-AU 11 64888486 64888486 single base substitution G A synonymous_variant A46A 138C>T MELA-AU 11 64888486 64888486 single base substitution G A synonymous_variant A81A 243C>T MELA-AU 11 64888518 64888518 single base substitution G A 3_prime_UTR_variant MELA-AU 11 64888518 64888518 single base substitution G A downstream_gene_variant MELA-AU 11 64888518 64888518 single base substitution G A exon_variant MELA-AU 11 64888518 64888518 single base substitution G A intron_variant MELA-AU 11 64889183 64889183 single base substitution G A exon_variant MELA-AU 11 64889183 64889183 single base substitution G A intron_variant MELA-AU 11 64889678 64889678 single base substitution C T 5_prime_UTR_variant MELA-AU 11 64889678 64889678 single base substitution C T upstream_gene_variant MELA-AU 11 64890559 64890559 single base substitution T C upstream_gene_variant MELA-AU 11 64891351 64891351 single base substitution G A upstream_gene_variant MELA-AU 11 64891770 64891770 single base substitution C T upstream_gene_variant MELA-AU 11 64892334 64892334 single base substitution G A upstream_gene_variant MELA-AU 11 64892817 64892817 single base substitution G A upstream_gene_variant MELA-AU 11 64893194 64893195 multiple base substitution (>=2bp and <=200bp) CC AT upstream_gene_variant MELA-AU 11 64894598 64894598 single base substitution C T upstream_gene_variant MELA-AU 11 64894662 64894663 multiple base substitution (>=2bp and <=200bp) CC TT upstream_gene_variant ORCA-IN 11 64884009 64884009 single base substitution C A downstream_gene_variant ORCA-IN 11 64884186 64884186 single base substitution C A downstream_gene_variant ORCA-IN 11 64884932 64884932 single base substitution G T downstream_gene_variant ORCA-IN 11 64893076 64893076 single base substitution G T upstream_gene_variant OV-AU 11 64891837 64891837 single base substitution T A upstream_gene_variant OV-AU 11 64894871 64894871 single base substitution A G upstream_gene_variant PACA-AU 11 64883581 64883581 single base substitution A G downstream_gene_variant PACA-AU 11 64885671 64885671 single base substitution G A downstream_gene_variant PACA-AU 11 64889301 64889301 single base substitution A C 5_prime_UTR_premature_start_codon_gain_variant PACA-AU 11 64889301 64889301 single base substitution A C exon_variant PACA-AU 11 64889301 64889301 single base substitution A C splice_region_variant PACA-AU 11 64889301 64889301 single base substitution A C upstream_gene_variant PACA-AU 11 64891205 64891205 deletion of <=200bp A - upstream_gene_variant PACA-AU 11 64894080 64894080 insertion of <=200bp - T upstream_gene_variant PACA-CA 11 64883385 64883385 single base substitution T C downstream_gene_variant PACA-CA 11 64887881 64887881 single base substitution C G downstream_gene_variant PACA-CA 11 64888016 64888016 single base substitution C T downstream_gene_variant PACA-CA 11 64888157 64888157 single base substitution G C 3_prime_UTR_variant PACA-CA 11 64888157 64888157 single base substitution G C downstream_gene_variant PACA-CA 11 64888157 64888157 single base substitution G C exon_variant PACA-CA 11 64888157 64888157 single base substitution G C missense_variant S133C 398C>G PACA-CA 11 64888157 64888157 single base substitution G C missense_variant S98C 293C>G PACA-CA 11 64888204 64888204 single base substitution G A 3_prime_UTR_variant PACA-CA 11 64888204 64888204 single base substitution G A downstream_gene_variant PACA-CA 11 64888204 64888204 single base substitution G A exon_variant PACA-CA 11 64888204 64888204 single base substitution G A synonymous_variant V117V 351C>T PACA-CA 11 64888204 64888204 single base substitution G A synonymous_variant V82V 246C>T PACA-CA 11 64888252 64888252 single base substitution C T 3_prime_UTR_variant PACA-CA 11 64888252 64888252 single base substitution C T downstream_gene_variant PACA-CA 11 64888252 64888252 single base substitution C T exon_variant PACA-CA 11 64888252 64888252 single base substitution C T missense_variant E83K 247G>A PACA-CA 11 64888252 64888252 single base substitution C T synonymous_variant K101K 303G>A PACA-CA 11 64888252 64888252 single base substitution C T synonymous_variant K66K 198G>A PACA-CA 11 64888255 64888255 single base substitution C T 3_prime_UTR_variant PACA-CA 11 64888255 64888255 single base substitution C T downstream_gene_variant PACA-CA 11 64888255 64888255 single base substitution C T exon_variant PACA-CA 11 64888255 64888255 single base substitution C T missense_variant E82K 244G>A PACA-CA 11 64888255 64888255 single base substitution C T synonymous_variant K100K 300G>A PACA-CA 11 64888255 64888255 single base substitution C T synonymous_variant K65K 195G>A PACA-CA 11 64888261 64888261 single base substitution C T 3_prime_UTR_variant PACA-CA 11 64888261 64888261 single base substitution C T downstream_gene_variant PACA-CA 11 64888261 64888261 single base substitution C T exon_variant PACA-CA 11 64888261 64888261 single base substitution C T missense_variant E80K 238G>A PACA-CA 11 64888261 64888261 single base substitution C T synonymous_variant K63K 189G>A PACA-CA 11 64888261 64888261 single base substitution C T synonymous_variant K98K 294G>A PACA-CA 11 64888350 64888350 single base substitution C T 3_prime_UTR_variant PACA-CA 11 64888350 64888350 single base substitution C T downstream_gene_variant PACA-CA 11 64888350 64888350 single base substitution C T exon_variant PACA-CA 11 64888350 64888350 single base substitution C T intron_variant PACA-CA 11 64888471 64888471 single base substitution C G 3_prime_UTR_variant PACA-CA 11 64888471 64888471 single base substitution C G downstream_gene_variant PACA-CA 11 64888471 64888471 single base substitution C G exon_variant PACA-CA 11 64888471 64888471 single base substitution C G intron_variant PACA-CA 11 64888471 64888471 single base substitution C G synonymous_variant V51V 153G>C PACA-CA 11 64888471 64888471 single base substitution C G synonymous_variant V86V 258G>C PACA-CA 11 64888579 64888579 single base substitution C T 3_prime_UTR_variant PACA-CA 11 64888579 64888579 single base substitution C T downstream_gene_variant PACA-CA 11 64888579 64888579 single base substitution C T exon_variant PACA-CA 11 64888579 64888579 single base substitution C T intron_variant PACA-CA 11 64888584 64888584 single base substitution C T 3_prime_UTR_variant PACA-CA 11 64888584 64888584 single base substitution C T downstream_gene_variant PACA-CA 11 64888584 64888584 single base substitution C T exon_variant PACA-CA 11 64888584 64888584 single base substitution C T intron_variant PACA-CA 11 64888817 64888817 single base substitution C G 3_prime_UTR_variant PACA-CA 11 64888817 64888817 single base substitution C G exon_variant PACA-CA 11 64888817 64888817 single base substitution C G intron_variant PACA-CA 11 64889383 64889383 single base substitution C T 5_prime_UTR_variant PACA-CA 11 64889383 64889383 single base substitution C T exon_variant PACA-CA 11 64889383 64889383 single base substitution C T intron_variant PACA-CA 11 64889383 64889383 single base substitution C T upstream_gene_variant PACA-CA 11 64891488 64891488 single base substitution T G upstream_gene_variant PACA-CA 11 64893817 64893817 single base substitution G T upstream_gene_variant PACA-CA 11 64894215 64894215 single base substitution G A upstream_gene_variant PAEN-IT 11 64890327 64890327 single base substitution G A upstream_gene_variant PBCA-DE 11 64888099 64888099 single base substitution C T downstream_gene_variant PRAD-CA 11 64894046 64894046 single base substitution C T upstream_gene_variant RECA-EU 11 64884363 64884363 single base substitution G C downstream_gene_variant RECA-EU 11 64886273 64886273 single base substitution A G downstream_gene_variant SKCA-BR 11 64888410 64888410 single base substitution G A 3_prime_UTR_variant SKCA-BR 11 64888410 64888410 single base substitution G A downstream_gene_variant SKCA-BR 11 64888410 64888410 single base substitution G A exon_variant SKCA-BR 11 64888410 64888410 single base substitution G A intron_variant SKCA-BR 11 64891512 64891512 single base substitution A G upstream_gene_variant SKCM-US 11 64883418 64883418 single base substitution G A downstream_gene_variant SKCM-US 11 64883442 64883442 single base substitution C T downstream_gene_variant SKCM-US 11 64891988 64891988 single base substitution C T upstream_gene_variant SKCM-US 11 64893018 64893018 single base substitution C T upstream_gene_variant STAD-US 11 64883942 64883942 single base substitution C A downstream_gene_variant STAD-US 11 64884013 64884013 single base substitution T C downstream_gene_variant STAD-US 11 64889890 64889890 single base substitution G A 5_prime_UTR_variant STAD-US 11 64889890 64889890 single base substitution G A upstream_gene_variant STAD-US 11 64893016 64893016 single base substitution G A upstream_gene_variant STAD-US 11 64893044 64893044 deletion of <=200bp G - upstream_gene_variant STAD-US 11 64893062 64893062 single base substitution G A upstream_gene_variant STAD-US 11 64893233 64893233 single base substitution G A upstream_gene_variant THCA-SA 11 64889085 64889085 single base substitution G A exon_variant THCA-SA 11 64889085 64889085 single base substitution G A intron_variant THCA-SA 11 64889085 64889085 single base substitution G A missense_variant P36L 107C>T UCEC-US 11 64883423 64883423 single base substitution C T downstream_gene_variant UCEC-US 11 64883976 64883976 single base substitution G A downstream_gene_variant UCEC-US 11 64884276 64884276 single base substitution G A downstream_gene_variant UCEC-US 11 64884406 64884406 single base substitution G C downstream_gene_variant UCEC-US 11 64889081 64889081 single base substitution T G exon_variant UCEC-US 11 64889081 64889081 single base substitution T G intron_variant UCEC-US 11 64889081 64889081 single base substitution T G missense_variant E37D 111A>C UCEC-US 11 64889277 64889277 single base substitution G T exon_variant UCEC-US 11 64889277 64889277 single base substitution G T synonymous_variant L3L 9C>A UCEC-US 11 64893016 64893016 single base substitution G A upstream_gene_variant

Mutation - COSMIC Sample Name Mutation ID Mutation CDS Mutation AA Mutation Description Mutation Genome Position Mutation Strand BN43T COSM1604996 c.386C>A p.P129H Substitution - Missense 11:65120697-65120697 - Pat_76_A COSM5839218 c.181G>A p.A61T Substitution - Missense 11:65121539-65121539 - TCGA-ED-A459-01 COSM4935670 c.394A>T p.N132Y Substitution - Missense 11:65120689-65120689 - CHLA-258 COSM4574650 c.173G>A p.G58E Substitution - Missense 11:65121547-65121547 - 2_PRE-TREATMENT COSM1721928 c.305_307delAGA p.K102delK Deletion - In frame 11:65120776-65120778 - TCGA-D1-A17Q-01 COSM930333 c.111A>C p.E37D Substitution - Missense 11:65121609-65121609 - PCSI_0111_Pa_P_526 COSM216884 c.294G>A p.K98K Substitution - coding silent 11:65120789-65120789 - PCSI_0226_Pa_P_526 COSM4965984 c.398C>G p.S133C Substitution - Missense 11:65120685-65120685 - TCGA-BT-A42C-01 COSM4199485 c.106C>T p.P36S Substitution - Missense 11:65121614-65121614 - TCGA-BQ-5885-01 COSM3986348 c.297G>T p.K99N Substitution - Missense 11:65120786-65120786 - TCGA-B2-4101-01 COSM3359319 c.274A>G p.K92E Substitution - Missense 11:65120983-65120983 - 2_RESISTANT COSM1721927 c.221-10C>T p.? Unknown 11:65121046-65121046 - 2_RESISTANT COSM1721928 c.305_307delAGA p.K102delK Deletion - In frame 11:65120776-65120778 - TCGA-K4-A3WS-01 COSM3791792 c.26A>T p.E9V Substitution - Missense 11:65121788-65121788 - TCGA-AG-3892-01 COSM256938 c.335A>G p.Y112C Substitution - Missense 11:65120748-65120748 - 587362 COSM1206683 c.344G>A p.R115H Substitution - Missense 11:65120739-65120739 - PTC_441 COSM4199484 c.107C>T p.P36L Substitution - Missense 11:65121613-65121613 - PCSI_0111_Pa_P COSM216883 c.303G>A p.K101K Substitution - coding silent 11:65120780-65120780 - PCSI_0111_Pa_P_526 COSM216883 c.303G>A p.K101K Substitution - coding silent 11:65120780-65120780 - PCSI_0111_Pa_P COSM216885 c.258G>C p.V86V Substitution - coding silent 11:65120999-65120999 - RK056_C01 COSM1628159 c.182C>T p.A61V Substitution - Missense 11:65121538-65121538 - TCGA-AP-A056-01 COSM930334 c.9C>A p.L3L Substitution - coding silent 11:65121805-65121805 - 1101-01-02TD COSM5416933 c.230A>G p.H77R Substitution - Missense 11:65121027-65121027 - PCSI_0111_Pa_P_526 COSM216885 c.258G>C p.V86V Substitution - coding silent 11:65120999-65120999 - CSCC-27-T COSM4511758 c.87C>T p.A29A Substitution - coding silent 11:65121633-65121633 - TCGA-B9-4114-01 COSM3986350 c.17G>C p.R6P Substitution - Missense 11:65121797-65121797 - SC_9094 COSM5563193 c.331C>T p.Q111* Substitution - Nonsense 11:65120752-65120752 - PCSI_0111_Pa_P_526 COSM4808295 c.300G>A p.K100K Substitution - coding silent 11:65120783-65120783 - TCGA-B9-4114-01 COSM3986349 c.18C>A p.R6R Substitution - coding silent 11:65121796-65121796 - T3021 COSM4683722 c.62T>G p.V21G Substitution - Missense 11:65121752-65121752 - BN43 COSM1604996 c.386C>A p.P129H Substitution - Missense 11:65120697-65120697 - PCSI_0111_Pa_P COSM216884 c.294G>A p.K98K Substitution - coding silent 11:65120789-65120789 - 2_PRE-TREATMENT COSM1721927 c.221-10C>T p.? Unknown 11:65121046-65121046 - TCGA-AA-3968-01 COSM5116723 c.322C>T p.R108W Substitution - Missense 11:65120761-65120761 - Pat_70_B COSM1721928 c.305_307delAGA p.K102delK Deletion - In frame 11:65120776-65120778 - T2418 COSM4683721 c.245G>A p.R82H Substitution - Missense 11:65121012-65121012 - LUAD-RT-S01487 COSM377844 c.109G>T p.E37* Substitution - Nonsense 11:65121611-65121611 - TCGA-AA-A010-01 COSM281073 c.76-10T>C p.? Unknown 11:65121654-65121654 - TCGA-AD-6964-01 COSM1355890 c.391G>A p.A131T Substitution - Missense 11:65120692-65120692 -

Mutation - CGAP UNIGENE CYTOBAND OMIM SNP Hs.387208 11q13 134690 2401310|CGAP|BC033877|C/T|non-coding||444|Candidate; 2401311|CGAP|BC033877|A/G|coding|Asn113Ser|374|Candidate; 2401322|CGAP|BC033877|A/T|coding|Leu48Gln|179|Candidate; 870143|dbSNP|BC033877|C/T|coding|Thr53Ile|194|Candidate

Mutation - IntOGen Mutated from(ref) Mutated to(alt) Consequence Type AA Mutation CDS Mutation Chr Pos Cancer A G Missense p.L62P c.185T>C 11 64889007 GBM C G Synonymous p.V86V c.258G>C 11 64888471 PAAD C T Synonymous p.K101K c.303G>A 11 64888252 PAAD C T Synonymous p.K98K c.294G>A 11 64888261 PAAD G A Missense p.A61V c.182C>T 11 64889010 HC G A Synonymous p.T64T c.192C>T 11 64889000 CM T C IntronicSNV . c.220+4A>G 11 64888968 RCCC T C Missense p.K92E c.274A>G 11 64888455 RCCC TCT - InFrameDeletion p.K102delK c.305_307delAGA 11 64888248 GBM TCT - InFrameDeletion p.K102delK c.305_307delAGA 11 64888248 LGG TCT - InFrameDeletion p.K102delK c.305_307delAGA 11 64888248 THCA