Mutation - TCGA Type Chromosome Start Position End Position Strand Variant Classification Variant Type Reference Allele Tumor_seq Allele 1 Tumor_seq Allele 2 Tumor Sample Barcode Matched Norm Sample Barcode Genome Change cDNA Change Codon Change Protein Change BLCA 7 100486857 100486857 + Silent SNP C C T TCGA-CF-A47X-01A-31D-A23U-08 TCGA-CF-A47X-10A-01D-A23U-08 g.chr7:100486857C>T c.36G>A c.(34-36)cgG>cgA p.R12R BRCA 7 100486535 100486535 + Missense_Mutation SNP C C G TCGA-BH-A1FN-01A-11D-A13L-09 TCGA-BH-A1FN-11A-34D-A13O-09 g.chr7:100486535C>G c.358G>C c.(358-360)Gac>Cac p.D120H BRCA 7 100486564 100486564 + Missense_Mutation SNP A A C TCGA-A2-A0T6-01A-11D-A099-09 TCGA-A2-A0T6-10A-01D-A099-09 g.chr7:100486564A>C c.329T>G c.(328-330)gTg>gGg p.V110G CESC 7 100486556 100486556 + Missense_Mutation SNP G G T TCGA-EK-A2R7-01A-11D-A18J-09 TCGA-EK-A2R7-10A-01D-A18J-09 g.chr7:100486556G>T c.337C>A c.(337-339)Caa>Aaa p.Q113K COAD 7 100486520 100486522 + In_Frame_Del DEL AGA AGA - TCGA-AD-5900-01A-11D-1650-10 TCGA-AD-5900-10A-01D-1650-10 g.chr7:100486520_100486522delAGA c.371_373delTCT c.(370-375)ttctac>tac p.F124del COAD 7 100486656 100486656 + Silent SNP T T G TCGA-D5-6923-01A-11D-1924-10 TCGA-D5-6923-10A-01D-1924-10 g.chr7:100486656T>G c.237A>C c.(235-237)gtA>gtC p.V79V COAD 7 100486696 100486697 + Frame_Shift_Ins INS - - C TCGA-AD-6889-01A-11D-1924-10 TCGA-AD-6889-10A-01D-1924-10 g.chr7:100486696_100486697insC c.196_197insG c.(196-198)gacfs p.D66fs COADREAD 7 100486520 100486522 + In_Frame_Del DEL AGA AGA - TCGA-AD-5900-01A-11D-1650-10 TCGA-AD-5900-10A-01D-1650-10 g.chr7:100486520_100486522delAGA c.371_373delTCT c.(370-375)ttctac>tac p.F124del COADREAD 7 100486656 100486656 + Silent SNP T T G TCGA-D5-6923-01A-11D-1924-10 TCGA-D5-6923-10A-01D-1924-10 g.chr7:100486656T>G c.237A>C c.(235-237)gtA>gtC p.V79V COADREAD 7 100486696 100486697 + Frame_Shift_Ins INS - - C TCGA-AD-6889-01A-11D-1924-10 TCGA-AD-6889-10A-01D-1924-10 g.chr7:100486696_100486697insC c.196_197insG c.(196-198)gacfs p.D66fs GBMLGG 7 100486857 100486857 + Silent SNP C C T TCGA-DU-7012-01A-11D-2024-08 TCGA-DU-7012-10A-01D-2024-08 g.chr7:100486857C>T c.36G>A c.(34-36)cgG>cgA p.R12R HNSC 7 100486561 100486562 + Frame_Shift_Del DEL CC CC - TCGA-CV-6952-01A-11D-1912-08 TCGA-CV-6952-10A-01D-1912-08 g.chr7:100486561_100486562delCC c.331_332delGG c.(331-333)ggcfs p.G111fs HNSC 7 100486564 100486564 + Missense_Mutation SNP A A G TCGA-T2-A6X2-01A-12D-A34J-08 TCGA-T2-A6X2-10B-01D-A34M-08 g.chr7:100486564A>G c.329T>C c.(328-330)gTg>gCg p.V110A KIPAN 7 100486530 100486530 + Frame_Shift_Del DEL G G - TCGA-BQ-7044-01A-11D-1961-08 TCGA-BQ-7044-11A-01D-1961-08 g.chr7:100486530delG c.363delC c.(361-363)cccfs p.P121fs KIRP 7 100486530 100486530 + Frame_Shift_Del DEL G G - TCGA-BQ-7044-01A-11D-1961-08 TCGA-BQ-7044-11A-01D-1961-08 g.chr7:100486530delG c.363delC c.(361-363)cccfs p.P121fs LGG 7 100486857 100486857 + Silent SNP C C T TCGA-DU-7012-01A-11D-2024-08 TCGA-DU-7012-10A-01D-2024-08 g.chr7:100486857C>T c.36G>A c.(34-36)cgG>cgA p.R12R LIHC 7 100486590 100486590 + Frame_Shift_Del DEL G G - TCGA-DD-A3A0-01A-11D-A20W-10 TCGA-DD-A3A0-11A-11D-A20W-10 g.chr7:100486590delG c.303delC c.(301-303)cccfs p.P101fs LUSC 7 100486765 100486765 + Missense_Mutation SNP A A T TCGA-66-2792-01A-01D-0983-08 TCGA-66-2792-11A-01D-0983-08 g.chr7:100486765A>T c.128T>A c.(127-129)cTg>cAg p.L43Q

Mutation - ICGC Project Code Chromosome Chromosome Start Chromosome End Mutation Type Mutated from Allele Mutated to Allele Consequence Type AA Mutation CDS Mutation BLCA-CN 7 100483495 100483495 single base substitution G A downstream_gene_variant BLCA-CN 7 100484028 100484028 single base substitution C T downstream_gene_variant BLCA-CN 7 100491611 100491611 single base substitution C T upstream_gene_variant BLCA-US 7 100482607 100482607 single base substitution G A downstream_gene_variant BLCA-US 7 100483362 100483362 single base substitution C G downstream_gene_variant BLCA-US 7 100485476 100485476 single base substitution C T downstream_gene_variant BLCA-US 7 100485992 100485992 single base substitution A C downstream_gene_variant BLCA-US 7 100489998 100489998 single base substitution C T upstream_gene_variant BLCA-US 7 100490233 100490233 single base substitution C T upstream_gene_variant BLCA-US 7 100491073 100491073 single base substitution C T upstream_gene_variant BLCA-US 7 100491541 100491541 single base substitution C A upstream_gene_variant BLCA-US 7 100491616 100491616 single base substitution G A upstream_gene_variant BRCA-EU 7 100482088 100482090 deletion of <=200bp AAG - downstream_gene_variant BRCA-EU 7 100482872 100482872 single base substitution G A downstream_gene_variant BRCA-EU 7 100483105 100483105 single base substitution C G downstream_gene_variant BRCA-EU 7 100484481 100484481 single base substitution C T downstream_gene_variant BRCA-EU 7 100484769 100484769 single base substitution G A downstream_gene_variant BRCA-EU 7 100486726 100486726 single base substitution C T missense_variant G56E 167G>A BRCA-EU 7 100488112 100488112 single base substitution G A upstream_gene_variant BRCA-EU 7 100488234 100488234 single base substitution G A upstream_gene_variant BRCA-EU 7 100488994 100488994 single base substitution C T upstream_gene_variant BRCA-EU 7 100490800 100490800 insertion of <=200bp - TG upstream_gene_variant BRCA-EU 7 100490803 100490803 single base substitution C T upstream_gene_variant BRCA-EU 7 100490804 100490804 single base substitution T A upstream_gene_variant BRCA-EU 7 100491051 100491051 single base substitution G T upstream_gene_variant BRCA-EU 7 100491132 100491132 single base substitution C A upstream_gene_variant BRCA-FR 7 100484481 100484481 single base substitution C T downstream_gene_variant BRCA-FR 7 100488112 100488112 single base substitution G A upstream_gene_variant BRCA-FR 7 100490845 100490845 single base substitution C T upstream_gene_variant BRCA-KR 7 100482527 100482527 single base substitution T C downstream_gene_variant BRCA-US 7 100482032 100482032 single base substitution C T downstream_gene_variant BRCA-US 7 100484569 100484569 single base substitution C T downstream_gene_variant BRCA-US 7 100484670 100484670 single base substitution C G downstream_gene_variant BRCA-US 7 100485396 100485396 single base substitution G A downstream_gene_variant BRCA-US 7 100485916 100485916 single base substitution C T downstream_gene_variant BRCA-US 7 100485995 100485995 single base substitution C G downstream_gene_variant BRCA-US 7 100486535 100486535 single base substitution C G missense_variant D120H 358G>C BRCA-US 7 100486564 100486564 single base substitution A C missense_variant V110G 329T>G BRCA-US 7 100488897 100488897 single base substitution T C upstream_gene_variant BRCA-US 7 100490265 100490265 single base substitution C T upstream_gene_variant BRCA-US 7 100491531 100491531 single base substitution T C upstream_gene_variant BTCA-JP 7 100489956 100489956 single base substitution C A upstream_gene_variant BTCA-JP 7 100490136 100490136 single base substitution C T upstream_gene_variant BTCA-JP 7 100490981 100490981 single base substitution G A upstream_gene_variant BTCA-JP 7 100491909 100491909 single base substitution G C upstream_gene_variant CESC-US 7 100482396 100482396 single base substitution G C downstream_gene_variant CESC-US 7 100482406 100482406 single base substitution G T downstream_gene_variant CESC-US 7 100482407 100482407 single base substitution G T downstream_gene_variant CESC-US 7 100482420 100482420 single base substitution G A downstream_gene_variant CESC-US 7 100482440 100482440 single base substitution C T downstream_gene_variant CESC-US 7 100482651 100482651 single base substitution G T downstream_gene_variant CESC-US 7 100482939 100482939 single base substitution C T downstream_gene_variant CESC-US 7 100483362 100483362 single base substitution C T downstream_gene_variant CESC-US 7 100485023 100485023 single base substitution G A downstream_gene_variant CESC-US 7 100485384 100485384 single base substitution A G downstream_gene_variant CESC-US 7 100486133 100486133 single base substitution G A downstream_gene_variant CESC-US 7 100486556 100486556 single base substitution G T missense_variant Q113K 337C>A CESC-US 7 100490160 100490160 single base substitution C T upstream_gene_variant CESC-US 7 100491481 100491481 single base substitution C G upstream_gene_variant CLLE-ES 7 100484615 100484615 single base substitution G C downstream_gene_variant COAD-US 7 100482899 100482899 single base substitution G A downstream_gene_variant COAD-US 7 100482979 100482979 single base substitution C T downstream_gene_variant COAD-US 7 100483960 100483960 single base substitution G A downstream_gene_variant COAD-US 7 100484735 100484735 single base substitution A G downstream_gene_variant COAD-US 7 100485673 100485673 single base substitution A G downstream_gene_variant COAD-US 7 100485725 100485725 single base substitution C T downstream_gene_variant COAD-US 7 100486110 100486110 single base substitution C T downstream_gene_variant COAD-US 7 100486520 100486522 deletion of <=200bp AGA - disruptive_inframe_deletion FY124Y COAD-US 7 100486696 100486696 insertion of <=200bp - C frameshift_variant D66E? COAD-US 7 100490027 100490027 single base substitution C T upstream_gene_variant COAD-US 7 100490077 100490077 single base substitution G A upstream_gene_variant COAD-US 7 100490797 100490797 single base substitution G T upstream_gene_variant COAD-US 7 100491611 100491611 single base substitution C T upstream_gene_variant COAD-US 7 100491616 100491616 single base substitution G A upstream_gene_variant COCA-CN 7 100482047 100482047 single base substitution G C downstream_gene_variant COCA-CN 7 100482741 100482741 single base substitution G A downstream_gene_variant COCA-CN 7 100483617 100483617 single base substitution G A downstream_gene_variant COCA-CN 7 100483998 100483998 single base substitution C T downstream_gene_variant COCA-CN 7 100484400 100484400 single base substitution C A downstream_gene_variant COCA-CN 7 100484508 100484508 single base substitution C T downstream_gene_variant COCA-CN 7 100488705 100488705 single base substitution C T upstream_gene_variant COCA-CN 7 100489976 100489976 single base substitution C T upstream_gene_variant COCA-CN 7 100491155 100491155 single base substitution C A upstream_gene_variant COCA-CN 7 100491367 100491367 single base substitution C T upstream_gene_variant ESAD-UK 7 100483827 100483827 single base substitution G A downstream_gene_variant ESAD-UK 7 100485410 100485410 single base substitution C T downstream_gene_variant ESAD-UK 7 100488055 100488055 single base substitution G A upstream_gene_variant ESAD-UK 7 100488343 100488343 single base substitution A C upstream_gene_variant ESAD-UK 7 100488889 100488889 single base substitution C T upstream_gene_variant ESCA-CN 7 100485727 100485727 single base substitution C T downstream_gene_variant ESCA-CN 7 100486631 100486631 single base substitution G A synonymous_variant L88L 262C>T ESCA-CN 7 100487873 100487873 single base substitution C T upstream_gene_variant ESCA-CN 7 100491355 100491355 single base substitution G A upstream_gene_variant GBM-US 7 100481735 100481735 insertion of <=200bp - G downstream_gene_variant GBM-US 7 100485931 100485931 single base substitution C G downstream_gene_variant GBM-US 7 100490909 100490909 single base substitution G A upstream_gene_variant KIRC-US 7 100483954 100483954 single base substitution G C downstream_gene_variant KIRC-US 7 100490365 100490367 deletion of <=200bp GTT - upstream_gene_variant KIRP-US 7 100482130 100482130 single base substitution G A downstream_gene_variant KIRP-US 7 100485329 100485329 single base substitution T C downstream_gene_variant KIRP-US 7 100485469 100485473 deletion of <=200bp GCCCC - downstream_gene_variant KIRP-US 7 100485704 100485704 single base substitution C A downstream_gene_variant KIRP-US 7 100486530 100486530 deletion of <=200bp G - frameshift_variant P121 LGG-US 7 100482650 100482652 deletion of <=200bp AGG - downstream_gene_variant LGG-US 7 100486857 100486857 single base substitution C T synonymous_variant R12R 36G>A LICA-CN 7 100487877 100487877 single base substitution C A upstream_gene_variant LICA-FR 7 100484462 100484462 single base substitution T C downstream_gene_variant LICA-FR 7 100486569 100486569 single base substitution C A synonymous_variant G108G 324G>T LICA-FR 7 100490107 100490107 single base substitution C T upstream_gene_variant LICA-FR 7 100491037 100491037 single base substitution C T upstream_gene_variant LIHC-US 7 100485882 100485882 single base substitution T C downstream_gene_variant LIHC-US 7 100487872 100487872 single base substitution T C upstream_gene_variant LINC-JP 7 100483085 100483085 single base substitution T G downstream_gene_variant LINC-JP 7 100483928 100483928 single base substitution A T downstream_gene_variant LINC-JP 7 100487033 100487033 single base substitution A C 5_prime_UTR_variant LINC-JP 7 100490652 100490652 single base substitution T A upstream_gene_variant LIRI-JP 7 100481726 100481726 single base substitution A G downstream_gene_variant LIRI-JP 7 100483085 100483085 single base substitution T G downstream_gene_variant LIRI-JP 7 100485395 100485395 single base substitution C A downstream_gene_variant LIRI-JP 7 100485870 100485871 deletion of <=200bp TG - downstream_gene_variant LIRI-JP 7 100488356 100488356 single base substitution A G upstream_gene_variant LIRI-JP 7 100489178 100489178 single base substitution C G upstream_gene_variant LIRI-JP 7 100490120 100490120 single base substitution T C upstream_gene_variant LIRI-JP 7 100490539 100490539 single base substitution T C upstream_gene_variant LIRI-JP 7 100490863 100490863 single base substitution C T upstream_gene_variant LIRI-JP 7 100491007 100491007 single base substitution C T upstream_gene_variant LUSC-KR 7 100481480 100481480 single base substitution C T downstream_gene_variant LUSC-KR 7 100488982 100488982 single base substitution A T upstream_gene_variant LUSC-KR 7 100489799 100489799 single base substitution C G upstream_gene_variant LUSC-KR 7 100490150 100490150 single base substitution C A upstream_gene_variant LUSC-US 7 100486765 100486765 single base substitution A T missense_variant L43Q 128T>A LUSC-US 7 100490047 100490047 single base substitution C G upstream_gene_variant LUSC-US 7 100490391 100490391 single base substitution C T upstream_gene_variant LUSC-US 7 100490928 100490928 single base substitution G C upstream_gene_variant LUSC-US 7 100491082 100491082 single base substitution G T upstream_gene_variant MALY-DE 7 100486622 100486622 single base substitution C T missense_variant D91N 271G>A MELA-AU 7 100481429 100481430 multiple base substitution (>=2bp and <=200bp) CC TT downstream_gene_variant MELA-AU 7 100481449 100481449 single base substitution C T downstream_gene_variant MELA-AU 7 100481551 100481551 single base substitution C T downstream_gene_variant MELA-AU 7 100481667 100481667 single base substitution T G downstream_gene_variant MELA-AU 7 100481695 100481695 single base substitution C T downstream_gene_variant MELA-AU 7 100482505 100482506 multiple base substitution (>=2bp and <=200bp) TG AT downstream_gene_variant MELA-AU 7 100482821 100482821 single base substitution C T downstream_gene_variant MELA-AU 7 100482920 100482920 single base substitution C T downstream_gene_variant MELA-AU 7 100483140 100483140 single base substitution C T downstream_gene_variant MELA-AU 7 100483362 100483362 single base substitution C T downstream_gene_variant MELA-AU 7 100483403 100483403 single base substitution G A downstream_gene_variant MELA-AU 7 100484117 100484117 single base substitution C T downstream_gene_variant MELA-AU 7 100486014 100486040 deletion of <=200bp GCAGACGCCCAAGCTTTGTTGCCGCCT - downstream_gene_variant MELA-AU 7 100487487 100487487 single base substitution C T upstream_gene_variant MELA-AU 7 100487929 100487929 single base substitution C T upstream_gene_variant MELA-AU 7 100488175 100488176 multiple base substitution (>=2bp and <=200bp) GG AA upstream_gene_variant MELA-AU 7 100488176 100488176 single base substitution G A upstream_gene_variant MELA-AU 7 100488202 100488202 single base substitution G A upstream_gene_variant MELA-AU 7 100488205 100488205 single base substitution G A upstream_gene_variant MELA-AU 7 100488296 100488296 single base substitution C T upstream_gene_variant MELA-AU 7 100488809 100488809 single base substitution G A upstream_gene_variant MELA-AU 7 100488854 100488854 single base substitution C T upstream_gene_variant MELA-AU 7 100489089 100489089 single base substitution C T upstream_gene_variant MELA-AU 7 100489713 100489713 single base substitution C T upstream_gene_variant MELA-AU 7 100489787 100489787 single base substitution C T upstream_gene_variant MELA-AU 7 100489801 100489801 single base substitution C T upstream_gene_variant MELA-AU 7 100490089 100490089 single base substitution C T upstream_gene_variant MELA-AU 7 100490312 100490312 single base substitution G A upstream_gene_variant MELA-AU 7 100490320 100490320 single base substitution G A upstream_gene_variant MELA-AU 7 100490348 100490348 single base substitution C T upstream_gene_variant MELA-AU 7 100490548 100490548 single base substitution G A upstream_gene_variant MELA-AU 7 100490579 100490579 single base substitution G A upstream_gene_variant MELA-AU 7 100490648 100490648 single base substitution G A upstream_gene_variant MELA-AU 7 100490669 100490669 single base substitution C T upstream_gene_variant MELA-AU 7 100490717 100490717 single base substitution C T upstream_gene_variant MELA-AU 7 100490939 100490939 single base substitution C T upstream_gene_variant MELA-AU 7 100491654 100491654 single base substitution G A upstream_gene_variant MELA-AU 7 100491819 100491819 single base substitution G A upstream_gene_variant MELA-AU 7 100491892 100491892 single base substitution G A upstream_gene_variant MELA-AU 7 100492017 100492017 single base substitution G T upstream_gene_variant MELA-AU 7 100492162 100492162 single base substitution C T upstream_gene_variant MELA-AU 7 100492309 100492309 single base substitution G A upstream_gene_variant ORCA-IN 7 100481729 100481729 single base substitution G A downstream_gene_variant ORCA-IN 7 100482010 100482010 single base substitution G T downstream_gene_variant ORCA-IN 7 100482141 100482141 single base substitution G A downstream_gene_variant OV-AU 7 100488066 100488066 single base substitution G T upstream_gene_variant OV-AU 7 100490874 100490874 single base substitution C G upstream_gene_variant OV-AU 7 100491150 100491150 single base substitution G T upstream_gene_variant OV-US 7 100485713 100485713 single base substitution C A downstream_gene_variant PACA-AU 7 100486256 100486256 single base substitution C G downstream_gene_variant PACA-AU 7 100488698 100488698 single base substitution G A upstream_gene_variant PACA-AU 7 100490074 100490074 single base substitution G A upstream_gene_variant PACA-AU 7 100491844 100491844 single base substitution G A upstream_gene_variant PACA-CA 7 100483998 100483998 single base substitution C T downstream_gene_variant PACA-CA 7 100489577 100489577 deletion of <=200bp T - upstream_gene_variant PACA-CA 7 100490181 100490181 single base substitution C A upstream_gene_variant PACA-CA 7 100490391 100490391 single base substitution C T upstream_gene_variant PACA-CA 7 100490881 100490881 single base substitution C T upstream_gene_variant PACA-CA 7 100491106 100491106 single base substitution G A upstream_gene_variant PACA-CA 7 100491129 100491129 single base substitution A G upstream_gene_variant PACA-CA 7 100491203 100491203 single base substitution G A upstream_gene_variant PACA-CA 7 100491337 100491337 single base substitution C T upstream_gene_variant PACA-CA 7 100491627 100491627 single base substitution C T upstream_gene_variant PAEN-AU 7 100482481 100482481 single base substitution G A downstream_gene_variant PAEN-AU 7 100488931 100488931 single base substitution C T upstream_gene_variant PBCA-DE 7 100483777 100483777 single base substitution G A downstream_gene_variant PBCA-DE 7 100490935 100490935 single base substitution G A upstream_gene_variant PRAD-CA 7 100487362 100487362 single base substitution G C upstream_gene_variant PRAD-CA 7 100487362 100487362 single base substitution G T upstream_gene_variant PRAD-CA 7 100491699 100491699 single base substitution C T upstream_gene_variant PRAD-UK 7 100487996 100487996 single base substitution G C upstream_gene_variant PRAD-US 7 100490935 100490935 single base substitution G A upstream_gene_variant SKCA-BR 7 100481800 100481800 single base substitution T G downstream_gene_variant SKCA-BR 7 100481944 100481944 single base substitution G T downstream_gene_variant SKCA-BR 7 100486656 100486656 single base substitution T G synonymous_variant V79V 237A>C SKCA-BR 7 100491157 100491157 single base substitution C A upstream_gene_variant SKCM-US 7 100482173 100482173 single base substitution G A downstream_gene_variant SKCM-US 7 100482420 100482420 single base substitution G A downstream_gene_variant SKCM-US 7 100482918 100482918 single base substitution G A downstream_gene_variant SKCM-US 7 100483874 100483874 single base substitution G A downstream_gene_variant SKCM-US 7 100484424 100484424 single base substitution C T downstream_gene_variant SKCM-US 7 100484463 100484463 single base substitution G A downstream_gene_variant SKCM-US 7 100484465 100484465 single base substitution T A downstream_gene_variant SKCM-US 7 100484522 100484522 single base substitution C T downstream_gene_variant SKCM-US 7 100484782 100484782 single base substitution C T downstream_gene_variant SKCM-US 7 100485698 100485698 single base substitution C A downstream_gene_variant SKCM-US 7 100488880 100488880 single base substitution C T upstream_gene_variant SKCM-US 7 100488959 100488959 single base substitution C T upstream_gene_variant SKCM-US 7 100490067 100490067 single base substitution C T upstream_gene_variant SKCM-US 7 100490111 100490111 single base substitution G A upstream_gene_variant SKCM-US 7 100490864 100490864 single base substitution G A upstream_gene_variant SKCM-US 7 100491034 100491034 single base substitution C T upstream_gene_variant SKCM-US 7 100491048 100491048 single base substitution G A upstream_gene_variant STAD-US 7 100481744 100481744 deletion of <=200bp G - downstream_gene_variant STAD-US 7 100482099 100482099 single base substitution C T downstream_gene_variant STAD-US 7 100482368 100482368 single base substitution A G downstream_gene_variant STAD-US 7 100482596 100482596 single base substitution G A downstream_gene_variant STAD-US 7 100482898 100482898 single base substitution G A downstream_gene_variant STAD-US 7 100483916 100483916 single base substitution C T downstream_gene_variant STAD-US 7 100484536 100484539 deletion of <=200bp AAGG - downstream_gene_variant STAD-US 7 100485018 100485018 single base substitution G A downstream_gene_variant STAD-US 7 100485890 100485890 single base substitution G A downstream_gene_variant STAD-US 7 100488859 100488859 single base substitution G A upstream_gene_variant STAD-US 7 100488914 100488914 single base substitution C T upstream_gene_variant STAD-US 7 100488956 100488956 single base substitution A G upstream_gene_variant STAD-US 7 100489954 100489954 single base substitution C T upstream_gene_variant STAD-US 7 100489999 100489999 single base substitution G A upstream_gene_variant STAD-US 7 100490064 100490064 single base substitution T C upstream_gene_variant STAD-US 7 100490117 100490117 single base substitution C T upstream_gene_variant STAD-US 7 100490818 100490818 single base substitution G T upstream_gene_variant STAD-US 7 100491090 100491090 single base substitution C A upstream_gene_variant STAD-US 7 100491206 100491208 deletion of <=200bp CTC - upstream_gene_variant STAD-US 7 100491298 100491298 single base substitution C T upstream_gene_variant STAD-US 7 100491479 100491479 single base substitution C A upstream_gene_variant STAD-US 7 100491548 100491548 single base substitution T C upstream_gene_variant STAD-US 7 100491560 100491560 single base substitution A G upstream_gene_variant STAD-US 7 100491577 100491577 single base substitution C T upstream_gene_variant STAD-US 7 100491627 100491627 single base substitution C T upstream_gene_variant THCA-SA 7 100482039 100482039 insertion of <=200bp - AGG downstream_gene_variant THCA-SA 7 100486464 100486464 single base substitution T G stop_lost *143C 429A>C THCA-US 7 100482086 100482086 single base substitution G C downstream_gene_variant UCEC-US 7 100482019 100482019 single base substitution A C downstream_gene_variant UCEC-US 7 100482040 100482042 deletion of <=200bp AGG - downstream_gene_variant UCEC-US 7 100482401 100482401 single base substitution C T downstream_gene_variant UCEC-US 7 100482557 100482557 single base substitution G A downstream_gene_variant UCEC-US 7 100482660 100482660 single base substitution C T downstream_gene_variant UCEC-US 7 100483923 100483923 single base substitution G A downstream_gene_variant UCEC-US 7 100483967 100483967 single base substitution G A downstream_gene_variant UCEC-US 7 100484426 100484426 single base substitution C T downstream_gene_variant UCEC-US 7 100484467 100484467 single base substitution G A downstream_gene_variant UCEC-US 7 100484493 100484493 single base substitution G T downstream_gene_variant UCEC-US 7 100484721 100484721 single base substitution C T downstream_gene_variant UCEC-US 7 100484762 100484762 single base substitution G A downstream_gene_variant UCEC-US 7 100485397 100485397 single base substitution C T downstream_gene_variant UCEC-US 7 100485430 100485430 single base substitution G A downstream_gene_variant UCEC-US 7 100485720 100485720 single base substitution T G downstream_gene_variant UCEC-US 7 100485886 100485886 single base substitution G A downstream_gene_variant UCEC-US 7 100485933 100485933 single base substitution G A downstream_gene_variant UCEC-US 7 100486181 100486181 single base substitution G A downstream_gene_variant UCEC-US 7 100486236 100486236 single base substitution G T downstream_gene_variant UCEC-US 7 100486477 100486477 single base substitution C T missense_variant R139H 416G>A UCEC-US 7 100487859 100487859 single base substitution C A upstream_gene_variant UCEC-US 7 100490017 100490017 single base substitution C T upstream_gene_variant UCEC-US 7 100490137 100490137 single base substitution G A upstream_gene_variant UCEC-US 7 100490363 100490363 single base substitution T G upstream_gene_variant UCEC-US 7 100490887 100490887 single base substitution C A upstream_gene_variant UCEC-US 7 100490900 100490900 single base substitution G A upstream_gene_variant UCEC-US 7 100491461 100491461 single base substitution G A upstream_gene_variant UCEC-US 7 100491567 100491567 single base substitution A G upstream_gene_variant

Mutation - COSMIC Sample Name Mutation ID Mutation CDS Mutation AA Mutation Description Mutation Genome Position Mutation Strand PTC-515C COSM4161413 c.139C>G p.L47V Substitution - Missense 7:100889133-100889133 - RMS88_ COSM4161413 c.139C>G p.L47V Substitution - Missense 7:100889133-100889133 - RMS85_ COSM4161413 c.139C>G p.L47V Substitution - Missense 7:100889133-100889133 - TCGA-EK-A2R7-01 COSM4852120 c.337C>A p.Q113K Substitution - Missense 7:100888935-100888935 - TCGA-AP-A0LM-01 COSM1083193 c.416G>A p.R139H Substitution - Missense 7:100888856-100888856 - RD COSM4161413 c.139C>G p.L47V Substitution - Missense 7:100889133-100889133 - RMS112_ COSM4161413 c.139C>G p.L47V Substitution - Missense 7:100889133-100889133 - ESCC_68 COSM5634045 c.72C>G p.L24L Substitution - coding silent 7:100889200-100889200 - T263 COSM4739034 c.234C>T p.C78C Substitution - coding silent 7:100889038-100889038 - 6P2-1 COSM3734260 c.305G>C p.S102T Substitution - Missense 7:100888967-100888967 - 6P2-2 COSM3734260 c.305G>C p.S102T Substitution - Missense 7:100888967-100888967 - CHC313T COSM4793509 c.324G>T p.G108G Substitution - coding silent 7:100888948-100888948 - CHC313T COSM4793509 c.324G>T p.G108G Substitution - coding silent 7:100888948-100888948 - TCGA-A2-A0T6-01 COSM3831350 c.329T>G p.V110G Substitution - Missense 7:100888943-100888943 - TCGA-AD-5900-01 COSM1446724 c.371_373delTCT p.F124delF Deletion - In frame 7:100888899-100888901 - RMS111_ COSM4161413 c.139C>G p.L47V Substitution - Missense 7:100889133-100889133 - TCGA-BH-A1FN-01 COSM1488030 c.358G>C p.D120H Substitution - Missense 7:100888914-100888914 - TCGA-AD-6889-01 COSM1446725 c.196_197insG p.D66fs*38 Insertion - Frameshift 7:100889075-100889076 - ESCC-248T COSM3941912 c.262C>T p.L88L Substitution - coding silent 7:100889010-100889010 - GC3_T COSM150343 c.237A>C p.V79V Substitution - coding silent 7:100889035-100889035 - TCGA-DU-7012-01 COSM3928681 c.36G>A p.R12R Substitution - coding silent 7:100889236-100889236 - TCGA-66-2792-01 COSM743633 c.128T>A p.L43Q Substitution - Missense 7:100889144-100889144 - SNUH_G10_S1 COSM150343 c.237A>C p.V79V Substitution - coding silent 7:100889035-100889035 - PTC-7C COSM150343 c.237A>C p.V79V Substitution - coding silent 7:100889035-100889035 - PD11397a COSM5797205 c.167G>A p.G56E Substitution - Missense 7:100889105-100889105 - Pat_59_B COSM5871345 c.136G>A p.E46K Substitution - Missense 7:100889136-100889136 - STC252 COSM5062028 c.291T>C p.T97T Substitution - coding silent 7:100888981-100888981 - SNUH_G45_S1 COSM150343 c.237A>C p.V79V Substitution - coding silent 7:100889035-100889035 - ESO-0133 COSM1269685 c.401C>T p.S134F Substitution - Missense 7:100888871-100888871 -

Mutation - CGAP UNIGENE CYTOBAND OMIM SNP Hs.534838;Hs.534841;Hs.534845 7q22.1 611481

Mutation - IntOGen Mutated from(ref) Mutated to(alt) Consequence Type AA Mutation CDS Mutation Chr Pos Cancer A G Missense p.L104P c.311T>C 7 100486582 CM A T Missense p.L43Q c.128T>A 7 100486765 LUSC CC - Frameshift p.G111Lfs*9 c.331_332delGG 7 100486561 HNSC C G Missense p.D120H c.358G>C 7 100486535 BRCA G A Missense p.S134F c.401C>T 7 100486492 ESCA