Mutation - ICGC |
Project Code | Chromosome | Chromosome Start | Chromosome End | Mutation Type | Mutated from Allele | Mutated to Allele | Consequence Type | AA Mutation | CDS Mutation |
BOCA-FR | 19 | 5558933 | 5558933 | single base substitution | G | T | downstream_gene_variant | | |
BOCA-FR | 19 | 5558933 | 5558933 | single base substitution | G | T | exon_variant | | |
BRCA-EU | 19 | 5553927 | 5553927 | single base substitution | G | C | downstream_gene_variant | | |
BRCA-EU | 19 | 5553950 | 5553950 | single base substitution | A | T | downstream_gene_variant | | |
BRCA-EU | 19 | 5554324 | 5554324 | single base substitution | G | C | downstream_gene_variant | | |
BRCA-EU | 19 | 5555501 | 5555501 | deletion of <=200bp | T | - | downstream_gene_variant | | |
BRCA-EU | 19 | 5560350 | 5560350 | single base substitution | T | G | downstream_gene_variant | | |
BRCA-EU | 19 | 5560350 | 5560350 | single base substitution | T | G | exon_variant | | |
BRCA-EU | 19 | 5560408 | 5560408 | single base substitution | C | G | downstream_gene_variant | | |
BRCA-EU | 19 | 5560408 | 5560408 | single base substitution | C | G | exon_variant | | |
BRCA-EU | 19 | 5564572 | 5564572 | single base substitution | G | C | intron_variant | | |
BRCA-EU | 19 | 5564572 | 5564572 | single base substitution | G | C | upstream_gene_variant | | |
BRCA-EU | 19 | 5565925 | 5565925 | single base substitution | C | T | intron_variant | | |
BRCA-EU | 19 | 5565925 | 5565925 | single base substitution | C | T | upstream_gene_variant | | |
BRCA-EU | 19 | 5568369 | 5568369 | single base substitution | C | T | upstream_gene_variant | | |
BRCA-EU | 19 | 5568734 | 5568734 | single base substitution | G | A | upstream_gene_variant | | |
BRCA-EU | 19 | 5569169 | 5569169 | single base substitution | C | A | upstream_gene_variant | | |
BRCA-EU | 19 | 5569509 | 5569509 | single base substitution | C | T | upstream_gene_variant | | |
BRCA-EU | 19 | 5569996 | 5569996 | single base substitution | C | T | upstream_gene_variant | | |
BRCA-EU | 19 | 5571812 | 5571812 | single base substitution | C | T | upstream_gene_variant | | |
BRCA-EU | 19 | 5572068 | 5572068 | single base substitution | A | G | upstream_gene_variant | | |
BRCA-EU | 19 | 5572341 | 5572341 | deletion of <=200bp | A | - | upstream_gene_variant | | |
BRCA-EU | 19 | 5572476 | 5572476 | single base substitution | G | C | upstream_gene_variant | | |
BRCA-FR | 19 | 5553401 | 5553401 | single base substitution | C | A | downstream_gene_variant | | |
BRCA-FR | 19 | 5553927 | 5553927 | single base substitution | G | C | downstream_gene_variant | | |
BRCA-FR | 19 | 5560350 | 5560350 | single base substitution | T | G | downstream_gene_variant | | |
BRCA-FR | 19 | 5560350 | 5560350 | single base substitution | T | G | exon_variant | | |
BRCA-UK | 19 | 5570237 | 5570237 | single base substitution | C | T | upstream_gene_variant | | |
CESC-US | 19 | 5561091 | 5561091 | single base substitution | G | C | downstream_gene_variant | | |
CESC-US | 19 | 5561091 | 5561091 | single base substitution | G | C | exon_variant | | |
CESC-US | 19 | 5561140 | 5561140 | single base substitution | C | G | downstream_gene_variant | | |
CESC-US | 19 | 5561140 | 5561140 | single base substitution | C | G | exon_variant | | |
CESC-US | 19 | 5562149 | 5562149 | single base substitution | C | G | exon_variant | | |
CLLE-ES | 19 | 5556960 | 5556960 | single base substitution | G | A | downstream_gene_variant | | |
CLLE-ES | 19 | 5562251 | 5562251 | single base substitution | T | A | exon_variant | | |
CLLE-ES | 19 | 5562251 | 5562251 | single base substitution | T | A | intron_variant | | |
EOPC-DE | 19 | 5554613 | 5554613 | single base substitution | C | T | downstream_gene_variant | | |
ESAD-UK | 19 | 5553938 | 5553938 | single base substitution | C | T | downstream_gene_variant | | |
ESAD-UK | 19 | 5555704 | 5555704 | single base substitution | G | A | downstream_gene_variant | | |
ESAD-UK | 19 | 5556389 | 5556389 | single base substitution | C | T | downstream_gene_variant | | |
ESAD-UK | 19 | 5556802 | 5556802 | single base substitution | G | T | downstream_gene_variant | | |
ESAD-UK | 19 | 5556890 | 5556890 | single base substitution | G | T | downstream_gene_variant | | |
ESAD-UK | 19 | 5558429 | 5558429 | single base substitution | G | A | downstream_gene_variant | | |
ESAD-UK | 19 | 5558429 | 5558429 | single base substitution | G | A | exon_variant | | |
ESAD-UK | 19 | 5558528 | 5558528 | single base substitution | A | G | downstream_gene_variant | | |
ESAD-UK | 19 | 5558528 | 5558528 | single base substitution | A | G | exon_variant | | |
ESAD-UK | 19 | 5558952 | 5558952 | single base substitution | G | T | downstream_gene_variant | | |
ESAD-UK | 19 | 5558952 | 5558952 | single base substitution | G | T | exon_variant | | |
ESAD-UK | 19 | 5560433 | 5560433 | single base substitution | C | T | downstream_gene_variant | | |
ESAD-UK | 19 | 5560433 | 5560433 | single base substitution | C | T | exon_variant | | |
ESAD-UK | 19 | 5561050 | 5561050 | single base substitution | C | T | downstream_gene_variant | | |
ESAD-UK | 19 | 5561050 | 5561050 | single base substitution | C | T | exon_variant | | |
ESAD-UK | 19 | 5561624 | 5561624 | insertion of <=200bp | - | T | downstream_gene_variant | | |
ESAD-UK | 19 | 5561624 | 5561624 | insertion of <=200bp | - | T | intron_variant | | |
ESAD-UK | 19 | 5562436 | 5562436 | single base substitution | C | T | intron_variant | | |
ESAD-UK | 19 | 5562436 | 5562436 | single base substitution | C | T | upstream_gene_variant | | |
ESAD-UK | 19 | 5562960 | 5562960 | single base substitution | G | A | intron_variant | | |
ESAD-UK | 19 | 5562960 | 5562960 | single base substitution | G | A | upstream_gene_variant | | |
ESAD-UK | 19 | 5565130 | 5565130 | single base substitution | C | T | intron_variant | | |
ESAD-UK | 19 | 5565130 | 5565130 | single base substitution | C | T | upstream_gene_variant | | |
ESAD-UK | 19 | 5565571 | 5565571 | single base substitution | T | C | intron_variant | | |
ESAD-UK | 19 | 5565571 | 5565571 | single base substitution | T | C | upstream_gene_variant | | |
ESAD-UK | 19 | 5568636 | 5568636 | single base substitution | G | A | upstream_gene_variant | | |
ESAD-UK | 19 | 5568989 | 5568989 | single base substitution | C | T | upstream_gene_variant | | |
ESAD-UK | 19 | 5569540 | 5569540 | single base substitution | C | G | upstream_gene_variant | | |
ESAD-UK | 19 | 5571183 | 5571183 | single base substitution | A | G | upstream_gene_variant | | |
ESAD-UK | 19 | 5571366 | 5571366 | single base substitution | C | A | upstream_gene_variant | | |
LAML-KR | 19 | 5556062 | 5556062 | single base substitution | C | T | downstream_gene_variant | | |
LICA-FR | 19 | 5564702 | 5564702 | single base substitution | C | A | intron_variant | | |
LICA-FR | 19 | 5564702 | 5564702 | single base substitution | C | A | upstream_gene_variant | | |
LINC-JP | 19 | 5564795 | 5564795 | single base substitution | G | A | intron_variant | | |
LINC-JP | 19 | 5564795 | 5564795 | single base substitution | G | A | upstream_gene_variant | | |
LINC-JP | 19 | 5564931 | 5564931 | single base substitution | T | C | intron_variant | | |
LINC-JP | 19 | 5564931 | 5564931 | single base substitution | T | C | upstream_gene_variant | | |
LIRI-JP | 19 | 5554130 | 5554130 | single base substitution | A | G | downstream_gene_variant | | |
LIRI-JP | 19 | 5554837 | 5554837 | single base substitution | G | T | downstream_gene_variant | | |
LIRI-JP | 19 | 5556060 | 5556060 | single base substitution | T | A | downstream_gene_variant | | |
LIRI-JP | 19 | 5561739 | 5561739 | single base substitution | T | C | exon_variant | | |
LIRI-JP | 19 | 5561739 | 5561739 | single base substitution | T | C | intron_variant | | |
LIRI-JP | 19 | 5561855 | 5561855 | single base substitution | T | A | intron_variant | | |
LIRI-JP | 19 | 5562595 | 5562595 | single base substitution | C | T | intron_variant | | |
LIRI-JP | 19 | 5562595 | 5562595 | single base substitution | C | T | upstream_gene_variant | | |
LIRI-JP | 19 | 5563882 | 5563882 | single base substitution | C | T | intron_variant | | |
LIRI-JP | 19 | 5563882 | 5563882 | single base substitution | C | T | upstream_gene_variant | | |
LIRI-JP | 19 | 5564875 | 5564875 | single base substitution | C | A | intron_variant | | |
LIRI-JP | 19 | 5564875 | 5564875 | single base substitution | C | A | upstream_gene_variant | | |
LIRI-JP | 19 | 5571224 | 5571224 | single base substitution | T | C | upstream_gene_variant | | |
LIRI-JP | 19 | 5572838 | 5572838 | single base substitution | G | T | upstream_gene_variant | | |
LUSC-KR | 19 | 5560182 | 5560182 | single base substitution | C | G | downstream_gene_variant | | |
LUSC-KR | 19 | 5560182 | 5560182 | single base substitution | C | G | exon_variant | | |
LUSC-KR | 19 | 5563287 | 5563287 | single base substitution | C | G | intron_variant | | |
LUSC-KR | 19 | 5563287 | 5563287 | single base substitution | C | G | upstream_gene_variant | | |
LUSC-KR | 19 | 5572314 | 5572314 | single base substitution | C | A | upstream_gene_variant | | |
MALY-DE | 19 | 5559512 | 5559512 | insertion of <=200bp | - | T | downstream_gene_variant | | |
MALY-DE | 19 | 5559512 | 5559512 | insertion of <=200bp | - | T | exon_variant | | |
MALY-DE | 19 | 5572808 | 5572808 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5553289 | 5553289 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5553391 | 5553391 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5553707 | 5553707 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5553726 | 5553726 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5554193 | 5554194 | multiple base substitution (>=2bp and <=200bp) | CC | TT | downstream_gene_variant | | |
MELA-AU | 19 | 5554433 | 5554433 | single base substitution | A | T | downstream_gene_variant | | |
MELA-AU | 19 | 5554526 | 5554526 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5554666 | 5554666 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5554701 | 5554701 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5554793 | 5554793 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5555041 | 5555041 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5555087 | 5555087 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5555097 | 5555097 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5555106 | 5555106 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5555515 | 5555515 | single base substitution | T | C | downstream_gene_variant | | |
MELA-AU | 19 | 5555768 | 5555768 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5555862 | 5555862 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5555922 | 5555922 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5556441 | 5556441 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5556666 | 5556666 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5556693 | 5556693 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5556703 | 5556703 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5556846 | 5556846 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5556892 | 5556892 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5556896 | 5556896 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5556914 | 5556914 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5556971 | 5556971 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5557043 | 5557043 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5557046 | 5557046 | single base substitution | A | T | downstream_gene_variant | | |
MELA-AU | 19 | 5557048 | 5557048 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5557619 | 5557619 | single base substitution | A | T | downstream_gene_variant | | |
MELA-AU | 19 | 5557695 | 5557695 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5557926 | 5557926 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5558085 | 5558085 | single base substitution | A | G | downstream_gene_variant | | |
MELA-AU | 19 | 5558113 | 5558113 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5558242 | 5558242 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5558242 | 5558242 | single base substitution | C | T | exon_variant | | |
MELA-AU | 19 | 5558773 | 5558773 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5558773 | 5558773 | single base substitution | C | T | exon_variant | | |
MELA-AU | 19 | 5559021 | 5559022 | multiple base substitution (>=2bp and <=200bp) | CC | TT | downstream_gene_variant | | |
MELA-AU | 19 | 5559021 | 5559022 | multiple base substitution (>=2bp and <=200bp) | CC | TT | exon_variant | | |
MELA-AU | 19 | 5559573 | 5559573 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5559573 | 5559573 | single base substitution | C | T | exon_variant | | |
MELA-AU | 19 | 5560049 | 5560049 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5560049 | 5560049 | single base substitution | G | A | exon_variant | | |
MELA-AU | 19 | 5560059 | 5560059 | insertion of <=200bp | - | C | downstream_gene_variant | | |
MELA-AU | 19 | 5560059 | 5560059 | insertion of <=200bp | - | C | exon_variant | | |
MELA-AU | 19 | 5560203 | 5560203 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5560203 | 5560203 | single base substitution | G | A | exon_variant | | |
MELA-AU | 19 | 5560236 | 5560236 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5560236 | 5560236 | single base substitution | G | A | exon_variant | | |
MELA-AU | 19 | 5560733 | 5560733 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5560733 | 5560733 | single base substitution | G | A | exon_variant | | |
MELA-AU | 19 | 5560735 | 5560735 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5560735 | 5560735 | single base substitution | G | A | exon_variant | | |
MELA-AU | 19 | 5560904 | 5560904 | single base substitution | C | A | downstream_gene_variant | | |
MELA-AU | 19 | 5560904 | 5560904 | single base substitution | C | A | exon_variant | | |
MELA-AU | 19 | 5560947 | 5560947 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5560947 | 5560947 | single base substitution | G | A | exon_variant | | |
MELA-AU | 19 | 5561399 | 5561399 | single base substitution | G | A | downstream_gene_variant | | |
MELA-AU | 19 | 5561399 | 5561399 | single base substitution | G | A | exon_variant | | |
MELA-AU | 19 | 5561513 | 5561513 | single base substitution | C | T | downstream_gene_variant | | |
MELA-AU | 19 | 5561513 | 5561513 | single base substitution | C | T | intron_variant | | |
MELA-AU | 19 | 5562292 | 5562292 | single base substitution | C | T | exon_variant | | |
MELA-AU | 19 | 5562292 | 5562292 | single base substitution | C | T | intron_variant | | |
MELA-AU | 19 | 5562464 | 5562464 | single base substitution | A | C | intron_variant | | |
MELA-AU | 19 | 5562464 | 5562464 | single base substitution | A | C | upstream_gene_variant | | |
MELA-AU | 19 | 5562520 | 5562520 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5562520 | 5562520 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5562521 | 5562521 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5562521 | 5562521 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5562871 | 5562871 | single base substitution | C | T | intron_variant | | |
MELA-AU | 19 | 5562871 | 5562871 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5563008 | 5563008 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5563008 | 5563008 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5563011 | 5563011 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5563011 | 5563011 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5563142 | 5563142 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5563142 | 5563142 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5563296 | 5563296 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5563296 | 5563296 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5564581 | 5564581 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5564581 | 5564581 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5564613 | 5564613 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5564613 | 5564613 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5564785 | 5564785 | single base substitution | C | G | intron_variant | | |
MELA-AU | 19 | 5564785 | 5564785 | single base substitution | C | G | upstream_gene_variant | | |
MELA-AU | 19 | 5564830 | 5564830 | single base substitution | C | T | intron_variant | | |
MELA-AU | 19 | 5564830 | 5564830 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5565161 | 5565161 | single base substitution | C | T | intron_variant | | |
MELA-AU | 19 | 5565161 | 5565161 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5565373 | 5565373 | single base substitution | C | T | intron_variant | | |
MELA-AU | 19 | 5565373 | 5565373 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5565702 | 5565702 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5565702 | 5565702 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5565750 | 5565750 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5565750 | 5565750 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5565891 | 5565891 | single base substitution | G | T | intron_variant | | |
MELA-AU | 19 | 5565891 | 5565891 | single base substitution | G | T | upstream_gene_variant | | |
MELA-AU | 19 | 5566116 | 5566116 | single base substitution | C | T | intron_variant | | |
MELA-AU | 19 | 5566116 | 5566116 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5566686 | 5566686 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5566686 | 5566686 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5566801 | 5566801 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5566801 | 5566801 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5567059 | 5567059 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5567059 | 5567059 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5567302 | 5567302 | single base substitution | G | A | intron_variant | | |
MELA-AU | 19 | 5567302 | 5567302 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5568343 | 5568343 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5568978 | 5568978 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5570158 | 5570158 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5570316 | 5570316 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5570629 | 5570629 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5571187 | 5571187 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5571397 | 5571397 | single base substitution | A | G | upstream_gene_variant | | |
MELA-AU | 19 | 5571800 | 5571800 | single base substitution | A | C | upstream_gene_variant | | |
MELA-AU | 19 | 5572675 | 5572675 | single base substitution | G | A | upstream_gene_variant | | |
MELA-AU | 19 | 5572910 | 5572910 | single base substitution | C | T | upstream_gene_variant | | |
MELA-AU | 19 | 5573022 | 5573022 | single base substitution | T | C | upstream_gene_variant | | |
ORCA-IN | 19 | 5557475 | 5557475 | single base substitution | A | T | downstream_gene_variant | | |
OV-AU | 19 | 5555444 | 5555444 | single base substitution | C | T | downstream_gene_variant | | |
OV-AU | 19 | 5558327 | 5558327 | single base substitution | G | C | downstream_gene_variant | | |
OV-AU | 19 | 5558327 | 5558327 | single base substitution | G | C | exon_variant | | |
OV-AU | 19 | 5561362 | 5561362 | single base substitution | C | T | downstream_gene_variant | | |
OV-AU | 19 | 5561362 | 5561362 | single base substitution | C | T | exon_variant | | |
OV-AU | 19 | 5563424 | 5563424 | single base substitution | T | A | intron_variant | | |
OV-AU | 19 | 5563424 | 5563424 | single base substitution | T | A | upstream_gene_variant | | |
OV-AU | 19 | 5565865 | 5565865 | single base substitution | G | A | intron_variant | | |
OV-AU | 19 | 5565865 | 5565865 | single base substitution | G | A | upstream_gene_variant | | |
OV-AU | 19 | 5566159 | 5566159 | single base substitution | G | A | intron_variant | | |
OV-AU | 19 | 5566159 | 5566159 | single base substitution | G | A | upstream_gene_variant | | |
OV-AU | 19 | 5567118 | 5567118 | single base substitution | G | A | intron_variant | | |
OV-AU | 19 | 5567118 | 5567118 | single base substitution | G | A | upstream_gene_variant | | |
OV-AU | 19 | 5572958 | 5572958 | single base substitution | G | C | upstream_gene_variant | | |
PACA-AU | 19 | 5553595 | 5553595 | single base substitution | C | T | downstream_gene_variant | | |
PACA-AU | 19 | 5554887 | 5554887 | single base substitution | A | T | downstream_gene_variant | | |
PACA-AU | 19 | 5556925 | 5556925 | deletion of <=200bp | A | - | downstream_gene_variant | | |
PACA-AU | 19 | 5561006 | 5561006 | single base substitution | G | T | downstream_gene_variant | | |
PACA-AU | 19 | 5561006 | 5561006 | single base substitution | G | T | exon_variant | | |
PACA-AU | 19 | 5568366 | 5568366 | single base substitution | C | T | upstream_gene_variant | | |
PACA-AU | 19 | 5569029 | 5569029 | single base substitution | A | C | upstream_gene_variant | | |
PACA-AU | 19 | 5570765 | 5570765 | single base substitution | C | A | upstream_gene_variant | | |
PACA-AU | 19 | 5570809 | 5570809 | single base substitution | G | A | upstream_gene_variant | | |
PACA-AU | 19 | 5570809 | 5570809 | single base substitution | G | T | upstream_gene_variant | | |
PACA-AU | 19 | 5570810 | 5570810 | single base substitution | T | C | upstream_gene_variant | | |
PACA-CA | 19 | 5554796 | 5554796 | single base substitution | G | A | downstream_gene_variant | | |
PACA-CA | 19 | 5556007 | 5556007 | single base substitution | C | T | downstream_gene_variant | | |
PACA-CA | 19 | 5558952 | 5558952 | single base substitution | G | T | downstream_gene_variant | | |
PACA-CA | 19 | 5558952 | 5558952 | single base substitution | G | T | exon_variant | | |
PACA-CA | 19 | 5561275 | 5561275 | deletion of <=200bp | T | - | downstream_gene_variant | | |
PACA-CA | 19 | 5561275 | 5561275 | deletion of <=200bp | T | - | exon_variant | | |
PACA-CA | 19 | 5561281 | 5561286 | deletion of <=200bp | CCGATA | - | downstream_gene_variant | | |
PACA-CA | 19 | 5561281 | 5561286 | deletion of <=200bp | CCGATA | - | exon_variant | | |
PACA-CA | 19 | 5561982 | 5561982 | single base substitution | A | G | intron_variant | | |
PACA-CA | 19 | 5562254 | 5562254 | single base substitution | C | T | exon_variant | | |
PACA-CA | 19 | 5562254 | 5562254 | single base substitution | C | T | intron_variant | | |
PACA-CA | 19 | 5562579 | 5562579 | deletion of <=200bp | A | - | intron_variant | | |
PACA-CA | 19 | 5562579 | 5562579 | deletion of <=200bp | A | - | upstream_gene_variant | | |
PACA-CA | 19 | 5565091 | 5565091 | single base substitution | G | T | intron_variant | | |
PACA-CA | 19 | 5565091 | 5565091 | single base substitution | G | T | upstream_gene_variant | | |
PACA-CA | 19 | 5565979 | 5565979 | single base substitution | C | T | intron_variant | | |
PACA-CA | 19 | 5565979 | 5565979 | single base substitution | C | T | upstream_gene_variant | | |
PACA-CA | 19 | 5568989 | 5568989 | single base substitution | C | T | upstream_gene_variant | | |
PACA-CA | 19 | 5569274 | 5569274 | single base substitution | G | T | upstream_gene_variant | | |
PACA-CA | 19 | 5570593 | 5570593 | single base substitution | C | T | upstream_gene_variant | | |
PAEN-AU | 19 | 5566786 | 5566786 | single base substitution | C | A | intron_variant | | |
PAEN-AU | 19 | 5566786 | 5566786 | single base substitution | C | A | upstream_gene_variant | | |
PAEN-AU | 19 | 5570809 | 5570809 | single base substitution | G | A | upstream_gene_variant | | |
PAEN-AU | 19 | 5570810 | 5570810 | single base substitution | T | C | upstream_gene_variant | | |
PBCA-DE | 19 | 5553552 | 5553552 | single base substitution | G | C | downstream_gene_variant | | |
PBCA-DE | 19 | 5556098 | 5556098 | single base substitution | C | T | downstream_gene_variant | | |
PBCA-DE | 19 | 5569968 | 5569968 | deletion of <=200bp | T | - | upstream_gene_variant | | |
PBCA-DE | 19 | 5572098 | 5572098 | single base substitution | C | T | upstream_gene_variant | | |
PRAD-UK | 19 | 5554376 | 5554376 | single base substitution | G | A | downstream_gene_variant | | |
PRAD-UK | 19 | 5555500 | 5555500 | insertion of <=200bp | - | T | downstream_gene_variant | | |
PRAD-UK | 19 | 5559485 | 5559534 | deletion of <=200bp | ACAGGCGCCCGCCACCAGGCCCGGCTATTTTTTTTGTACTTTTAGTAGAG | - | downstream_gene_variant | | |
PRAD-UK | 19 | 5559485 | 5559534 | deletion of <=200bp | ACAGGCGCCCGCCACCAGGCCCGGCTATTTTTTTTGTACTTTTAGTAGAG | - | exon_variant | | |
PRAD-UK | 19 | 5570392 | 5570392 | single base substitution | A | C | upstream_gene_variant | | |
PRAD-UK | 19 | 5570393 | 5570393 | single base substitution | G | A | upstream_gene_variant | | |
RECA-EU | 19 | 5559539 | 5559539 | single base substitution | G | A | downstream_gene_variant | | |
RECA-EU | 19 | 5559539 | 5559539 | single base substitution | G | A | exon_variant | | |
RECA-EU | 19 | 5564343 | 5564343 | single base substitution | C | G | intron_variant | | |
RECA-EU | 19 | 5564343 | 5564343 | single base substitution | C | G | upstream_gene_variant | | |
SKCA-BR | 19 | 5553301 | 5553301 | insertion of <=200bp | - | CT | downstream_gene_variant | | |
SKCA-BR | 19 | 5553603 | 5553603 | single base substitution | T | C | downstream_gene_variant | | |
SKCA-BR | 19 | 5554505 | 5554505 | single base substitution | T | C | downstream_gene_variant | | |
SKCA-BR | 19 | 5554640 | 5554640 | single base substitution | A | T | downstream_gene_variant | | |
SKCA-BR | 19 | 5554798 | 5554798 | single base substitution | T | C | downstream_gene_variant | | |
SKCA-BR | 19 | 5555529 | 5555529 | single base substitution | C | T | downstream_gene_variant | | |
SKCA-BR | 19 | 5558519 | 5558519 | single base substitution | G | A | downstream_gene_variant | | |
SKCA-BR | 19 | 5558519 | 5558519 | single base substitution | G | A | exon_variant | | |
SKCA-BR | 19 | 5559345 | 5559347 | deletion of <=200bp | CTT | - | downstream_gene_variant | | |
SKCA-BR | 19 | 5559345 | 5559347 | deletion of <=200bp | CTT | - | exon_variant | | |
SKCA-BR | 19 | 5561007 | 5561007 | single base substitution | G | A | downstream_gene_variant | | |
SKCA-BR | 19 | 5561007 | 5561007 | single base substitution | G | A | exon_variant | | |
SKCA-BR | 19 | 5564158 | 5564158 | single base substitution | A | G | intron_variant | | |
SKCA-BR | 19 | 5564158 | 5564158 | single base substitution | A | G | upstream_gene_variant | | |
SKCA-BR | 19 | 5564328 | 5564328 | single base substitution | A | C | intron_variant | | |
SKCA-BR | 19 | 5564328 | 5564328 | single base substitution | A | C | upstream_gene_variant | | |
SKCA-BR | 19 | 5569196 | 5569196 | single base substitution | G | A | upstream_gene_variant | | |
SKCA-BR | 19 | 5569592 | 5569592 | single base substitution | G | A | upstream_gene_variant | | |
SKCA-BR | 19 | 5571296 | 5571296 | single base substitution | T | C | upstream_gene_variant | | |
THCA-SA | 19 | 5560812 | 5560812 | single base substitution | G | C | downstream_gene_variant | | |
THCA-SA | 19 | 5560812 | 5560812 | single base substitution | G | C | exon_variant | | |
THCA-SA | 19 | 5561381 | 5561381 | single base substitution | G | T | downstream_gene_variant | | |
THCA-SA | 19 | 5561381 | 5561381 | single base substitution | G | T | exon_variant | | |