Mutation - ICGC | Project Code | Chromosome | Chromosome Start | Chromosome End | Mutation Type | Mutated from Allele | Mutated to Allele | Consequence Type | AA Mutation | CDS Mutation | BLCA-CN | 6 | 33289619 | 33289619 | single base substitution | G | A | upstream_gene_variant | | | BLCA-US | 6 | 33283235 | 33283235 | single base substitution | G | A | downstream_gene_variant | | | BLCA-US | 6 | 33283235 | 33283235 | single base substitution | G | A | synonymous_variant | L487L | 1459C>T | BLCA-US | 6 | 33283569 | 33283569 | single base substitution | G | A | downstream_gene_variant | | | BLCA-US | 6 | 33283569 | 33283569 | single base substitution | G | A | synonymous_variant | V375V | 1125C>T | BLCA-US | 6 | 33284067 | 33284067 | single base substitution | G | A | downstream_gene_variant | | | BLCA-US | 6 | 33284067 | 33284067 | single base substitution | G | A | synonymous_variant | F209F | 627C>T | BLCA-US | 6 | 33284074 | 33284074 | single base substitution | T | C | downstream_gene_variant | | | BLCA-US | 6 | 33284074 | 33284074 | single base substitution | T | C | missense_variant | N207S | 620A>G | BLCA-US | 6 | 33284382 | 33284382 | single base substitution | G | A | synonymous_variant | A104A | 312C>T | BLCA-US | 6 | 33284430 | 33284430 | single base substitution | G | C | synonymous_variant | L88L | 264C>G | BLCA-US | 6 | 33284496 | 33284496 | single base substitution | C | T | synonymous_variant | R66R | 198G>A | BLCA-US | 6 | 33287200 | 33287200 | single base substitution | G | A | upstream_gene_variant | | | BLCA-US | 6 | 33288742 | 33288742 | single base substitution | G | A | upstream_gene_variant | | | BLCA-US | 6 | 33289243 | 33289243 | single base substitution | C | T | upstream_gene_variant | | | BRCA-EU | 6 | 33278191 | 33278191 | single base substitution | G | A | downstream_gene_variant | | | BRCA-EU | 6 | 33278405 | 33278405 | single base substitution | G | C | downstream_gene_variant | | | BRCA-EU | 6 | 33281878 | 33281878 | single base substitution | C | T | downstream_gene_variant | | | BRCA-EU | 6 | 33282087 | 33282087 | single base substitution | A | C | downstream_gene_variant | | | BRCA-EU | 6 | 33283153 | 33283153 | single base substitution | T | C | downstream_gene_variant | | | BRCA-EU | 6 | 33283153 | 33283153 | single base substitution | T | C | missense_variant | D514G | 1541A>G | BRCA-EU | 6 | 33283184 | 33283184 | single base substitution | C | T | downstream_gene_variant | | | BRCA-EU | 6 | 33283184 | 33283184 | single base substitution | C | T | missense_variant | V504M | 1510G>A | BRCA-EU | 6 | 33283206 | 33283206 | single base substitution | G | C | downstream_gene_variant | | | BRCA-EU | 6 | 33283206 | 33283206 | single base substitution | G | C | missense_variant | H496Q | 1488C>G | BRCA-EU | 6 | 33284236 | 33284236 | single base substitution | G | A | downstream_gene_variant | | | BRCA-EU | 6 | 33284236 | 33284236 | single base substitution | G | A | missense_variant | S153L | 458C>T | BRCA-EU | 6 | 33284314 | 33284314 | single base substitution | A | C | missense_variant | F127C | 380T>G | BRCA-EU | 6 | 33284713 | 33284713 | insertion of <=200bp | - | C | 5_prime_UTR_variant | | | BRCA-EU | 6 | 33285346 | 33285346 | insertion of <=200bp | - | C | intron_variant | | | BRCA-EU | 6 | 33285942 | 33285942 | single base substitution | G | A | upstream_gene_variant | | | BRCA-EU | 6 | 33286628 | 33286628 | single base substitution | G | A | upstream_gene_variant | | | BRCA-EU | 6 | 33286886 | 33286886 | single base substitution | G | A | upstream_gene_variant | | | BRCA-EU | 6 | 33287432 | 33287432 | single base substitution | C | T | upstream_gene_variant | | | BRCA-EU | 6 | 33289423 | 33289423 | single base substitution | G | T | upstream_gene_variant | | | BRCA-EU | 6 | 33289932 | 33289932 | single base substitution | G | T | upstream_gene_variant | | | BRCA-EU | 6 | 33290607 | 33290607 | single base substitution | C | T | upstream_gene_variant | | | BRCA-FR | 6 | 33280846 | 33280846 | single base substitution | C | T | downstream_gene_variant | | | BRCA-FR | 6 | 33284236 | 33284236 | single base substitution | G | A | downstream_gene_variant | | | BRCA-FR | 6 | 33284236 | 33284236 | single base substitution | G | A | missense_variant | S153L | 458C>T | BRCA-FR | 6 | 33284314 | 33284314 | single base substitution | A | C | missense_variant | F127C | 380T>G | BRCA-FR | 6 | 33285942 | 33285942 | single base substitution | G | A | upstream_gene_variant | | | BRCA-FR | 6 | 33286628 | 33286628 | single base substitution | G | A | upstream_gene_variant | | | BRCA-FR | 6 | 33287432 | 33287432 | single base substitution | C | T | upstream_gene_variant | | | BRCA-KR | 6 | 33290608 | 33290608 | single base substitution | G | C | upstream_gene_variant | | | BRCA-UK | 6 | 33283393 | 33283393 | single base substitution | G | A | downstream_gene_variant | | | BRCA-UK | 6 | 33283393 | 33283393 | single base substitution | G | A | missense_variant | S434L | 1301C>T | BRCA-UK | 6 | 33286111 | 33286111 | single base substitution | G | A | upstream_gene_variant | | | BRCA-UK | 6 | 33289100 | 33289100 | single base substitution | G | T | upstream_gene_variant | | | BRCA-US | 6 | 33282945 | 33282945 | deletion of <=200bp | C | - | downstream_gene_variant | | | BRCA-US | 6 | 33282945 | 33282945 | deletion of <=200bp | C | - | frameshift_variant | G583 | | BRCA-US | 6 | 33283446 | 33283446 | single base substitution | G | C | downstream_gene_variant | | | BRCA-US | 6 | 33283446 | 33283446 | single base substitution | G | C | synonymous_variant | L416L | 1248C>G | BRCA-US | 6 | 33283626 | 33283626 | single base substitution | G | A | downstream_gene_variant | | | BRCA-US | 6 | 33283626 | 33283626 | single base substitution | G | A | synonymous_variant | L356L | 1068C>T | BRCA-US | 6 | 33284027 | 33284027 | single base substitution | C | T | downstream_gene_variant | | | BRCA-US | 6 | 33284027 | 33284027 | single base substitution | C | T | missense_variant | E223K | 667G>A | BRCA-US | 6 | 33284490 | 33284490 | single base substitution | G | A | synonymous_variant | F68F | 204C>T | BRCA-US | 6 | 33284663 | 33284663 | deletion of <=200bp | C | - | frameshift_variant | A11 | | BRCA-US | 6 | 33286558 | 33286558 | single base substitution | C | T | upstream_gene_variant | | | BRCA-US | 6 | 33288193 | 33288193 | single base substitution | A | G | upstream_gene_variant | | | BRCA-US | 6 | 33288266 | 33288266 | single base substitution | A | C | upstream_gene_variant | | | BTCA-JP | 6 | 33281053 | 33281053 | single base substitution | C | T | downstream_gene_variant | | | BTCA-JP | 6 | 33281689 | 33281689 | single base substitution | C | A | downstream_gene_variant | | | BTCA-JP | 6 | 33281755 | 33281755 | deletion of <=200bp | G | - | downstream_gene_variant | | | BTCA-JP | 6 | 33284713 | 33284713 | deletion of <=200bp | C | - | 5_prime_UTR_variant | | | BTCA-JP | 6 | 33287052 | 33287052 | single base substitution | G | A | upstream_gene_variant | | | BTCA-JP | 6 | 33289155 | 33289155 | single base substitution | C | T | upstream_gene_variant | | | BTCA-JP | 6 | 33289393 | 33289393 | single base substitution | G | A | upstream_gene_variant | | | CESC-US | 6 | 33281019 | 33281019 | single base substitution | C | A | downstream_gene_variant | | | CESC-US | 6 | 33281142 | 33281142 | single base substitution | G | A | downstream_gene_variant | | | CESC-US | 6 | 33281175 | 33281175 | single base substitution | G | C | downstream_gene_variant | | | CESC-US | 6 | 33283917 | 33283917 | single base substitution | C | T | downstream_gene_variant | | | CESC-US | 6 | 33283917 | 33283917 | single base substitution | C | T | synonymous_variant | L259L | 777G>A | CESC-US | 6 | 33284082 | 33284082 | single base substitution | G | A | downstream_gene_variant | | | CESC-US | 6 | 33284082 | 33284082 | single base substitution | G | A | synonymous_variant | S204S | 612C>T | CESC-US | 6 | 33286832 | 33286832 | single base substitution | G | A | upstream_gene_variant | | | CESC-US | 6 | 33288313 | 33288313 | single base substitution | C | G | upstream_gene_variant | | | CESC-US | 6 | 33289038 | 33289038 | single base substitution | C | T | upstream_gene_variant | | | COAD-US | 6 | 33283467 | 33283467 | deletion of <=200bp | G | - | downstream_gene_variant | | | COAD-US | 6 | 33283467 | 33283467 | deletion of <=200bp | G | - | frameshift_variant | P409 | | COAD-US | 6 | 33283594 | 33283594 | single base substitution | G | A | downstream_gene_variant | | | COAD-US | 6 | 33283594 | 33283594 | single base substitution | G | A | missense_variant | P367L | 1100C>T | COAD-US | 6 | 33283645 | 33283645 | deletion of <=200bp | C | - | downstream_gene_variant | | | COAD-US | 6 | 33283645 | 33283645 | deletion of <=200bp | C | - | frameshift_variant | G350 | | COAD-US | 6 | 33283669 | 33283669 | deletion of <=200bp | C | - | downstream_gene_variant | | | COAD-US | 6 | 33283669 | 33283669 | deletion of <=200bp | C | - | frameshift_variant | G342 | | COAD-US | 6 | 33283766 | 33283766 | single base substitution | T | C | downstream_gene_variant | | | COAD-US | 6 | 33283766 | 33283766 | single base substitution | T | C | missense_variant | T310A | 928A>G | COAD-US | 6 | 33283914 | 33283914 | single base substitution | C | A | downstream_gene_variant | | | COAD-US | 6 | 33283914 | 33283914 | single base substitution | C | A | missense_variant | E260D | 780G>T | COAD-US | 6 | 33284126 | 33284126 | single base substitution | G | A | downstream_gene_variant | | | COAD-US | 6 | 33284126 | 33284126 | single base substitution | G | A | missense_variant | R190C | 568C>T | COAD-US | 6 | 33284128 | 33284128 | single base substitution | G | A | downstream_gene_variant | | | COAD-US | 6 | 33284128 | 33284128 | single base substitution | G | A | missense_variant | A189V | 566C>T | COAD-US | 6 | 33284168 | 33284168 | single base substitution | C | T | downstream_gene_variant | | | COAD-US | 6 | 33284168 | 33284168 | single base substitution | C | T | missense_variant | G176R | 526G>A | COAD-US | 6 | 33284426 | 33284426 | single base substitution | C | A | missense_variant | G90C | 268G>T | COAD-US | 6 | 33284713 | 33284713 | deletion of <=200bp | C | - | 5_prime_UTR_variant | | | COAD-US | 6 | 33286533 | 33286533 | single base substitution | G | C | upstream_gene_variant | | | COAD-US | 6 | 33286921 | 33286921 | single base substitution | G | A | upstream_gene_variant | | | COAD-US | 6 | 33287212 | 33287212 | insertion of <=200bp | - | G | upstream_gene_variant | | | COAD-US | 6 | 33287213 | 33287213 | deletion of <=200bp | G | - | upstream_gene_variant | | | COAD-US | 6 | 33289568 | 33289568 | single base substitution | A | G | upstream_gene_variant | | | COAD-US | 6 | 33289661 | 33289661 | single base substitution | G | A | upstream_gene_variant | | | COAD-US | 6 | 33289694 | 33289694 | single base substitution | G | A | upstream_gene_variant | | | COAD-US | 6 | 33289695 | 33289695 | single base substitution | G | A | upstream_gene_variant | | | COCA-CN | 6 | 33282628 | 33282628 | single base substitution | C | T | 3_prime_UTR_variant | | | COCA-CN | 6 | 33282628 | 33282628 | single base substitution | C | T | downstream_gene_variant | | | COCA-CN | 6 | 33283741 | 33283741 | single base substitution | T | G | downstream_gene_variant | | | COCA-CN | 6 | 33283741 | 33283741 | single base substitution | T | G | missense_variant | D318A | 953A>C | COCA-CN | 6 | 33283766 | 33283766 | single base substitution | T | C | downstream_gene_variant | | | COCA-CN | 6 | 33283766 | 33283766 | single base substitution | T | C | missense_variant | T310A | 928A>G | COCA-CN | 6 | 33284127 | 33284127 | single base substitution | C | T | downstream_gene_variant | | | COCA-CN | 6 | 33284127 | 33284127 | single base substitution | C | T | synonymous_variant | A189A | 567G>A | COCA-CN | 6 | 33284479 | 33284479 | single base substitution | C | T | missense_variant | R72Q | 215G>A | COCA-CN | 6 | 33287291 | 33287291 | single base substitution | C | A | upstream_gene_variant | | | COCA-CN | 6 | 33289271 | 33289271 | single base substitution | C | T | upstream_gene_variant | | | COCA-CN | 6 | 33290547 | 33290547 | single base substitution | T | A | upstream_gene_variant | | | ESAD-UK | 6 | 33279172 | 33279172 | single base substitution | G | T | downstream_gene_variant | | | ESAD-UK | 6 | 33282300 | 33282300 | single base substitution | T | C | 3_prime_UTR_variant | | | ESAD-UK | 6 | 33282300 | 33282300 | single base substitution | T | C | downstream_gene_variant | | | ESAD-UK | 6 | 33285960 | 33285960 | single base substitution | G | A | upstream_gene_variant | | | ESAD-UK | 6 | 33287111 | 33287111 | single base substitution | T | C | upstream_gene_variant | | | ESAD-UK | 6 | 33288080 | 33288080 | single base substitution | A | T | upstream_gene_variant | | | ESAD-UK | 6 | 33288774 | 33288774 | single base substitution | G | A | upstream_gene_variant | | | ESAD-UK | 6 | 33289942 | 33289942 | single base substitution | C | A | upstream_gene_variant | | | ESCA-CN | 6 | 33288296 | 33288296 | single base substitution | C | T | upstream_gene_variant | | | ESCA-CN | 6 | 33289288 | 33289288 | single base substitution | G | C | upstream_gene_variant | | | GBM-US | 6 | 33286946 | 33286946 | single base substitution | C | A | upstream_gene_variant | | | GBM-US | 6 | 33287338 | 33287338 | single base substitution | A | G | upstream_gene_variant | | | GBM-US | 6 | 33289539 | 33289539 | single base substitution | C | T | upstream_gene_variant | | | KIRC-US | 6 | 33283534 | 33283534 | single base substitution | T | A | downstream_gene_variant | | | KIRC-US | 6 | 33283534 | 33283534 | single base substitution | T | A | missense_variant | Y387F | 1160A>T | KIRC-US | 6 | 33286892 | 33286892 | single base substitution | G | C | upstream_gene_variant | | | KIRC-US | 6 | 33287883 | 33287883 | single base substitution | T | A | upstream_gene_variant | | | KIRC-US | 6 | 33288852 | 33288852 | single base substitution | G | A | upstream_gene_variant | | | KIRC-US | 6 | 33289504 | 33289504 | single base substitution | A | T | upstream_gene_variant | | | KIRP-US | 6 | 33284267 | 33284267 | single base substitution | A | G | missense_variant | C143R | 427T>C | KIRP-US | 6 | 33284668 | 33284668 | single base substitution | C | T | missense_variant | S9N | 26G>A | KIRP-US | 6 | 33287821 | 33287821 | insertion of <=200bp | - | A | upstream_gene_variant | | | LAML-CN | 6 | 33281045 | 33281045 | single base substitution | G | T | downstream_gene_variant | | | LAML-CN | 6 | 33289630 | 33289630 | single base substitution | A | G | upstream_gene_variant | | | LAML-KR | 6 | 33278820 | 33278820 | single base substitution | G | A | downstream_gene_variant | | | LGG-US | 6 | 33287900 | 33287900 | single base substitution | C | T | upstream_gene_variant | | | LICA-CN | 6 | 33282947 | 33282947 | single base substitution | C | A | downstream_gene_variant | | | LICA-CN | 6 | 33282947 | 33282947 | single base substitution | C | A | missense_variant | G583W | 1747G>T | LICA-CN | 6 | 33284631 | 33284631 | single base substitution | C | A | synonymous_variant | P21P | 63G>T | LICA-FR | 6 | 33281488 | 33281488 | single base substitution | A | C | downstream_gene_variant | | | LICA-FR | 6 | 33283241 | 33283241 | single base substitution | T | A | downstream_gene_variant | | | LICA-FR | 6 | 33283241 | 33283241 | single base substitution | T | A | missense_variant | I485F | 1453A>T | LICA-FR | 6 | 33283648 | 33283648 | single base substitution | C | T | downstream_gene_variant | | | LICA-FR | 6 | 33283648 | 33283648 | single base substitution | C | T | missense_variant | G349E | 1046G>A | LICA-FR | 6 | 33288003 | 33288003 | single base substitution | T | C | upstream_gene_variant | | | LICA-FR | 6 | 33288680 | 33288680 | single base substitution | C | A | upstream_gene_variant | | | LINC-JP | 6 | 33282771 | 33282771 | single base substitution | C | G | 3_prime_UTR_variant | | | LINC-JP | 6 | 33282771 | 33282771 | single base substitution | C | G | downstream_gene_variant | | | LINC-JP | 6 | 33282956 | 33282956 | single base substitution | T | C | downstream_gene_variant | | | LINC-JP | 6 | 33282956 | 33282956 | single base substitution | T | C | missense_variant | T580A | 1738A>G | LINC-JP | 6 | 33284783 | 33284783 | single base substitution | G | T | intron_variant | | | LINC-JP | 6 | 33285983 | 33285983 | deletion of <=200bp | A | - | upstream_gene_variant | | | LINC-JP | 6 | 33287912 | 33287912 | single base substitution | C | T | upstream_gene_variant | | | LIRI-JP | 6 | 33277689 | 33277689 | single base substitution | C | T | downstream_gene_variant | | | LIRI-JP | 6 | 33278721 | 33278721 | single base substitution | G | A | downstream_gene_variant | | | LIRI-JP | 6 | 33281589 | 33281598 | deletion of <=200bp | CACGAACCAA | - | downstream_gene_variant | | | LIRI-JP | 6 | 33282921 | 33282922 | deletion of <=200bp | CT | - | downstream_gene_variant | | | LIRI-JP | 6 | 33282921 | 33282922 | deletion of <=200bp | CT | - | frameshift_variant | E591 | | LIRI-JP | 6 | 33283558 | 33283558 | single base substitution | T | C | downstream_gene_variant | | | LIRI-JP | 6 | 33283558 | 33283558 | single base substitution | T | C | missense_variant | E379G | 1136A>G | LIRI-JP | 6 | 33286285 | 33286285 | single base substitution | G | A | upstream_gene_variant | | | LIRI-JP | 6 | 33286298 | 33286298 | single base substitution | A | T | upstream_gene_variant | | | LIRI-JP | 6 | 33288400 | 33288400 | single base substitution | A | G | upstream_gene_variant | | | LIRI-JP | 6 | 33289329 | 33289329 | single base substitution | T | C | upstream_gene_variant | | | LUSC-KR | 6 | 33280968 | 33280968 | single base substitution | C | T | downstream_gene_variant | | | LUSC-KR | 6 | 33285001 | 33285001 | single base substitution | C | A | intron_variant | | | LUSC-US | 6 | 33281012 | 33281012 | single base substitution | G | C | downstream_gene_variant | | | LUSC-US | 6 | 33281611 | 33281611 | single base substitution | G | C | downstream_gene_variant | | | LUSC-US | 6 | 33281789 | 33281789 | single base substitution | C | A | downstream_gene_variant | | | LUSC-US | 6 | 33284035 | 33284035 | single base substitution | G | T | downstream_gene_variant | | | LUSC-US | 6 | 33284035 | 33284035 | single base substitution | G | T | missense_variant | S220Y | 659C>A | LUSC-US | 6 | 33288240 | 33288240 | single base substitution | C | T | upstream_gene_variant | | | LUSC-US | 6 | 33288803 | 33288803 | single base substitution | C | T | upstream_gene_variant | | | LUSC-US | 6 | 33289247 | 33289247 | single base substitution | G | A | upstream_gene_variant | | | MALY-DE | 6 | 33279504 | 33279504 | single base substitution | G | T | downstream_gene_variant | | | MALY-DE | 6 | 33281347 | 33281347 | single base substitution | C | T | downstream_gene_variant | | | MALY-DE | 6 | 33281348 | 33281348 | single base substitution | C | G | downstream_gene_variant | | | MELA-AU | 6 | 33277487 | 33277487 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33278523 | 33278523 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33279012 | 33279012 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33279087 | 33279087 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33279131 | 33279131 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33279330 | 33279331 | multiple base substitution (>=2bp and <=200bp) | GG | AA | downstream_gene_variant | | | MELA-AU | 6 | 33280085 | 33280085 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33280374 | 33280374 | single base substitution | C | T | downstream_gene_variant | | | MELA-AU | 6 | 33281247 | 33281247 | single base substitution | C | T | downstream_gene_variant | | | MELA-AU | 6 | 33281348 | 33281348 | single base substitution | C | T | downstream_gene_variant | | | MELA-AU | 6 | 33281723 | 33281723 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33282387 | 33282387 | single base substitution | A | G | 3_prime_UTR_variant | | | MELA-AU | 6 | 33282387 | 33282387 | single base substitution | A | G | downstream_gene_variant | | | MELA-AU | 6 | 33282392 | 33282392 | single base substitution | G | A | 3_prime_UTR_variant | | | MELA-AU | 6 | 33282392 | 33282392 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33282930 | 33282930 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33282930 | 33282930 | single base substitution | G | A | synonymous_variant | S588S | 1764C>T | MELA-AU | 6 | 33283015 | 33283015 | single base substitution | C | T | downstream_gene_variant | | | MELA-AU | 6 | 33283015 | 33283015 | single base substitution | C | T | missense_variant | R560Q | 1679G>A | MELA-AU | 6 | 33283339 | 33283339 | single base substitution | C | T | downstream_gene_variant | | | MELA-AU | 6 | 33283339 | 33283339 | single base substitution | C | T | missense_variant | G452E | 1355G>A | MELA-AU | 6 | 33283655 | 33283655 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33283655 | 33283655 | single base substitution | G | A | missense_variant | P347S | 1039C>T | MELA-AU | 6 | 33283968 | 33283968 | single base substitution | G | A | downstream_gene_variant | | | MELA-AU | 6 | 33283968 | 33283968 | single base substitution | G | A | synonymous_variant | F242F | 726C>T | MELA-AU | 6 | 33285116 | 33285117 | multiple base substitution (>=2bp and <=200bp) | GG | AA | intron_variant | | | MELA-AU | 6 | 33285156 | 33285156 | single base substitution | C | T | intron_variant | | | MELA-AU | 6 | 33286733 | 33286733 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33286904 | 33286904 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33287070 | 33287070 | single base substitution | C | T | upstream_gene_variant | | | MELA-AU | 6 | 33287200 | 33287200 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33287635 | 33287635 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33287642 | 33287642 | single base substitution | A | C | upstream_gene_variant | | | MELA-AU | 6 | 33287676 | 33287676 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33287706 | 33287706 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33288028 | 33288028 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33288119 | 33288119 | single base substitution | A | C | upstream_gene_variant | | | MELA-AU | 6 | 33288175 | 33288175 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33288412 | 33288412 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33288743 | 33288743 | single base substitution | C | T | upstream_gene_variant | | | MELA-AU | 6 | 33288918 | 33288918 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33289089 | 33289089 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33289205 | 33289205 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33289228 | 33289228 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33289352 | 33289352 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33289386 | 33289386 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33289386 | 33289387 | multiple base substitution (>=2bp and <=200bp) | GG | AA | upstream_gene_variant | | | MELA-AU | 6 | 33289724 | 33289724 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33290217 | 33290217 | single base substitution | G | A | upstream_gene_variant | | | MELA-AU | 6 | 33290550 | 33290550 | single base substitution | C | T | upstream_gene_variant | | | ORCA-IN | 6 | 33280999 | 33280999 | single base substitution | G | T | downstream_gene_variant | | | ORCA-IN | 6 | 33281285 | 33281285 | single base substitution | G | C | downstream_gene_variant | | | ORCA-IN | 6 | 33281479 | 33281479 | single base substitution | C | A | downstream_gene_variant | | | ORCA-IN | 6 | 33281490 | 33281490 | single base substitution | C | A | downstream_gene_variant | | | ORCA-IN | 6 | 33287170 | 33287170 | single base substitution | G | T | upstream_gene_variant | | | ORCA-IN | 6 | 33288556 | 33288556 | single base substitution | G | C | upstream_gene_variant | | | ORCA-IN | 6 | 33289278 | 33289278 | single base substitution | G | A | upstream_gene_variant | | | OV-AU | 6 | 33281506 | 33281506 | single base substitution | G | C | downstream_gene_variant | | | OV-AU | 6 | 33281641 | 33281687 | deletion of <=200bp | CCTGGCGTATAGGGACGCGAGTGAGGAGCGGTTTGTATGTCTGGTGA | - | downstream_gene_variant | | | OV-AU | 6 | 33282345 | 33282345 | single base substitution | T | G | 3_prime_UTR_variant | | | OV-AU | 6 | 33282345 | 33282345 | single base substitution | T | G | downstream_gene_variant | | | OV-AU | 6 | 33288949 | 33288949 | single base substitution | C | T | upstream_gene_variant | | | OV-US | 6 | 33284546 | 33284546 | single base substitution | G | A | stop_gained | Q50* | 148C>T | PACA-AU | 6 | 33281332 | 33281332 | single base substitution | C | A | downstream_gene_variant | | | PACA-AU | 6 | 33286743 | 33286743 | single base substitution | T | A | upstream_gene_variant | | | PACA-AU | 6 | 33288380 | 33288380 | single base substitution | G | C | upstream_gene_variant | | | PACA-AU | 6 | 33289094 | 33289094 | single base substitution | T | C | upstream_gene_variant | | | PAEN-AU | 6 | 33287462 | 33287466 | deletion of <=200bp | AGCAT | - | upstream_gene_variant | | | PAEN-AU | 6 | 33287842 | 33287842 | single base substitution | G | A | upstream_gene_variant | | | PAEN-AU | 6 | 33288152 | 33288152 | single base substitution | C | T | upstream_gene_variant | | | PAEN-AU | 6 | 33288561 | 33288561 | single base substitution | C | A | upstream_gene_variant | | | PAEN-AU | 6 | 33288690 | 33288693 | deletion of <=200bp | CCCC | - | upstream_gene_variant | | | PAEN-AU | 6 | 33289345 | 33289345 | single base substitution | C | T | upstream_gene_variant | | | PAEN-IT | 6 | 33288561 | 33288561 | single base substitution | C | A | upstream_gene_variant | | | PAEN-IT | 6 | 33288570 | 33288570 | single base substitution | G | A | upstream_gene_variant | | | PAEN-IT | 6 | 33288573 | 33288573 | single base substitution | G | A | upstream_gene_variant | | | PAEN-IT | 6 | 33289139 | 33289139 | single base substitution | G | C | upstream_gene_variant | | | PAEN-IT | 6 | 33289242 | 33289242 | single base substitution | C | A | upstream_gene_variant | | | PBCA-DE | 6 | 33288158 | 33288158 | single base substitution | T | C | upstream_gene_variant | | | PRAD-US | 6 | 33283001 | 33283001 | single base substitution | G | A | downstream_gene_variant | | | PRAD-US | 6 | 33283001 | 33283001 | single base substitution | G | A | missense_variant | R565C | 1693C>T | PRAD-US | 6 | 33284252 | 33284252 | single base substitution | G | A | stop_gained | R148* | 442C>T | PRAD-US | 6 | 33287278 | 33287278 | single base substitution | T | C | upstream_gene_variant | | | PRAD-US | 6 | 33287900 | 33287900 | single base substitution | C | T | upstream_gene_variant | | | READ-US | 6 | 33284470 | 33284470 | single base substitution | A | G | missense_variant | L75P | 224T>C | READ-US | 6 | 33289660 | 33289660 | single base substitution | C | T | upstream_gene_variant | | | RECA-EU | 6 | 33289830 | 33289830 | single base substitution | C | T | upstream_gene_variant | | | SKCA-BR | 6 | 33279344 | 33279344 | single base substitution | C | T | downstream_gene_variant | | | SKCA-BR | 6 | 33281577 | 33281577 | single base substitution | G | A | downstream_gene_variant | | | SKCA-BR | 6 | 33282080 | 33282080 | single base substitution | G | C | downstream_gene_variant | | | SKCA-BR | 6 | 33282181 | 33282181 | single base substitution | A | G | downstream_gene_variant | | | SKCA-BR | 6 | 33284655 | 33284655 | single base substitution | A | G | synonymous_variant | L13L | 39T>C | SKCA-BR | 6 | 33284667 | 33284667 | single base substitution | A | C | missense_variant | S9R | 27T>G | SKCA-BR | 6 | 33284669 | 33284669 | single base substitution | T | G | missense_variant | S9R | 25A>C | SKCA-BR | 6 | 33284673 | 33284673 | single base substitution | A | G | synonymous_variant | S7S | 21T>C | SKCA-BR | 6 | 33284712 | 33284712 | single base substitution | A | C | 5_prime_UTR_variant | | | SKCM-US | 6 | 33281164 | 33281164 | single base substitution | G | A | downstream_gene_variant | | | SKCM-US | 6 | 33281529 | 33281529 | single base substitution | T | G | downstream_gene_variant | | | SKCM-US | 6 | 33283159 | 33283159 | single base substitution | G | A | downstream_gene_variant | | | SKCM-US | 6 | 33283159 | 33283159 | single base substitution | G | A | missense_variant | P512L | 1535C>T | SKCM-US | 6 | 33283250 | 33283250 | single base substitution | C | T | downstream_gene_variant | | | SKCM-US | 6 | 33283250 | 33283250 | single base substitution | C | T | missense_variant | G482R | 1444G>A | SKCM-US | 6 | 33283416 | 33283416 | single base substitution | G | A | downstream_gene_variant | | | SKCM-US | 6 | 33283416 | 33283416 | single base substitution | G | A | synonymous_variant | I426I | 1278C>T | SKCM-US | 6 | 33283441 | 33283441 | single base substitution | G | A | downstream_gene_variant | | | SKCM-US | 6 | 33283441 | 33283441 | single base substitution | G | A | missense_variant | P418L | 1253C>T | SKCM-US | 6 | 33283465 | 33283465 | single base substitution | G | C | downstream_gene_variant | | | SKCM-US | 6 | 33283465 | 33283465 | single base substitution | G | C | missense_variant | S410C | 1229C>G | SKCM-US | 6 | 33283477 | 33283477 | single base substitution | G | A | downstream_gene_variant | | | SKCM-US | 6 | 33283477 | 33283477 | single base substitution | G | A | missense_variant | S406F | 1217C>T | SKCM-US | 6 | 33283498 | 33283498 | single base substitution | G | A | downstream_gene_variant | | | SKCM-US | 6 | 33283498 | 33283498 | single base substitution | G | A | missense_variant | S399L | 1196C>T | SKCM-US | 6 | 33284312 | 33284312 | single base substitution | G | A | missense_variant | L128F | 382C>T | SKCM-US | 6 | 33284313 | 33284313 | single base substitution | G | A | synonymous_variant | F127F | 381C>T | SKCM-US | 6 | 33284382 | 33284382 | single base substitution | G | A | synonymous_variant | A104A | 312C>T | SKCM-US | 6 | 33284485 | 33284485 | single base substitution | G | A | missense_variant | A70V | 209C>T | SKCM-US | 6 | 33284653 | 33284653 | single base substitution | G | A | missense_variant | P14L | 41C>T | SKCM-US | 6 | 33286918 | 33286918 | single base substitution | C | T | upstream_gene_variant | | | SKCM-US | 6 | 33287363 | 33287363 | single base substitution | G | T | upstream_gene_variant | | | SKCM-US | 6 | 33287412 | 33287412 | single base substitution | G | A | upstream_gene_variant | | | SKCM-US | 6 | 33287991 | 33287991 | single base substitution | C | T | upstream_gene_variant | | | SKCM-US | 6 | 33288175 | 33288175 | single base substitution | G | A | upstream_gene_variant | | | SKCM-US | 6 | 33288188 | 33288188 | single base substitution | T | A | upstream_gene_variant | | | SKCM-US | 6 | 33288714 | 33288714 | single base substitution | G | A | upstream_gene_variant | | | SKCM-US | 6 | 33289089 | 33289089 | single base substitution | G | A | upstream_gene_variant | | | SKCM-US | 6 | 33289292 | 33289292 | single base substitution | A | T | upstream_gene_variant | | | SKCM-US | 6 | 33289581 | 33289581 | single base substitution | G | A | upstream_gene_variant | | | STAD-US | 6 | 33281127 | 33281127 | single base substitution | C | T | downstream_gene_variant | | | STAD-US | 6 | 33281220 | 33281220 | single base substitution | C | G | downstream_gene_variant | | | STAD-US | 6 | 33281536 | 33281536 | single base substitution | C | T | downstream_gene_variant | | | STAD-US | 6 | 33281604 | 33281604 | single base substitution | G | A | downstream_gene_variant | | | STAD-US | 6 | 33283022 | 33283022 | single base substitution | G | A | downstream_gene_variant | | | STAD-US | 6 | 33283022 | 33283022 | single base substitution | G | A | missense_variant | R558C | 1672C>T | STAD-US | 6 | 33283621 | 33283621 | single base substitution | A | G | downstream_gene_variant | | | STAD-US | 6 | 33283621 | 33283621 | single base substitution | A | G | missense_variant | I358T | 1073T>C | STAD-US | 6 | 33283797 | 33283797 | single base substitution | G | A | downstream_gene_variant | | | STAD-US | 6 | 33283797 | 33283797 | single base substitution | G | A | synonymous_variant | Y299Y | 897C>T | STAD-US | 6 | 33287482 | 33287482 | single base substitution | C | G | upstream_gene_variant | | | STAD-US | 6 | 33287513 | 33287513 | single base substitution | C | T | upstream_gene_variant | | | STAD-US | 6 | 33287518 | 33287518 | single base substitution | T | C | upstream_gene_variant | | | STAD-US | 6 | 33287520 | 33287520 | single base substitution | C | T | upstream_gene_variant | | | STAD-US | 6 | 33287839 | 33287839 | single base substitution | C | T | upstream_gene_variant | | | STAD-US | 6 | 33287897 | 33287897 | single base substitution | T | C | upstream_gene_variant | | | STAD-US | 6 | 33287900 | 33287900 | single base substitution | C | T | upstream_gene_variant | | | STAD-US | 6 | 33288217 | 33288217 | single base substitution | C | T | upstream_gene_variant | | | STAD-US | 6 | 33288600 | 33288600 | single base substitution | G | A | upstream_gene_variant | | | STAD-US | 6 | 33288764 | 33288764 | single base substitution | C | T | upstream_gene_variant | | | STAD-US | 6 | 33288785 | 33288785 | single base substitution | C | T | upstream_gene_variant | | | STAD-US | 6 | 33288840 | 33288840 | single base substitution | G | A | upstream_gene_variant | | | STAD-US | 6 | 33289197 | 33289197 | single base substitution | G | A | upstream_gene_variant | | | STAD-US | 6 | 33289268 | 33289268 | single base substitution | G | A | upstream_gene_variant | | | STAD-US | 6 | 33289522 | 33289522 | single base substitution | G | A | upstream_gene_variant | | | THCA-US | 6 | 33281527 | 33281527 | single base substitution | G | A | downstream_gene_variant | | | THCA-US | 6 | 33282984 | 33282984 | single base substitution | G | A | downstream_gene_variant | | | THCA-US | 6 | 33282984 | 33282984 | single base substitution | G | A | synonymous_variant | G570G | 1710C>T | THCA-US | 6 | 33283595 | 33283595 | single base substitution | G | A | downstream_gene_variant | | | THCA-US | 6 | 33283595 | 33283595 | single base substitution | G | A | missense_variant | P367S | 1099C>T | THCA-US | 6 | 33283609 | 33283609 | single base substitution | C | T | downstream_gene_variant | | | THCA-US | 6 | 33283609 | 33283609 | single base substitution | C | T | missense_variant | R362H | 1085G>A | THCA-US | 6 | 33283858 | 33283858 | single base substitution | G | T | downstream_gene_variant | | | THCA-US | 6 | 33283858 | 33283858 | single base substitution | G | T | missense_variant | A279D | 836C>A | UCEC-US | 6 | 33283117 | 33283117 | single base substitution | T | C | downstream_gene_variant | | | UCEC-US | 6 | 33283117 | 33283117 | single base substitution | T | C | missense_variant | H526R | 1577A>G | UCEC-US | 6 | 33283190 | 33283190 | single base substitution | G | A | downstream_gene_variant | | | UCEC-US | 6 | 33283190 | 33283190 | single base substitution | G | A | missense_variant | R502W | 1504C>T | UCEC-US | 6 | 33283317 | 33283317 | single base substitution | C | T | downstream_gene_variant | | | UCEC-US | 6 | 33283317 | 33283317 | single base substitution | C | T | synonymous_variant | T459T | 1377G>A | UCEC-US | 6 | 33284347 | 33284347 | single base substitution | C | T | missense_variant | R116H | 347G>A | UCEC-US | 6 | 33284384 | 33284384 | single base substitution | C | T | missense_variant | A104T | 310G>A | UCEC-US | 6 | 33287248 | 33287248 | single base substitution | C | T | upstream_gene_variant | | | UCEC-US | 6 | 33287597 | 33287597 | single base substitution | T | C | upstream_gene_variant | | | UCEC-US | 6 | 33287875 | 33287875 | single base substitution | C | A | upstream_gene_variant | | | UCEC-US | 6 | 33287888 | 33287888 | single base substitution | C | A | upstream_gene_variant | | | UCEC-US | 6 | 33287935 | 33287935 | single base substitution | C | T | upstream_gene_variant | | | UCEC-US | 6 | 33287938 | 33287938 | single base substitution | C | A | upstream_gene_variant | | | UCEC-US | 6 | 33288597 | 33288597 | single base substitution | C | T | upstream_gene_variant | | | UCEC-US | 6 | 33288949 | 33288949 | single base substitution | C | A | upstream_gene_variant | | | UCEC-US | 6 | 33289266 | 33289266 | single base substitution | G | A | upstream_gene_variant | | | UCEC-US | 6 | 33289535 | 33289535 | single base substitution | C | A | upstream_gene_variant | | | UCEC-US | 6 | 33290653 | 33290653 | single base substitution | C | A | upstream_gene_variant | | | |