Mutation - ICGC Project Code Chromosome Chromosome Start Chromosome End Mutation Type Mutated from Allele Mutated to Allele Consequence Type AA Mutation CDS Mutation BLCA-CN 19 36227852 36227852 single base substitution G A missense_variant R2446Q 7337G>A BLCA-CN 19 36231325 36231325 single base substitution T G downstream_gene_variant BLCA-US 19 36205902 36205902 single base substitution A C upstream_gene_variant BLCA-US 19 36206116 36206116 single base substitution C T upstream_gene_variant BLCA-US 19 36206379 36206379 single base substitution G A upstream_gene_variant BLCA-US 19 36216719 36216719 single base substitution G A downstream_gene_variant BLCA-US 19 36216719 36216719 single base substitution G A stop_gained W1295* 3885G>A BLCA-US 19 36218436 36218436 single base substitution G C synonymous_variant L1405L 4215G>C BLCA-US 19 36219890 36219890 single base substitution C T synonymous_variant F1564F 4692C>T BLCA-US 19 36230880 36230880 single base substitution T C downstream_gene_variant BLCA-US 19 36230990 36230990 single base substitution C T downstream_gene_variant BLCA-US 19 36231306 36231306 single base substitution C T downstream_gene_variant BLCA-US 19 36233667 36233667 single base substitution C G downstream_gene_variant BOCA-FR 19 36207439 36207439 single base substitution A G upstream_gene_variant BRCA-EU 19 36205778 36205778 single base substitution G C upstream_gene_variant BRCA-EU 19 36205827 36205827 single base substitution T G upstream_gene_variant BRCA-EU 19 36206571 36206571 deletion of <=200bp G - upstream_gene_variant BRCA-EU 19 36209615 36209615 single base substitution G C intron_variant BRCA-EU 19 36210654 36210654 single base substitution G A intron_variant BRCA-EU 19 36211361 36211361 single base substitution A T missense_variant E371V 1112A>T BRCA-EU 19 36212835 36212835 single base substitution G A downstream_gene_variant BRCA-EU 19 36212835 36212835 single base substitution G A intron_variant BRCA-EU 19 36214054 36214054 single base substitution G C downstream_gene_variant BRCA-EU 19 36214054 36214054 single base substitution G C missense_variant K960N 2880G>C BRCA-EU 19 36214347 36214347 single base substitution A C downstream_gene_variant BRCA-EU 19 36214347 36214347 single base substitution A C splice_acceptor_variant BRCA-EU 19 36214851 36214851 single base substitution G A downstream_gene_variant BRCA-EU 19 36214851 36214851 single base substitution G A missense_variant D1093N 3277G>A BRCA-EU 19 36214937 36214937 single base substitution G C downstream_gene_variant BRCA-EU 19 36214937 36214937 single base substitution G C intron_variant BRCA-EU 19 36215024 36215024 single base substitution G A downstream_gene_variant BRCA-EU 19 36215024 36215024 single base substitution G A intron_variant BRCA-EU 19 36215054 36215054 single base substitution G A downstream_gene_variant BRCA-EU 19 36215054 36215054 single base substitution G A intron_variant BRCA-EU 19 36215086 36215086 single base substitution G A downstream_gene_variant BRCA-EU 19 36215086 36215086 single base substitution G A intron_variant BRCA-EU 19 36215162 36215162 single base substitution G A downstream_gene_variant BRCA-EU 19 36215162 36215162 single base substitution G A intron_variant BRCA-EU 19 36215177 36215177 single base substitution G A downstream_gene_variant BRCA-EU 19 36215177 36215177 single base substitution G A intron_variant BRCA-EU 19 36215292 36215292 single base substitution A G downstream_gene_variant BRCA-EU 19 36215292 36215292 single base substitution A G intron_variant BRCA-EU 19 36216769 36216769 single base substitution C T downstream_gene_variant BRCA-EU 19 36216769 36216769 single base substitution C T intron_variant BRCA-EU 19 36216900 36216900 single base substitution G C downstream_gene_variant BRCA-EU 19 36216900 36216900 single base substitution G C intron_variant BRCA-EU 19 36217226 36217226 insertion of <=200bp - C downstream_gene_variant BRCA-EU 19 36217226 36217226 insertion of <=200bp - C frameshift_variant C1325C? BRCA-EU 19 36217954 36217954 single base substitution G A intron_variant BRCA-EU 19 36218006 36218006 single base substitution G C intron_variant BRCA-EU 19 36218303 36218303 single base substitution G A intron_variant BRCA-EU 19 36218451 36218451 deletion of <=200bp G - frameshift_variant Q1410 BRCA-EU 19 36219318 36219318 single base substitution G A intron_variant BRCA-EU 19 36219947 36219947 single base substitution C A synonymous_variant L1583L 4749C>A BRCA-EU 19 36222610 36222610 single base substitution G A intron_variant BRCA-EU 19 36223002 36223002 deletion of <=200bp G - frameshift_variant L1877 BRCA-EU 19 36224645 36224645 single base substitution G C intron_variant BRCA-EU 19 36224861 36224861 single base substitution C T intron_variant BRCA-EU 19 36225782 36225782 single base substitution G C intron_variant BRCA-EU 19 36225815 36225815 single base substitution G T intron_variant BRCA-EU 19 36225943 36225943 single base substitution G A intron_variant BRCA-EU 19 36226189 36226189 single base substitution T C intron_variant BRCA-EU 19 36226903 36226903 single base substitution C T intron_variant BRCA-EU 19 36227883 36227883 single base substitution T C synonymous_variant F2456F 7368T>C BRCA-EU 19 36231505 36231505 single base substitution G T downstream_gene_variant BRCA-EU 19 36231597 36231597 single base substitution C G downstream_gene_variant BRCA-EU 19 36233106 36233106 single base substitution G A downstream_gene_variant BRCA-FR 19 36207760 36207760 single base substitution C T upstream_gene_variant BRCA-FR 19 36209615 36209615 single base substitution G C intron_variant BRCA-FR 19 36216900 36216900 single base substitution G C downstream_gene_variant BRCA-FR 19 36216900 36216900 single base substitution G C intron_variant BRCA-FR 19 36224645 36224645 single base substitution G C intron_variant BRCA-FR 19 36225943 36225943 single base substitution G A intron_variant BRCA-FR 19 36228365 36228365 single base substitution A G intron_variant BRCA-FR 19 36231597 36231597 single base substitution C G downstream_gene_variant BRCA-UK 19 36211214 36211214 single base substitution G C missense_variant G322A 965G>C BRCA-UK 19 36214780 36214780 single base substitution C T downstream_gene_variant BRCA-UK 19 36214780 36214780 single base substitution C T missense_variant S1069F 3206C>T BRCA-UK 19 36228000 36228000 single base substitution G A synonymous_variant A2462A 7386G>A BRCA-US 19 36205602 36205602 single base substitution G A upstream_gene_variant BRCA-US 19 36205635 36205635 single base substitution G A upstream_gene_variant BRCA-US 19 36207192 36207192 single base substitution C T upstream_gene_variant BRCA-US 19 36207599 36207599 single base substitution C G upstream_gene_variant BRCA-US 19 36210398 36210398 single base substitution G C missense_variant D131H 391G>C BRCA-US 19 36210764 36210764 deletion of <=200bp C - frameshift_variant T172 BRCA-US 19 36210803 36210803 single base substitution G A missense_variant G185D 554G>A BRCA-US 19 36211033 36211033 single base substitution C T stop_gained Q262* 784C>T BRCA-US 19 36211394 36211397 deletion of <=200bp AAGA - frameshift_variant EE382 BRCA-US 19 36211899 36211899 deletion of <=200bp C - frameshift_variant D550 BRCA-US 19 36211899 36211899 deletion of <=200bp C - intron_variant BRCA-US 19 36216136 36216136 single base substitution G A downstream_gene_variant BRCA-US 19 36216136 36216136 single base substitution G A missense_variant E1182K 3544G>A BRCA-US 19 36216490 36216490 single base substitution C T downstream_gene_variant BRCA-US 19 36216490 36216490 single base substitution C T synonymous_variant F1251F 3753C>T BRCA-US 19 36218387 36218387 insertion of <=200bp - G frameshift_variant T1389S? BRCA-US 19 36220093 36220093 single base substitution G T stop_gained E1605* 4813G>T BRCA-US 19 36220954 36220954 single base substitution G A synonymous_variant R1668R 5004G>A BRCA-US 19 36220993 36220993 single base substitution C A missense_variant F1681L 5043C>A BRCA-US 19 36224339 36224339 insertion of <=200bp - C frameshift_variant A2297R? BRCA-US 19 36224729 36224729 single base substitution G T missense_variant G2372V 7115G>T BRCA-US 19 36229011 36229011 deletion of <=200bp G - frameshift_variant A2597 BRCA-US 19 36229228 36229228 single base substitution G T missense_variant D2640Y 7918G>T BRCA-US 19 36230200 36230200 single base substitution G A downstream_gene_variant BTCA-JP 19 36206271 36206271 single base substitution C T upstream_gene_variant BTCA-JP 19 36210427 36210427 single base substitution G A synonymous_variant A140A 420G>A BTCA-JP 19 36210693 36210693 single base substitution G A synonymous_variant A148A 444G>A BTCA-JP 19 36210722 36210722 single base substitution C T missense_variant T158M 473C>T BTCA-JP 19 36211822 36211822 single base substitution C T missense_variant R525W 1573C>T BTCA-JP 19 36213330 36213330 single base substitution C T downstream_gene_variant BTCA-JP 19 36213330 36213330 single base substitution C T missense_variant R843W 2527C>T BTCA-JP 19 36213944 36213944 single base substitution C T downstream_gene_variant BTCA-JP 19 36213944 36213944 single base substitution C T missense_variant R924W 2770C>T BTCA-JP 19 36214714 36214714 deletion of <=200bp G - downstream_gene_variant BTCA-JP 19 36214714 36214714 deletion of <=200bp G - frameshift_variant R1047 BTCA-JP 19 36214821 36214821 single base substitution C T downstream_gene_variant BTCA-JP 19 36214821 36214821 single base substitution C T stop_gained R1083* 3247C>T BTCA-JP 19 36215495 36215495 single base substitution C T downstream_gene_variant BTCA-JP 19 36215495 36215495 single base substitution C T intron_variant BTCA-JP 19 36216184 36216184 deletion of <=200bp G - downstream_gene_variant BTCA-JP 19 36216184 36216184 deletion of <=200bp G - frameshift_variant G1198 BTCA-JP 19 36217121 36217121 single base substitution C T downstream_gene_variant BTCA-JP 19 36217121 36217121 single base substitution C T intron_variant BTCA-JP 19 36221242 36221242 single base substitution G A splice_acceptor_variant BTCA-JP 19 36221497 36221497 single base substitution G A synonymous_variant R1752R 5256G>A BTCA-JP 19 36223175 36223175 deletion of <=200bp C - frameshift_variant P1909 BTCA-JP 19 36224611 36224611 single base substitution T G intron_variant BTCA-JP 19 36229027 36229027 single base substitution G A missense_variant E2603K 7807G>A BTCA-JP 19 36229232 36229232 single base substitution C G missense_variant A2641G 7922C>G BTCA-JP 19 36230668 36230668 single base substitution C T downstream_gene_variant BTCA-JP 19 36230800 36230800 single base substitution T C downstream_gene_variant CESC-US 19 36211933 36211933 single base substitution G T intron_variant CESC-US 19 36211933 36211933 single base substitution G T missense_variant V562F 1684G>T CESC-US 19 36212558 36212558 single base substitution C T downstream_gene_variant CESC-US 19 36212558 36212558 single base substitution C T missense_variant P770L 2309C>T CESC-US 19 36217210 36217210 single base substitution G C downstream_gene_variant CESC-US 19 36217210 36217210 single base substitution G C missense_variant G1320A 3959G>C CESC-US 19 36220184 36220184 single base substitution G A missense_variant R1635Q 4904G>A CESC-US 19 36223347 36223347 single base substitution C T missense_variant S1966F 5897C>T CESC-US 19 36227608 36227608 single base substitution G A missense_variant E2393K 7177G>A CESC-US 19 36229363 36229363 single base substitution G C missense_variant E2685Q 8053G>C CESC-US 19 36231340 36231340 single base substitution C T downstream_gene_variant CLLE-ES 19 36206566 36206566 single base substitution C T upstream_gene_variant CLLE-ES 19 36208372 36208372 single base substitution C G upstream_gene_variant COAD-US 19 36205865 36205865 single base substitution C T upstream_gene_variant COAD-US 19 36206026 36206026 single base substitution C T upstream_gene_variant COAD-US 19 36206111 36206111 single base substitution C T upstream_gene_variant COAD-US 19 36207510 36207510 single base substitution G A upstream_gene_variant COAD-US 19 36210426 36210426 single base substitution C T missense_variant A140V 419C>T COAD-US 19 36210710 36210710 single base substitution G A missense_variant R154H 461G>A COAD-US 19 36210790 36210790 single base substitution C T missense_variant R181W 541C>T COAD-US 19 36211219 36211219 single base substitution G A missense_variant E324K 970G>A COAD-US 19 36211742 36211742 single base substitution C A missense_variant T498N 1493C>A COAD-US 19 36211898 36211898 insertion of <=200bp - C frameshift_variant D550A? COAD-US 19 36211898 36211898 insertion of <=200bp - C intron_variant COAD-US 19 36212050 36212050 single base substitution C T intron_variant COAD-US 19 36212050 36212050 single base substitution C T missense_variant R601W 1801C>T COAD-US 19 36212631 36212633 deletion of <=200bp CCT - downstream_gene_variant COAD-US 19 36212631 36212633 deletion of <=200bp CCT - inframe_deletion SL794S COAD-US 19 36213368 36213368 single base substitution G A downstream_gene_variant COAD-US 19 36213368 36213368 single base substitution G A synonymous_variant R855R 2565G>A COAD-US 19 36215577 36215577 single base substitution G A downstream_gene_variant COAD-US 19 36215577 36215577 single base substitution G A missense_variant R1125H 3374G>A COAD-US 19 36216701 36216701 single base substitution G A downstream_gene_variant COAD-US 19 36216701 36216701 single base substitution G A synonymous_variant T1289T 3867G>A COAD-US 19 36217196 36217196 single base substitution C T downstream_gene_variant COAD-US 19 36217196 36217196 single base substitution C T synonymous_variant D1315D 3945C>T COAD-US 19 36218093 36218093 single base substitution A G missense_variant D1347G 4040A>G COAD-US 19 36218100 36218100 single base substitution C T synonymous_variant D1349D 4047C>T COAD-US 19 36218128 36218128 single base substitution C T stop_gained Q1359* 4075C>T COAD-US 19 36218439 36218439 single base substitution C T synonymous_variant S1406S 4218C>T COAD-US 19 36218478 36218478 single base substitution C T synonymous_variant G1419G 4257C>T COAD-US 19 36218512 36218512 single base substitution C T missense_variant L1431F 4291C>T COAD-US 19 36219044 36219044 single base substitution T C missense_variant Y1515H 4543T>C COAD-US 19 36219050 36219050 single base substitution C T stop_gained R1517* 4549C>T COAD-US 19 36219725 36219725 single base substitution C T missense_variant A1541V 4622C>T COAD-US 19 36219738 36219738 single base substitution G T missense_variant Q1545H 4635G>T COAD-US 19 36219960 36219960 single base substitution G A missense_variant G1588R 4762G>A COAD-US 19 36220899 36220899 single base substitution C T missense_variant T1650M 4949C>T COAD-US 19 36220997 36220997 single base substitution C T stop_gained Q1683* 5047C>T COAD-US 19 36221496 36221496 single base substitution G A missense_variant R1752Q 5255G>A COAD-US 19 36221648 36221648 single base substitution C T missense_variant R1773C 5317C>T COAD-US 19 36222828 36222828 deletion of <=200bp C - frameshift_variant D1819 COAD-US 19 36222925 36222925 single base substitution G A missense_variant A1852T 5554G>A COAD-US 19 36222961 36222961 single base substitution C T stop_gained R1864* 5590C>T COAD-US 19 36223002 36223002 deletion of <=200bp G - frameshift_variant L1877 COAD-US 19 36224532 36224532 single base substitution C T missense_variant R2332C 6994C>T COAD-US 19 36224705 36224705 single base substitution A G missense_variant D2364G 7091A>G COAD-US 19 36227675 36227675 single base substitution G A missense_variant R2415H 7244G>A COAD-US 19 36228146 36228146 single base substitution G A missense_variant R2511Q 7532G>A COAD-US 19 36228594 36228594 deletion of <=200bp G - frameshift_variant E2536 COAD-US 19 36228816 36228816 single base substitution C T missense_variant T2572M 7715C>T COAD-US 19 36229431 36229431 single base substitution C G synonymous_variant A2707A 8121C>G COAD-US 19 36230417 36230417 single base substitution C T downstream_gene_variant COAD-US 19 36231450 36231450 single base substitution T C downstream_gene_variant COAD-US 19 36234772 36234772 single base substitution C T downstream_gene_variant COCA-CN 19 36205816 36205816 single base substitution G A upstream_gene_variant COCA-CN 19 36210697 36210697 single base substitution C T stop_gained R150* 448C>T COCA-CN 19 36211117 36211117 single base substitution C T missense_variant R290C 868C>T COCA-CN 19 36211118 36211118 single base substitution G A missense_variant R290H 869G>A COCA-CN 19 36211366 36211366 single base substitution G T stop_gained E373* 1117G>T COCA-CN 19 36211800 36211800 single base substitution C T synonymous_variant S517S 1551C>T COCA-CN 19 36212586 36212586 single base substitution C T downstream_gene_variant COCA-CN 19 36212586 36212586 single base substitution C T synonymous_variant G779G 2337C>T COCA-CN 19 36214594 36214594 single base substitution T C downstream_gene_variant COCA-CN 19 36214594 36214594 single base substitution T C intron_variant COCA-CN 19 36214844 36214844 single base substitution G T downstream_gene_variant COCA-CN 19 36214844 36214844 single base substitution G T missense_variant E1090D 3270G>T COCA-CN 19 36216693 36216693 single base substitution C A downstream_gene_variant COCA-CN 19 36216693 36216693 single base substitution C A synonymous_variant R1287R 3859C>A COCA-CN 19 36216771 36216771 single base substitution A C downstream_gene_variant COCA-CN 19 36216771 36216771 single base substitution A C intron_variant COCA-CN 19 36217950 36217950 single base substitution C A intron_variant COCA-CN 19 36219050 36219050 single base substitution C T stop_gained R1517* 4549C>T COCA-CN 19 36219680 36219680 single base substitution T C missense_variant V1526A 4577T>C COCA-CN 19 36221041 36221041 single base substitution T C intron_variant COCA-CN 19 36221642 36221642 single base substitution C T missense_variant R1771W 5311C>T COCA-CN 19 36223005 36223005 single base substitution G A synonymous_variant G1878G 5634G>A COCA-CN 19 36223645 36223645 single base substitution C T synonymous_variant D2065D 6195C>T COCA-CN 19 36223783 36223783 single base substitution G A synonymous_variant S2111S 6333G>A COCA-CN 19 36224468 36224468 single base substitution G A intron_variant COCA-CN 19 36228752 36228752 single base substitution C A splice_region_variant COCA-CN 19 36233469 36233469 single base substitution C T downstream_gene_variant ESAD-UK 19 36204849 36204873 deletion of <=200bp TCTGGTTCCTTCCCTGAGGATGTGT - upstream_gene_variant ESAD-UK 19 36205138 36205138 single base substitution G C upstream_gene_variant ESAD-UK 19 36206570 36206570 single base substitution C T upstream_gene_variant ESAD-UK 19 36210356 36210356 single base substitution G A intron_variant ESAD-UK 19 36210688 36210688 single base substitution C T stop_gained R147* 439C>T ESAD-UK 19 36214870 36214870 single base substitution G C downstream_gene_variant ESAD-UK 19 36214870 36214870 single base substitution G C missense_variant G1099A 3296G>C ESAD-UK 19 36216157 36216157 single base substitution G A downstream_gene_variant ESAD-UK 19 36216157 36216157 single base substitution G A missense_variant G1189S 3565G>A ESAD-UK 19 36216480 36216480 single base substitution G A downstream_gene_variant ESAD-UK 19 36216480 36216480 single base substitution G A missense_variant R1248H 3743G>A ESAD-UK 19 36218717 36218717 single base substitution G A intron_variant ESAD-UK 19 36220133 36220133 single base substitution T C missense_variant V1618A 4853T>C ESAD-UK 19 36220895 36220895 single base substitution G A missense_variant A1649T 4945G>A ESAD-UK 19 36221695 36221695 single base substitution G A synonymous_variant P1788P 5364G>A ESAD-UK 19 36223296 36223296 single base substitution C A missense_variant T1949K 5846C>A ESAD-UK 19 36223322 36223328 deletion of <=200bp CTGGCTC - frameshift_variant LAP1958 ESAD-UK 19 36223547 36223547 single base substitution C T missense_variant R2033C 6097C>T ESAD-UK 19 36224508 36224508 single base substitution G T missense_variant V2324L 6970G>T ESAD-UK 19 36224509 36224509 single base substitution T G missense_variant V2324G 6971T>G ESAD-UK 19 36225900 36225900 single base substitution C T intron_variant ESAD-UK 19 36227416 36227416 single base substitution G A intron_variant ESAD-UK 19 36227487 36227487 single base substitution G A intron_variant ESAD-UK 19 36229674 36229674 single base substitution T A 3_prime_UTR_variant ESAD-UK 19 36230500 36230501 deletion of <=200bp AG - downstream_gene_variant ESCA-CN 19 36206050 36206050 single base substitution A C upstream_gene_variant ESCA-CN 19 36212164 36212164 single base substitution A C intron_variant ESCA-CN 19 36212164 36212164 single base substitution A C missense_variant T639P 1915A>C ESCA-CN 19 36214865 36214865 single base substitution C T downstream_gene_variant ESCA-CN 19 36214865 36214865 single base substitution C T synonymous_variant P1097P 3291C>T ESCA-CN 19 36218821 36218821 single base substitution C G missense_variant H1478D 4432C>G ESCA-CN 19 36223505 36223505 single base substitution G A missense_variant G2019S 6055G>A ESCA-CN 19 36229080 36229080 single base substitution C T synonymous_variant F2620F 7860C>T ESCA-CN 19 36231719 36231719 single base substitution T C downstream_gene_variant GBM-US 19 36210728 36210728 single base substitution C A missense_variant P160H 479C>A GBM-US 19 36212329 36212329 single base substitution C T missense_variant R694W 2080C>T GBM-US 19 36212329 36212329 single base substitution C T synonymous_variant L549L 1647C>T GBM-US 19 36212357 36212357 single base substitution G A missense_variant A559T 1675G>A GBM-US 19 36212357 36212357 single base substitution G A missense_variant S703N 2108G>A GBM-US 19 36214780 36214780 single base substitution C G downstream_gene_variant GBM-US 19 36214780 36214780 single base substitution C G missense_variant S1069C 3206C>G GBM-US 19 36219962 36219962 single base substitution G A synonymous_variant G1588G 4764G>A GBM-US 19 36222840 36222840 single base substitution C T synonymous_variant D1823D 5469C>T GBM-US 19 36223857 36223857 single base substitution T A missense_variant L2136H 6407T>A GBM-US 19 36224327 36224327 deletion of <=200bp C - frameshift_variant P2293 GBM-US 19 36230669 36230669 single base substitution G A downstream_gene_variant KIRC-US 19 36211503 36211503 single base substitution A C synonymous_variant P418P 1254A>C KIRC-US 19 36211567 36211567 single base substitution C G missense_variant P440A 1318C>G KIRC-US 19 36219945 36219945 single base substitution C T missense_variant L1583F 4747C>T KIRC-US 19 36224005 36224005 insertion of <=200bp - C frameshift_variant K2185N? KIRC-US 19 36230813 36230813 single base substitution C T downstream_gene_variant KIRC-US 19 36231433 36231433 single base substitution C T downstream_gene_variant KIRP-US 19 36229181 36229181 single base substitution A G splice_acceptor_variant KIRP-US 19 36230750 36230750 single base substitution G C downstream_gene_variant KIRP-US 19 36232080 36232080 single base substitution A G downstream_gene_variant LAML-KR 19 36219692 36219692 single base substitution C T missense_variant A1530V 4589C>T LAML-KR 19 36221051 36221051 single base substitution G A intron_variant LAML-KR 19 36228667 36228667 single base substitution C T intron_variant LAML-KR 19 36228954 36228954 single base substitution G T intron_variant LGG-US 19 36216441 36216441 single base substitution G A downstream_gene_variant LGG-US 19 36216441 36216441 single base substitution G A missense_variant R1235Q 3704G>A LGG-US 19 36216664 36216664 single base substitution C T downstream_gene_variant LGG-US 19 36216664 36216664 single base substitution C T missense_variant P1277L 3830C>T LGG-US 19 36218411 36218411 single base substitution C T missense_variant A1397V 4190C>T LICA-CN 19 36205681 36205681 single base substitution C T upstream_gene_variant LICA-CN 19 36212669 36212669 single base substitution A T downstream_gene_variant LICA-CN 19 36212669 36212669 single base substitution A T missense_variant D807V 2420A>T LICA-CN 19 36221643 36221643 single base substitution G A missense_variant R1771Q 5312G>A LICA-CN 19 36232045 36232045 single base substitution G A downstream_gene_variant LICA-FR 19 36205539 36205539 single base substitution C T upstream_gene_variant LICA-FR 19 36207038 36207038 single base substitution C T upstream_gene_variant LICA-FR 19 36210796 36210796 single base substitution G T stop_gained E183* 547G>T LICA-FR 19 36210910 36210910 single base substitution G T stop_gained G221* 661G>T LICA-FR 19 36211821 36211821 single base substitution C A synonymous_variant I524I 1572C>A LICA-FR 19 36212642 36212642 insertion of <=200bp - ACAGATTACGAGTCAGGTATCTGGTGCCAATGGGGCGAGGCTCTGAATACACACCATTAGTGTCCACAGTAAAGTCCACATTAACAGATTTGTTGTAGTTGGAAGTGTACTGAATTTCGGGATTCCAGCGTTTGCTGTTCTCCTTCTGCAGCTCCCACTC downstream_gene_variant LICA-FR 19 36212642 36212642 insertion of <=200bp - ACAGATTACGAGTCAGGTATCTGGTGCCAATGGGGCGAGGCTCTGAATACACACCATTAGTGTCCACAGTAAAGTCCACATTAACAGATTTGTTGTAGTTGGAAGTGTACTGAATTTCGGGATTCCAGCGTTTGCTGTTCTCCTTCTGCAGCTCCCACTC frameshift_variant R798NRLRVRYLVPMGRGSEYTPLVSTVKSTLTDLL*LEVY*ISGFQRLLFSFCSSHS? LICA-FR 19 36216680 36216680 single base substitution C T downstream_gene_variant LICA-FR 19 36216680 36216680 single base substitution C T synonymous_variant P1282P 3846C>T LICA-FR 19 36219722 36219722 single base substitution A G missense_variant Y1540C 4619A>G LICA-FR 19 36220784 36220784 single base substitution G C intron_variant LICA-FR 19 36224700 36224700 single base substitution G A synonymous_variant P2362P 7086G>A LICA-FR 19 36228158 36228158 single base substitution A G missense_variant Y2515C 7544A>G LICA-FR 19 36229215 36229215 insertion of <=200bp - CT frameshift_variant D2635D? LICA-FR 19 36231451 36231451 single base substitution C T downstream_gene_variant LIHC-US 19 36206306 36206306 single base substitution C A upstream_gene_variant LIHC-US 19 36207170 36207170 single base substitution A T upstream_gene_variant LIHC-US 19 36211168 36211168 single base substitution T C missense_variant F307L 919T>C LIHC-US 19 36214634 36214634 single base substitution C G downstream_gene_variant LIHC-US 19 36214634 36214634 single base substitution C G splice_region_variant LIHC-US 19 36214899 36214899 single base substitution C T downstream_gene_variant LIHC-US 19 36214899 36214899 single base substitution C T stop_gained R1109* 3325C>T LIHC-US 19 36216120 36216120 single base substitution G C downstream_gene_variant LIHC-US 19 36216120 36216120 single base substitution G C splice_acceptor_variant LIHC-US 19 36219035 36219035 single base substitution G A missense_variant D1512N 4534G>A LIHC-US 19 36220117 36220117 single base substitution A G missense_variant I1613V 4837A>G LIHC-US 19 36221017 36221017 single base substitution G C synonymous_variant L1689L 5067G>C LIHC-US 19 36221665 36221665 single base substitution C A stop_gained C1778* 5334C>A LIHC-US 19 36222960 36222960 single base substitution T C synonymous_variant A1863A 5589T>C LIHC-US 19 36222992 36222992 single base substitution G T missense_variant R1874L 5621G>T LIHC-US 19 36228046 36228046 single base substitution C A missense_variant Q2478K 7432C>A LIHC-US 19 36229093 36229093 single base substitution G T splice_donor_variant LINC-JP 19 36207433 36207433 single base substitution G C upstream_gene_variant LINC-JP 19 36210448 36210448 single base substitution G T splice_region_variant LINC-JP 19 36210612 36210612 single base substitution C T intron_variant LINC-JP 19 36210776 36210776 single base substitution C T missense_variant T176I 527C>T LINC-JP 19 36211825 36211825 single base substitution C T stop_gained Q526* 1576C>T LINC-JP 19 36212596 36212596 insertion of <=200bp - T downstream_gene_variant LINC-JP 19 36212596 36212596 insertion of <=200bp - T frameshift_variant L783F? LINC-JP 19 36213143 36213143 single base substitution G T downstream_gene_variant LINC-JP 19 36213143 36213143 single base substitution G T intron_variant LINC-JP 19 36213631 36213631 single base substitution A G downstream_gene_variant LINC-JP 19 36213631 36213631 single base substitution A G intron_variant LINC-JP 19 36214492 36214492 single base substitution G T downstream_gene_variant LINC-JP 19 36214492 36214492 single base substitution G T intron_variant LINC-JP 19 36215800 36215800 single base substitution G A downstream_gene_variant LINC-JP 19 36215800 36215800 single base substitution G A intron_variant LINC-JP 19 36217526 36217526 single base substitution G T intron_variant LINC-JP 19 36217527 36217527 single base substitution G C intron_variant LINC-JP 19 36220210 36220210 single base substitution G T intron_variant LINC-JP 19 36221694 36221694 single base substitution C T missense_variant P1788L 5363C>T LINC-JP 19 36227851 36227851 single base substitution C T stop_gained R2446* 7336C>T LINC-JP 19 36228071 36228071 single base substitution A T missense_variant Q2486L 7457A>T LINC-JP 19 36228997 36228997 single base substitution C T missense_variant R2593C 7777C>T LINC-JP 19 36230212 36230212 single base substitution T A downstream_gene_variant LINC-JP 19 36233455 36233455 single base substitution T C downstream_gene_variant LIRI-JP 19 36206369 36206369 single base substitution C T upstream_gene_variant LIRI-JP 19 36213248 36213248 single base substitution T C downstream_gene_variant LIRI-JP 19 36213248 36213248 single base substitution T C intron_variant LIRI-JP 19 36214440 36214440 single base substitution G A downstream_gene_variant LIRI-JP 19 36214440 36214440 single base substitution G A intron_variant LIRI-JP 19 36214804 36214804 single base substitution G A downstream_gene_variant LIRI-JP 19 36214804 36214804 single base substitution G A missense_variant R1077Q 3230G>A LIRI-JP 19 36215975 36215975 single base substitution G A downstream_gene_variant LIRI-JP 19 36215975 36215975 single base substitution G A missense_variant R1172H 3515G>A LIRI-JP 19 36215987 36215987 single base substitution A T downstream_gene_variant LIRI-JP 19 36215987 36215987 single base substitution A T missense_variant K1176M 3527A>T LIRI-JP 19 36217102 36217102 single base substitution C A downstream_gene_variant LIRI-JP 19 36217102 36217102 single base substitution C A intron_variant LIRI-JP 19 36218009 36218009 single base substitution T A intron_variant LIRI-JP 19 36218389 36218389 insertion of <=200bp - T frameshift_variant C1390L? LIRI-JP 19 36219646 36219646 single base substitution C T intron_variant LIRI-JP 19 36225342 36225342 single base substitution G A intron_variant LIRI-JP 19 36225984 36225984 single base substitution C G intron_variant LIRI-JP 19 36227195 36227208 deletion of <=200bp TGCATCTAAAAAAA - intron_variant LIRI-JP 19 36227393 36227393 single base substitution G A intron_variant LIRI-JP 19 36227984 36227984 single base substitution C T splice_region_variant LIRI-JP 19 36228188 36228188 single base substitution C T intron_variant LIRI-JP 19 36229451 36229451 single base substitution T C missense_variant L2714P 8141T>C LUSC-KR 19 36205726 36205726 single base substitution C T upstream_gene_variant LUSC-KR 19 36206979 36206979 single base substitution T A upstream_gene_variant LUSC-KR 19 36207279 36207279 single base substitution C A upstream_gene_variant LUSC-KR 19 36209124 36209124 single base substitution C G synonymous_variant L68L 204C>G LUSC-KR 19 36214014 36214014 single base substitution A G downstream_gene_variant LUSC-KR 19 36214014 36214014 single base substitution A G missense_variant H947R 2840A>G LUSC-KR 19 36222415 36222415 single base substitution G A intron_variant LUSC-KR 19 36222460 36222460 single base substitution G A intron_variant LUSC-KR 19 36225131 36225131 single base substitution G T intron_variant LUSC-KR 19 36234652 36234652 single base substitution T C downstream_gene_variant LUSC-US 19 36210823 36210823 single base substitution G T missense_variant A192S 574G>T LUSC-US 19 36212435 36212435 single base substitution A G downstream_gene_variant LUSC-US 19 36212435 36212435 single base substitution A G missense_variant N729S 2186A>G LUSC-US 19 36213498 36213498 single base substitution G A downstream_gene_variant LUSC-US 19 36213498 36213498 single base substitution G A missense_variant R867H 2600G>A LUSC-US 19 36214714 36214714 single base substitution G A downstream_gene_variant LUSC-US 19 36214714 36214714 single base substitution G A missense_variant R1047Q 3140G>A LUSC-US 19 36218350 36218350 single base substitution G T stop_gained E1377* 4129G>T LUSC-US 19 36218436 36218436 single base substitution G C synonymous_variant L1405L 4215G>C LUSC-US 19 36219920 36219920 single base substitution C A missense_variant H1574Q 4722C>A LUSC-US 19 36220127 36220127 single base substitution C A missense_variant A1616E 4847C>A LUSC-US 19 36223339 36223339 single base substitution G A synonymous_variant P1963P 5889G>A LUSC-US 19 36223655 36223655 single base substitution G C missense_variant D2069H 6205G>C LUSC-US 19 36223758 36223758 single base substitution C T missense_variant A2103V 6308C>T LUSC-US 19 36227820 36227820 single base substitution G A stop_gained W2435* 7305G>A LUSC-US 19 36230525 36230525 single base substitution G T downstream_gene_variant LUSC-US 19 36230925 36230925 single base substitution T C downstream_gene_variant MALY-DE 19 36221839 36221839 single base substitution G A intron_variant MALY-DE 19 36229289 36229290 deletion of <=200bp TC - frameshift_variant F2660 MALY-DE 19 36234651 36234651 single base substitution A G downstream_gene_variant MELA-AU 19 36204292 36204292 single base substitution G A upstream_gene_variant MELA-AU 19 36204575 36204575 single base substitution C T upstream_gene_variant MELA-AU 19 36204843 36204843 single base substitution G A upstream_gene_variant MELA-AU 19 36205261 36205261 single base substitution T C upstream_gene_variant MELA-AU 19 36205450 36205450 single base substitution C T upstream_gene_variant MELA-AU 19 36205957 36205957 single base substitution G A upstream_gene_variant MELA-AU 19 36206043 36206043 single base substitution G A upstream_gene_variant MELA-AU 19 36206694 36206694 single base substitution G A upstream_gene_variant MELA-AU 19 36208210 36208210 single base substitution G A upstream_gene_variant MELA-AU 19 36208436 36208436 single base substitution G A upstream_gene_variant MELA-AU 19 36210316 36210316 single base substitution G A intron_variant MELA-AU 19 36210408 36210408 single base substitution C T missense_variant P134L 401C>T MELA-AU 19 36210423 36210423 single base substitution C T missense_variant S139F 416C>T MELA-AU 19 36210838 36210838 single base substitution C T missense_variant L197F 589C>T MELA-AU 19 36211169 36211169 single base substitution T A missense_variant F307Y 920T>A MELA-AU 19 36211277 36211277 single base substitution G A missense_variant R343K 1028G>A MELA-AU 19 36211732 36211732 single base substitution C T missense_variant P495S 1483C>T MELA-AU 19 36211792 36211792 single base substitution C T missense_variant P515S 1543C>T MELA-AU 19 36211857 36211857 single base substitution C T intron_variant MELA-AU 19 36211857 36211857 single base substitution C T synonymous_variant S536S 1608C>T MELA-AU 19 36212000 36212000 single base substitution C A intron_variant MELA-AU 19 36212000 36212000 single base substitution C A missense_variant P584Q 1751C>A MELA-AU 19 36212667 36212667 single base substitution C T downstream_gene_variant MELA-AU 19 36212667 36212667 single base substitution C T synonymous_variant I806I 2418C>T MELA-AU 19 36212704 36212705 multiple base substitution (>=2bp and <=200bp) CC TT downstream_gene_variant MELA-AU 19 36212704 36212705 multiple base substitution (>=2bp and <=200bp) CC TT missense_variant P819L 2455CC>TT MELA-AU 19 36213221 36213221 single base substitution C T downstream_gene_variant MELA-AU 19 36213221 36213221 single base substitution C T intron_variant MELA-AU 19 36213401 36213401 single base substitution G A downstream_gene_variant MELA-AU 19 36213401 36213401 single base substitution G A intron_variant MELA-AU 19 36213587 36213587 single base substitution C T downstream_gene_variant MELA-AU 19 36213587 36213587 single base substitution C T missense_variant P897S 2689C>T MELA-AU 19 36213771 36213771 single base substitution C T downstream_gene_variant MELA-AU 19 36213771 36213771 single base substitution C T intron_variant MELA-AU 19 36214012 36214013 multiple base substitution (>=2bp and <=200bp) CC TT downstream_gene_variant MELA-AU 19 36214012 36214013 multiple base substitution (>=2bp and <=200bp) CC TT missense_variant AH946AY MELA-AU 19 36214041 36214041 deletion of <=200bp A - downstream_gene_variant MELA-AU 19 36214041 36214041 deletion of <=200bp A - frameshift_variant H956 MELA-AU 19 36214054 36214054 single base substitution G T downstream_gene_variant MELA-AU 19 36214054 36214054 single base substitution G T missense_variant K960N 2880G>T MELA-AU 19 36214736 36214736 single base substitution C G downstream_gene_variant MELA-AU 19 36214736 36214736 single base substitution C G synonymous_variant P1054P 3162C>G MELA-AU 19 36214784 36214785 multiple base substitution (>=2bp and <=200bp) CC TT downstream_gene_variant MELA-AU 19 36214784 36214785 multiple base substitution (>=2bp and <=200bp) CC TT synonymous_variant LL1070 MELA-AU 19 36214899 36214899 single base substitution C T downstream_gene_variant MELA-AU 19 36214899 36214899 single base substitution C T stop_gained R1109* 3325C>T MELA-AU 19 36215150 36215150 single base substitution C T downstream_gene_variant MELA-AU 19 36215150 36215150 single base substitution C T intron_variant MELA-AU 19 36215194 36215194 single base substitution G A downstream_gene_variant MELA-AU 19 36215194 36215194 single base substitution G A intron_variant MELA-AU 19 36215235 36215235 single base substitution C T downstream_gene_variant MELA-AU 19 36215235 36215235 single base substitution C T intron_variant MELA-AU 19 36215645 36215645 single base substitution C T downstream_gene_variant MELA-AU 19 36215645 36215645 single base substitution C T intron_variant MELA-AU 19 36216330 36216330 single base substitution C T downstream_gene_variant MELA-AU 19 36216330 36216330 single base substitution C T intron_variant MELA-AU 19 36216503 36216515 deletion of <=200bp GGACGCAAAGGTC - downstream_gene_variant MELA-AU 19 36216503 36216515 deletion of <=200bp GGACGCAAAGGTC - frameshift_variant GRKGR1256 MELA-AU 19 36216688 36216688 single base substitution C T downstream_gene_variant MELA-AU 19 36216688 36216688 single base substitution C T missense_variant P1285L 3854C>T MELA-AU 19 36217044 36217044 single base substitution C T downstream_gene_variant MELA-AU 19 36217044 36217044 single base substitution C T intron_variant MELA-AU 19 36217192 36217192 single base substitution G A downstream_gene_variant MELA-AU 19 36217192 36217192 single base substitution G A stop_gained W1314* 3941G>A MELA-AU 19 36217204 36217204 single base substitution G A downstream_gene_variant MELA-AU 19 36217204 36217204 single base substitution G A stop_gained W1318* 3953G>A MELA-AU 19 36217228 36217228 single base substitution C T downstream_gene_variant MELA-AU 19 36217228 36217228 single base substitution C T missense_variant P1326L 3977C>T MELA-AU 19 36218205 36218205 single base substitution C T intron_variant MELA-AU 19 36218335 36218335 single base substitution C T splice_region_variant MELA-AU 19 36218489 36218489 single base substitution C T missense_variant S1423F 4268C>T MELA-AU 19 36218774 36218774 single base substitution C T splice_region_variant MELA-AU 19 36219506 36219506 single base substitution C T intron_variant MELA-AU 19 36219707 36219707 single base substitution C T missense_variant S1535F 4604C>T MELA-AU 19 36219708 36219708 single base substitution C T synonymous_variant S1535S 4605C>T MELA-AU 19 36219891 36219891 single base substitution C T stop_gained Q1565* 4693C>T MELA-AU 19 36220065 36220065 deletion of <=200bp G - frameshift_variant A1595 MELA-AU 19 36220238 36220238 single base substitution C T intron_variant MELA-AU 19 36220504 36220504 single base substitution C T intron_variant MELA-AU 19 36220624 36220624 single base substitution C G intron_variant MELA-AU 19 36221069 36221069 single base substitution C T intron_variant MELA-AU 19 36221233 36221233 single base substitution C T intron_variant MELA-AU 19 36221609 36221609 single base substitution T G missense_variant C1760G 5278T>G MELA-AU 19 36221626 36221626 single base substitution G T missense_variant W1765C 5295G>T MELA-AU 19 36222833 36222833 single base substitution C T missense_variant P1821L 5462C>T MELA-AU 19 36222961 36222961 single base substitution C T stop_gained R1864* 5590C>T MELA-AU 19 36222989 36222989 single base substitution C T missense_variant S1873F 5618C>T MELA-AU 19 36223175 36223175 single base substitution C T missense_variant P1909S 5725C>T MELA-AU 19 36223257 36223257 single base substitution C T missense_variant S1936F 5807C>T MELA-AU 19 36223291 36223291 single base substitution C T synonymous_variant V1947V 5841C>T MELA-AU 19 36223421 36223421 single base substitution C T synonymous_variant L1991L 5971C>T MELA-AU 19 36223841 36223841 single base substitution C T missense_variant P2131S 6391C>T MELA-AU 19 36223841 36223842 multiple base substitution (>=2bp and <=200bp) CC TT missense_variant P2131F 6391CC>TT MELA-AU 19 36223889 36223889 single base substitution C T stop_gained Q2147* 6439C>T MELA-AU 19 36224249 36224250 multiple base substitution (>=2bp and <=200bp) GG AA missense_variant G2267K 6799GG>AA MELA-AU 19 36224313 36224313 single base substitution C T missense_variant S2288F 6863C>T MELA-AU 19 36224341 36224341 single base substitution C T synonymous_variant A2297A 6891C>T MELA-AU 19 36224475 36224475 single base substitution C T intron_variant MELA-AU 19 36224681 36224681 single base substitution C T missense_variant S2356F 7067C>T MELA-AU 19 36224682 36224682 single base substitution C T synonymous_variant S2356S 7068C>T MELA-AU 19 36224797 36224797 single base substitution C T intron_variant MELA-AU 19 36224893 36224893 single base substitution C T intron_variant MELA-AU 19 36225351 36225351 single base substitution C T intron_variant MELA-AU 19 36225723 36225723 single base substitution C T intron_variant MELA-AU 19 36225854 36225854 single base substitution G T intron_variant MELA-AU 19 36226486 36226486 single base substitution C T intron_variant MELA-AU 19 36227419 36227419 single base substitution C T intron_variant MELA-AU 19 36227650 36227650 single base substitution C T missense_variant P2407S 7219C>T MELA-AU 19 36227864 36227864 single base substitution G A missense_variant R2450Q 7349G>A MELA-AU 19 36228525 36228525 insertion of <=200bp - AGG intron_variant MELA-AU 19 36231515 36231515 single base substitution G A downstream_gene_variant MELA-AU 19 36231525 36231525 single base substitution C T downstream_gene_variant MELA-AU 19 36232102 36232102 single base substitution G A downstream_gene_variant MELA-AU 19 36233231 36233231 single base substitution C T downstream_gene_variant MELA-AU 19 36233532 36233532 single base substitution G A downstream_gene_variant MELA-AU 19 36233720 36233720 single base substitution T C downstream_gene_variant MELA-AU 19 36234634 36234635 multiple base substitution (>=2bp and <=200bp) GG AA downstream_gene_variant ORCA-IN 19 36207464 36207464 single base substitution C A upstream_gene_variant ORCA-IN 19 36210404 36210404 insertion of <=200bp - C frameshift_variant A133R? ORCA-IN 19 36211882 36211882 single base substitution C T intron_variant ORCA-IN 19 36211882 36211882 single base substitution C T stop_gained R545* 1633C>T ORCA-IN 19 36211899 36211899 deletion of <=200bp C - frameshift_variant D550 ORCA-IN 19 36211899 36211899 deletion of <=200bp C - intron_variant ORCA-IN 19 36212365 36212365 single base substitution C T stop_gained R706* 2116C>T ORCA-IN 19 36212365 36212365 single base substitution C T synonymous_variant L561L 1683C>T ORCA-IN 19 36214142 36214142 deletion of <=200bp T - downstream_gene_variant ORCA-IN 19 36214142 36214142 deletion of <=200bp T - frameshift_variant F990 ORCA-IN 19 36215779 36215779 single base substitution G A downstream_gene_variant ORCA-IN 19 36215779 36215779 single base substitution G A intron_variant ORCA-IN 19 36215953 36215953 single base substitution C T downstream_gene_variant ORCA-IN 19 36215953 36215953 single base substitution C T missense_variant P1165S 3493C>T ORCA-IN 19 36216421 36216421 single base substitution C G downstream_gene_variant ORCA-IN 19 36216421 36216421 single base substitution C G missense_variant F1228L 3684C>G ORCA-IN 19 36218142 36218142 single base substitution G A stop_gained W1363* 4089G>A ORCA-IN 19 36219731 36219731 single base substitution G A stop_gained W1543* 4628G>A ORCA-IN 19 36220138 36220138 single base substitution G T stop_gained E1620* 4858G>T ORCA-IN 19 36221004 36221004 single base substitution A G missense_variant H1685R 5054A>G ORCA-IN 19 36221026 36221030 deletion of <=200bp GGTGG - frameshift_variant K1692 ORCA-IN 19 36221656 36221656 single base substitution G A stop_gained W1775* 5325G>A ORCA-IN 19 36222886 36222886 single base substitution C T stop_gained Q1839* 5515C>T ORCA-IN 19 36223676 36223676 single base substitution C T stop_gained Q2076* 6226C>T ORCA-IN 19 36224521 36224521 deletion of <=200bp C - frameshift_variant T2328 ORCA-IN 19 36229320 36229321 deletion of <=200bp AC - frameshift_variant KH2670 ORCA-IN 19 36231744 36231744 single base substitution C A downstream_gene_variant ORCA-IN 19 36233805 36233805 single base substitution G A downstream_gene_variant OV-AU 19 36204219 36204219 single base substitution G A upstream_gene_variant OV-AU 19 36210615 36210615 single base substitution C T intron_variant OV-AU 19 36223715 36223715 single base substitution G C missense_variant G2089R 6265G>C OV-AU 19 36224680 36224680 single base substitution T G missense_variant S2356A 7066T>G OV-AU 19 36226974 36226974 single base substitution A G intron_variant OV-AU 19 36226986 36226986 single base substitution T A intron_variant OV-AU 19 36227559 36227559 single base substitution G A intron_variant OV-AU 19 36229231 36229231 single base substitution G A missense_variant A2641T 7921G>A OV-AU 19 36230013 36230013 single base substitution C G downstream_gene_variant OV-AU 19 36230665 36230665 single base substitution G C downstream_gene_variant OV-US 19 36207502 36207502 single base substitution C A upstream_gene_variant OV-US 19 36223567 36223567 single base substitution G T synonymous_variant V2039V 6117G>T PACA-AU 19 36204118 36204118 single base substitution G A upstream_gene_variant PACA-AU 19 36206571 36206571 single base substitution G A upstream_gene_variant PACA-AU 19 36207432 36207432 single base substitution G A upstream_gene_variant PACA-AU 19 36212529 36212529 single base substitution G A downstream_gene_variant PACA-AU 19 36212529 36212529 single base substitution G A synonymous_variant L760L 2280G>A PACA-AU 19 36214351 36214351 single base substitution A T downstream_gene_variant PACA-AU 19 36214351 36214351 single base substitution A T missense_variant Y1002F 3005A>T PACA-AU 19 36221489 36221489 single base substitution G A missense_variant E1750K 5248G>A PACA-AU 19 36224309 36224309 single base substitution C A synonymous_variant R2287R 6859C>A PACA-AU 19 36224740 36224740 single base substitution C T synonymous_variant L2376L 7126C>T PACA-AU 19 36224975 36224975 single base substitution C T intron_variant PACA-AU 19 36231696 36231696 deletion of <=200bp C - downstream_gene_variant PACA-AU 19 36233154 36233154 single base substitution G A downstream_gene_variant PACA-CA 19 36204594 36204594 single base substitution G A upstream_gene_variant PACA-CA 19 36214243 36214243 single base substitution C A downstream_gene_variant PACA-CA 19 36214243 36214243 single base substitution C A intron_variant PACA-CA 19 36218959 36218959 single base substitution G A intron_variant PACA-CA 19 36221929 36221929 single base substitution G T intron_variant PACA-CA 19 36222068 36222068 single base substitution C T intron_variant PACA-CA 19 36223191 36223191 single base substitution G A missense_variant R1914H 5741G>A PACA-CA 19 36224271 36224271 single base substitution A G missense_variant Q2274R 6821A>G PACA-CA 19 36226928 36226940 deletion of <=200bp GGCCGAGGCGGGC - intron_variant PACA-CA 19 36227137 36227137 single base substitution A G intron_variant PACA-CA 19 36227549 36227549 single base substitution C T intron_variant PACA-CA 19 36234039 36234039 single base substitution C T downstream_gene_variant PAEN-AU 19 36213626 36213626 single base substitution T G downstream_gene_variant PAEN-AU 19 36213626 36213626 single base substitution T G splice_region_variant PAEN-AU 19 36215780 36215780 insertion of <=200bp - GGGTCTGGATCA downstream_gene_variant PAEN-AU 19 36215780 36215780 insertion of <=200bp - GGGTCTGGATCA intron_variant PBCA-DE 19 36207983 36207983 single base substitution G T upstream_gene_variant PBCA-DE 19 36216184 36216184 deletion of <=200bp G - downstream_gene_variant PBCA-DE 19 36216184 36216184 deletion of <=200bp G - frameshift_variant G1198 PBCA-DE 19 36218461 36218461 single base substitution C T missense_variant R1414C 4240C>T PBCA-DE 19 36223541 36223541 single base substitution A C missense_variant T2031P 6091A>C PRAD-CA 19 36224459 36224459 single base substitution G A intron_variant PRAD-CA 19 36226383 36226383 single base substitution G A intron_variant PRAD-CA 19 36227803 36227803 single base substitution G A intron_variant PRAD-UK 19 36211138 36211138 single base substitution C T stop_gained R297* 889C>T PRAD-UK 19 36211289 36211289 single base substitution G T missense_variant G347V 1040G>T PRAD-UK 19 36222944 36222944 single base substitution G A missense_variant R1858H 5573G>A PRAD-US 19 36206307 36206307 single base substitution C A upstream_gene_variant PRAD-US 19 36229230 36229230 single base substitution C T synonymous_variant D2640D 7920C>T PRAD-US 19 36234735 36234735 single base substitution G A downstream_gene_variant READ-US 19 36206338 36206338 single base substitution C T upstream_gene_variant READ-US 19 36210821 36210821 single base substitution A T missense_variant Q191L 572A>T READ-US 19 36221688 36221688 deletion of <=200bp G - frameshift_variant W1786 READ-US 19 36229230 36229230 single base substitution C T synonymous_variant D2640D 7920C>T RECA-EU 19 36229220 36229220 single base substitution A G missense_variant D2637G 7910A>G RECA-EU 19 36229909 36229909 single base substitution C G downstream_gene_variant SKCA-BR 19 36206423 36206423 single base substitution T G upstream_gene_variant SKCA-BR 19 36210189 36210189 single base substitution C T intron_variant SKCA-BR 19 36214463 36214463 single base substitution G A downstream_gene_variant SKCA-BR 19 36214463 36214463 single base substitution G A intron_variant SKCA-BR 19 36214464 36214464 single base substitution G A downstream_gene_variant SKCA-BR 19 36214464 36214464 single base substitution G A intron_variant SKCA-BR 19 36215783 36215783 single base substitution T G downstream_gene_variant SKCA-BR 19 36215783 36215783 single base substitution T G intron_variant SKCA-BR 19 36216467 36216467 single base substitution T A downstream_gene_variant SKCA-BR 19 36216467 36216467 single base substitution T A missense_variant W1244R 3730T>A SKCA-BR 19 36224161 36224161 single base substitution C A synonymous_variant G2237G 6711C>A SKCA-BR 19 36230849 36230849 single base substitution G A downstream_gene_variant SKCA-BR 19 36231710 36231710 single base substitution T C downstream_gene_variant SKCA-BR 19 36232537 36232537 single base substitution C A downstream_gene_variant SKCA-BR 19 36233149 36233149 single base substitution T C downstream_gene_variant SKCM-US 19 36205566 36205566 single base substitution G A upstream_gene_variant SKCM-US 19 36205574 36205574 single base substitution C T upstream_gene_variant SKCM-US 19 36205636 36205636 single base substitution G A upstream_gene_variant SKCM-US 19 36205768 36205768 single base substitution G A upstream_gene_variant SKCM-US 19 36206302 36206302 single base substitution C T upstream_gene_variant SKCM-US 19 36207515 36207515 single base substitution C T upstream_gene_variant SKCM-US 19 36207628 36207628 single base substitution T G upstream_gene_variant SKCM-US 19 36210760 36210760 single base substitution C T missense_variant P171S 511C>T SKCM-US 19 36211033 36211033 single base substitution C T stop_gained Q262* 784C>T SKCM-US 19 36211154 36211154 single base substitution C T missense_variant P302L 905C>T SKCM-US 19 36211905 36211905 single base substitution C T intron_variant SKCM-US 19 36211905 36211905 single base substitution C T synonymous_variant P552P 1656C>T SKCM-US 19 36212370 36212370 single base substitution C T missense_variant S563L 1688C>T SKCM-US 19 36212370 36212370 single base substitution C T synonymous_variant F707F 2121C>T SKCM-US 19 36212573 36212573 single base substitution C T downstream_gene_variant SKCM-US 19 36212573 36212573 single base substitution C T missense_variant A775V 2324C>T SKCM-US 19 36213929 36213929 single base substitution C T downstream_gene_variant SKCM-US 19 36213929 36213929 single base substitution C T missense_variant P919S 2755C>T SKCM-US 19 36214692 36214692 single base substitution C T downstream_gene_variant SKCM-US 19 36214692 36214692 single base substitution C T missense_variant P1040S 3118C>T SKCM-US 19 36214784 36214784 single base substitution C T downstream_gene_variant SKCM-US 19 36214784 36214784 single base substitution C T synonymous_variant L1070L 3210C>T SKCM-US 19 36214803 36214803 single base substitution C T downstream_gene_variant SKCM-US 19 36214803 36214803 single base substitution C T missense_variant R1077W 3229C>T SKCM-US 19 36215596 36215596 deletion of <=200bp T - downstream_gene_variant SKCM-US 19 36215596 36215596 deletion of <=200bp T - frameshift_variant P1131 SKCM-US 19 36215909 36215909 single base substitution C T downstream_gene_variant SKCM-US 19 36215909 36215909 single base substitution C T missense_variant P1150L 3449C>T SKCM-US 19 36216190 36216190 single base substitution C T downstream_gene_variant SKCM-US 19 36216190 36216190 single base substitution C T missense_variant P1200S 3598C>T SKCM-US 19 36216413 36216413 single base substitution C T downstream_gene_variant SKCM-US 19 36216413 36216413 single base substitution C T missense_variant H1226Y 3676C>T SKCM-US 19 36217192 36217192 single base substitution G A downstream_gene_variant SKCM-US 19 36217192 36217192 single base substitution G A stop_gained W1314* 3941G>A SKCM-US 19 36217228 36217228 single base substitution C T downstream_gene_variant SKCM-US 19 36217228 36217228 single base substitution C T missense_variant P1326L 3977C>T SKCM-US 19 36217254 36217254 single base substitution G A downstream_gene_variant SKCM-US 19 36217254 36217254 single base substitution G A missense_variant G1335R 4003G>A SKCM-US 19 36218489 36218489 single base substitution C T missense_variant S1423F 4268C>T SKCM-US 19 36218811 36218811 single base substitution C T synonymous_variant I1474I 4422C>T SKCM-US 19 36218823 36218823 single base substitution C T synonymous_variant H1478H 4434C>T SKCM-US 19 36218841 36218841 single base substitution C G synonymous_variant T1484T 4452C>G SKCM-US 19 36219791 36219791 single base substitution G T splice_donor_variant SKCM-US 19 36221442 36221442 single base substitution C T missense_variant S1734F 5201C>T SKCM-US 19 36221458 36221458 single base substitution C T synonymous_variant S1739S 5217C>T SKCM-US 19 36222932 36222932 single base substitution C T missense_variant P1854L 5561C>T SKCM-US 19 36223175 36223175 single base substitution C T missense_variant P1909S 5725C>T SKCM-US 19 36223189 36223189 single base substitution C T synonymous_variant S1913S 5739C>T SKCM-US 19 36223190 36223190 single base substitution C T missense_variant R1914C 5740C>T SKCM-US 19 36223280 36223280 single base substitution C T missense_variant P1944S 5830C>T SKCM-US 19 36223347 36223347 single base substitution C T missense_variant S1966F 5897C>T SKCM-US 19 36223529 36223529 single base substitution G T stop_gained E2027* 6079G>T SKCM-US 19 36223707 36223707 single base substitution C T missense_variant S2086L 6257C>T SKCM-US 19 36223782 36223782 single base substitution C T missense_variant S2111L 6332C>T SKCM-US 19 36224124 36224124 deletion of <=200bp C - frameshift_variant S2225 SKCM-US 19 36224547 36224547 single base substitution C T synonymous_variant L2337L 7009C>T SKCM-US 19 36224722 36224722 single base substitution C T missense_variant P2370S 7108C>T SKCM-US 19 36227621 36227621 single base substitution C T missense_variant P2397L 7190C>T SKCM-US 19 36227703 36227703 single base substitution C T synonymous_variant F2424F 7272C>T SKCM-US 19 36227864 36227864 single base substitution G A missense_variant R2450Q 7349G>A SKCM-US 19 36228010 36228010 single base substitution G A missense_variant G2466S 7396G>A SKCM-US 19 36228084 36228084 single base substitution C T synonymous_variant F2490F 7470C>T SKCM-US 19 36228131 36228131 single base substitution C T missense_variant P2506L 7517C>T SKCM-US 19 36231322 36231322 single base substitution G A downstream_gene_variant SKCM-US 19 36233529 36233529 single base substitution G A downstream_gene_variant SKCM-US 19 36233574 36233574 single base substitution G A downstream_gene_variant SKCM-US 19 36233575 36233575 single base substitution G A downstream_gene_variant STAD-US 19 36205601 36205601 single base substitution C T upstream_gene_variant STAD-US 19 36206345 36206345 single base substitution G A upstream_gene_variant STAD-US 19 36207046 36207046 single base substitution A G upstream_gene_variant STAD-US 19 36207454 36207454 single base substitution A G upstream_gene_variant STAD-US 19 36207582 36207582 single base substitution C A upstream_gene_variant STAD-US 19 36210704 36210704 single base substitution G A missense_variant R152Q 455G>A STAD-US 19 36210710 36210710 single base substitution G A missense_variant R154H 461G>A STAD-US 19 36210764 36210764 deletion of <=200bp C - frameshift_variant T172 STAD-US 19 36210764 36210764 insertion of <=200bp - C frameshift_variant T172T? STAD-US 19 36210893 36210893 deletion of <=200bp C - frameshift_variant T215 STAD-US 19 36211209 36211209 single base substitution C A synonymous_variant S320S 960C>A STAD-US 19 36211852 36211852 single base substitution C T intron_variant STAD-US 19 36211852 36211852 single base substitution C T missense_variant R535C 1603C>T STAD-US 19 36211882 36211882 single base substitution C T intron_variant STAD-US 19 36211882 36211882 single base substitution C T stop_gained R545* 1633C>T STAD-US 19 36211899 36211899 deletion of <=200bp C - frameshift_variant D550 STAD-US 19 36211899 36211899 deletion of <=200bp C - intron_variant STAD-US 19 36214078 36214078 single base substitution C T downstream_gene_variant STAD-US 19 36214078 36214078 single base substitution C T synonymous_variant H968H 2904C>T STAD-US 19 36214083 36214083 single base substitution G A downstream_gene_variant STAD-US 19 36214083 36214083 single base substitution G A missense_variant R970Q 2909G>A STAD-US 19 36214714 36214714 deletion of <=200bp G - downstream_gene_variant STAD-US 19 36214714 36214714 deletion of <=200bp G - frameshift_variant R1047 STAD-US 19 36214856 36214856 single base substitution C T downstream_gene_variant STAD-US 19 36214856 36214856 single base substitution C T synonymous_variant D1094D 3282C>T STAD-US 19 36215889 36215889 single base substitution G T downstream_gene_variant STAD-US 19 36215889 36215889 single base substitution G T splice_acceptor_variant STAD-US 19 36215931 36215935 deletion of <=200bp CTGGA - downstream_gene_variant STAD-US 19 36215931 36215935 deletion of <=200bp CTGGA - frameshift_variant GWT1157 STAD-US 19 36215971 36215971 single base substitution G A downstream_gene_variant STAD-US 19 36215971 36215971 single base substitution G A missense_variant V1171I 3511G>A STAD-US 19 36215974 36215974 single base substitution C T downstream_gene_variant STAD-US 19 36215974 36215974 single base substitution C T missense_variant R1172C 3514C>T STAD-US 19 36216189 36216189 deletion of <=200bp C - downstream_gene_variant STAD-US 19 36216189 36216189 deletion of <=200bp C - frameshift_variant G1199 STAD-US 19 36216189 36216189 single base substitution C T downstream_gene_variant STAD-US 19 36216189 36216189 single base substitution C T synonymous_variant G1199G 3597C>T STAD-US 19 36216527 36216527 single base substitution G A downstream_gene_variant STAD-US 19 36216527 36216527 single base substitution G A splice_donor_variant STAD-US 19 36218396 36218396 single base substitution C A missense_variant P1392Q 4175C>A STAD-US 19 36218419 36218419 single base substitution C T missense_variant R1400C 4198C>T STAD-US 19 36218423 36218423 single base substitution G A stop_gained W1401* 4202G>A STAD-US 19 36218451 36218451 deletion of <=200bp G - frameshift_variant Q1410 STAD-US 19 36219029 36219029 single base substitution G A missense_variant A1510T 4528G>A STAD-US 19 36221296 36221296 single base substitution C T synonymous_variant F1710F 5130C>T STAD-US 19 36221488 36221488 single base substitution C T synonymous_variant C1749C 5247C>T STAD-US 19 36221615 36221615 single base substitution C T missense_variant R1762C 5284C>T STAD-US 19 36223002 36223002 deletion of <=200bp G - frameshift_variant L1877 STAD-US 19 36223276 36223276 single base substitution C A synonymous_variant P1942P 5826C>A STAD-US 19 36223432 36223432 single base substitution G A synonymous_variant A1994A 5982G>A STAD-US 19 36223476 36223476 single base substitution C T missense_variant A2009V 6026C>T STAD-US 19 36223858 36223858 deletion of <=200bp C - frameshift_variant L2136 STAD-US 19 36224532 36224532 single base substitution C T missense_variant R2332C 6994C>T STAD-US 19 36228041 36228041 single base substitution C T missense_variant A2476V 7427C>T STAD-US 19 36228111 36228111 single base substitution G A synonymous_variant Q2499Q 7497G>A STAD-US 19 36228635 36228635 deletion of <=200bp G - frameshift_variant R2550 STAD-US 19 36228995 36228995 single base substitution A G missense_variant K2592R 7775A>G STAD-US 19 36229028 36229028 single base substitution A C missense_variant E2603A 7808A>C STAD-US 19 36229073 36229075 deletion of <=200bp AGA - inframe_deletion EK2618E STAD-US 19 36229256 36229256 single base substitution G A missense_variant R2649H 7946G>A STAD-US 19 36229305 36229305 deletion of <=200bp C - frameshift_variant H2665 STAD-US 19 36229428 36229428 single base substitution C T synonymous_variant G2706G 8118C>T STAD-US 19 36230389 36230389 single base substitution G A downstream_gene_variant STAD-US 19 36230664 36230664 single base substitution A G downstream_gene_variant STAD-US 19 36230720 36230720 single base substitution G A downstream_gene_variant STAD-US 19 36231285 36231285 single base substitution C T downstream_gene_variant STAD-US 19 36232025 36232025 single base substitution C T downstream_gene_variant THCA-SA 19 36216448 36216448 single base substitution G A downstream_gene_variant THCA-SA 19 36216448 36216448 single base substitution G A synonymous_variant L1237L 3711G>A THCA-SA 19 36219702 36219702 single base substitution C T synonymous_variant P1533P 4599C>T THCA-SA 19 36230206 36230206 single base substitution C T downstream_gene_variant THCA-US 19 36206734 36206734 single base substitution T C upstream_gene_variant THCA-US 19 36212112 36212112 insertion of <=200bp - C frameshift_variant P621P? THCA-US 19 36212112 36212112 insertion of <=200bp - C intron_variant THCA-US 19 36219029 36219029 single base substitution G A missense_variant A1510T 4528G>A UCEC-US 19 36205877 36205877 single base substitution G A upstream_gene_variant UCEC-US 19 36205924 36205924 single base substitution G T upstream_gene_variant UCEC-US 19 36206715 36206715 single base substitution C T upstream_gene_variant UCEC-US 19 36210381 36210381 single base substitution G A missense_variant G125D 374G>A UCEC-US 19 36210704 36210704 single base substitution G A missense_variant R152Q 455G>A UCEC-US 19 36210721 36210721 insertion of <=200bp - CGAC frameshift_variant T158RH? UCEC-US 19 36210845 36210845 single base substitution G A missense_variant R199Q 596G>A UCEC-US 19 36210860 36210860 single base substitution A G missense_variant Q204R 611A>G UCEC-US 19 36211135 36211135 single base substitution G A missense_variant G296S 886G>A UCEC-US 19 36211366 36211366 single base substitution G T stop_gained E373* 1117G>T UCEC-US 19 36211495 36211495 single base substitution C A missense_variant P416T 1246C>A UCEC-US 19 36211520 36211520 single base substitution C A missense_variant P424H 1271C>A UCEC-US 19 36211575 36211575 single base substitution A G synonymous_variant P442P 1326A>G UCEC-US 19 36211625 36211625 single base substitution C A missense_variant P459H 1376C>A UCEC-US 19 36211742 36211742 single base substitution C A missense_variant T498N 1493C>A UCEC-US 19 36212024 36212024 insertion of <=200bp - CCCAGTT frameshift_variant T592TQF? UCEC-US 19 36212024 36212024 insertion of <=200bp - CCCAGTT intron_variant UCEC-US 19 36212061 36212061 single base substitution A G intron_variant UCEC-US 19 36212061 36212061 single base substitution A G synonymous_variant L604L 1812A>G UCEC-US 19 36212600 36212600 single base substitution C T downstream_gene_variant UCEC-US 19 36212600 36212600 single base substitution C T missense_variant P784L 2351C>T UCEC-US 19 36213980 36213980 single base substitution T C downstream_gene_variant UCEC-US 19 36213980 36213980 single base substitution T C missense_variant S936P 2806T>C UCEC-US 19 36214068 36214068 single base substitution G T downstream_gene_variant UCEC-US 19 36214068 36214068 single base substitution G T missense_variant R965L 2894G>T UCEC-US 19 36214082 36214082 single base substitution C T downstream_gene_variant UCEC-US 19 36214082 36214082 single base substitution C T missense_variant R970W 2908C>T UCEC-US 19 36216171 36216171 single base substitution C T downstream_gene_variant UCEC-US 19 36216171 36216171 single base substitution C T synonymous_variant L1193L 3579C>T UCEC-US 19 36216638 36216638 single base substitution C T downstream_gene_variant UCEC-US 19 36216638 36216638 single base substitution C T synonymous_variant C1268C 3804C>T UCEC-US 19 36216690 36216690 single base substitution A G downstream_gene_variant UCEC-US 19 36216690 36216690 single base substitution A G missense_variant T1286A 3856A>G UCEC-US 19 36217157 36217157 single base substitution C T downstream_gene_variant UCEC-US 19 36217157 36217157 single base substitution C T synonymous_variant R1302R 3906C>T UCEC-US 19 36217198 36217198 single base substitution T C downstream_gene_variant UCEC-US 19 36217198 36217198 single base substitution T C missense_variant V1316A 3947T>C UCEC-US 19 36218102 36218102 single base substitution A G missense_variant Y1350C 4049A>G UCEC-US 19 36218375 36218375 single base substitution C T missense_variant S1385L 4154C>T UCEC-US 19 36219002 36219002 single base substitution C T synonymous_variant L1501L 4501C>T UCEC-US 19 36219692 36219692 single base substitution C T missense_variant A1530V 4589C>T UCEC-US 19 36220070 36220070 single base substitution G A missense_variant R1597Q 4790G>A UCEC-US 19 36220075 36220075 single base substitution T G missense_variant L1599V 4795T>G UCEC-US 19 36220137 36220137 single base substitution C T synonymous_variant F1619F 4857C>T UCEC-US 19 36220140 36220140 single base substitution G T missense_variant E1620D 4860G>T UCEC-US 19 36220169 36220169 single base substitution A G missense_variant H1630R 4889A>G UCEC-US 19 36221279 36221279 single base substitution C T stop_gained R1705* 5113C>T UCEC-US 19 36221482 36221482 single base substitution G A synonymous_variant S1747S 5241G>A UCEC-US 19 36221616 36221616 single base substitution G A missense_variant R1762H 5285G>A UCEC-US 19 36221622 36221622 single base substitution A C missense_variant Y1764S 5291A>C UCEC-US 19 36221739 36221739 single base substitution C T missense_variant T1803I 5408C>T UCEC-US 19 36222878 36222878 single base substitution C T missense_variant S1836L 5507C>T UCEC-US 19 36222944 36222944 single base substitution G A missense_variant R1858H 5573G>A UCEC-US 19 36222961 36222961 single base substitution C T stop_gained R1864* 5590C>T UCEC-US 19 36222962 36222962 single base substitution G A missense_variant R1864Q 5591G>A UCEC-US 19 36223121 36223121 single base substitution C A missense_variant P1891T 5671C>A UCEC-US 19 36223430 36223430 single base substitution G A missense_variant A1994T 5980G>A UCEC-US 19 36223929 36223929 single base substitution C T missense_variant T2160I 6479C>T UCEC-US 19 36224407 36224407 single base substitution C T splice_region_variant UCEC-US 19 36224533 36224533 single base substitution G A missense_variant R2332H 6995G>A UCEC-US 19 36224759 36224759 single base substitution G A stop_gained W2382* 7145G>A UCEC-US 19 36227635 36227639 deletion of <=200bp AAAGA - frameshift_variant KE2402 UCEC-US 19 36227689 36227689 single base substitution A C missense_variant S2420R 7258A>C UCEC-US 19 36227817 36227817 single base substitution G A synonymous_variant A2434A 7302G>A UCEC-US 19 36228630 36228630 single base substitution G T missense_variant Q2548H 7644G>T UCEC-US 19 36228645 36228645 single base substitution G T splice_donor_variant UCEC-US 19 36228800 36228800 single base substitution C T missense_variant R2567C 7699C>T UCEC-US 19 36228979 36228979 single base substitution C T stop_gained R2587* 7759C>T UCEC-US 19 36229206 36229206 single base substitution C T synonymous_variant R2632R 7896C>T UCEC-US 19 36229209 36229209 single base substitution G T missense_variant M2633I 7899G>T UCEC-US 19 36229236 36229236 single base substitution G A synonymous_variant T2642T 7926G>A UCEC-US 19 36229292 36229292 single base substitution C T missense_variant S2661F 7982C>T UCEC-US 19 36229330 36229330 single base substitution A G missense_variant I2674V 8020A>G UCEC-US 19 36229345 36229345 single base substitution C T missense_variant R2679C 8035C>T UCEC-US 19 36229396 36229396 single base substitution G T missense_variant D2696Y 8086G>T UCEC-US 19 36229410 36229410 single base substitution G C missense_variant K2700N 8100G>C UCEC-US 19 36229444 36229444 single base substitution C T missense_variant R2712W 8134C>T UCEC-US 19 36229456 36229456 single base substitution T C stop_lost *2716R 8146T>C UCEC-US 19 36230495 36230495 single base substitution G A downstream_gene_variant UCEC-US 19 36230612 36230612 single base substitution C T downstream_gene_variant UCEC-US 19 36230802 36230802 single base substitution G A downstream_gene_variant UCEC-US 19 36230875 36230875 single base substitution C G downstream_gene_variant UCEC-US 19 36233612 36233612 single base substitution C T downstream_gene_variant UCEC-US 19 36234588 36234591 deletion of <=200bp AAAA - downstream_gene_variant

Mutation - IntOGen Mutated from(ref) Mutated to(alt) Consequence Type AA Mutation CDS Mutation Chr Pos Cancer AAAGA - Frameshift p.K2402Efs*18 c.7204_7208delAAAGA 19 36227635 UCEC A C Missense p.E2427A c.7280A>C 19 36227711 STAD A C Missense p.E2603A c.7808A>C 19 36229028 STAD A C Missense p.S2420R c.7258A>C 19 36227689 UCEC A C Missense p.Y1764S c.5291A>C 19 36221622 UCEC A C Synonymous p.P418P c.1254A>C 19 36211503 RCCC - A Frameshift p.A1404Gfs*274 c.4208dupA 19 36218429 HNSC AGA - InFrameDeletion p.K2619delK c.7855_7857delAAG 19 36229073 STAD A G Missense p.H1630R c.4889A>G 19 36220169 UCEC A G Missense p.K516E c.1546A>G 19 36211795 BLCA A G Missense p.N700S c.2099A>G 19 36212348 OV A G Missense p.N729S c.2186A>G 19 36212435 LUSC A G Missense p.Q204R c.611A>G 19 36210860 UCEC A T Missense p.I2113F c.6337A>T 19 36223787 CM CA GT Missense p.S135C c.402_403delinsGT 19 36210409 COREAD C A Missense p.A1233D c.3698C>A 19 36216435 STAD C A Missense p.A1616E c.4847C>A 19 36220127 LUSC C A Missense p.H1574Q c.4722C>A 19 36219920 LUSC C A Missense p.P160H c.479C>A 19 36210728 GBM C A Missense p.P416T c.1246C>A 19 36211495 UCEC C A Missense p.P459H c.1376C>A 19 36211625 UCEC C A Synonymous p.P1697P c.5091C>A 19 36221257 STAD C A Synonymous p.P1942P c.5826C>A 19 36223276 STAD - CCCAGTT Frameshift p.V594Sfs*7 c.1778_1779insCAGTTCC 19 36212025 UCEC CC TT Missense p.P1150L c.3449_3450delinsTT 19 36215909 CM CC TT Missense p.Q1492* c.4473_4474delinsTT 19 36218862 CM - C Frameshift p.A2187Rfs*23 c.6558dupC 19 36224006 RCCC - C Frameshift p.A624Sfs*52 c.1868dupC 19 36212113 THCA C - Frameshift p.P2138Rfs*15 c.6413delC 19 36223858 STAD C - Frameshift p.P2294Hfs*31 c.6881delC 19 36224327 GBM C - Frameshift p.P442Hfs*33 c.1325delC 19 36211573 COREAD - C Frameshift p.R1109Pfs*4 c.3325dupC 19 36214894 HNSC - C Frameshift p.R217Pfs*35 c.649dupC 19 36210893 COREAD - CGAC Frameshift p.T159Dfs*26 c.473_474insCGAC 19 36210722 UCEC C G Missense p.A1798G c.5393C>G 19 36221724 RCCC C G Missense p.P440A c.1318C>G 19 36211567 RCCC C G Missense p.S1069C c.3206C>G 19 36214780 GBM C G Synonymous p.T1484T c.4452C>G 19 36218841 CM C T Missense p.A1397V c.4190C>T 19 36218411 LGG C T Missense p.A1649V c.4946C>T 19 36220896 CM C T Missense p.A2009V c.6026C>T 19 36223476 STAD C T Missense p.A2103V c.6308C>T 19 36223758 LUSC C T Missense p.H1226Y c.3676C>T 19 36216413 CM C T Missense p.L1379F c.4135C>T 19 36218356 CM C T Missense p.L1583F c.4747C>T 19 36219945 RCCC C T Missense p.L1939F c.5815C>T 19 36223265 CM C T Missense p.L2714F c.8140C>T 19 36229450 ESCA C T Missense p.P1040S c.3118C>T 19 36214692 CM C T Missense p.P1326L c.3977C>T 19 36217228 CM C T Missense p.P162S c.484C>T 19 36210733 HNSC C T Missense p.P171S c.511C>T 19 36210760 CM C T Missense p.P1854L c.5561C>T 19 36222932 CM C T Missense p.P1909S c.5725C>T 19 36223175 CM C T Missense p.P1944S c.5830C>T 19 36223280 CM C T Missense p.P302L c.905C>T 19 36211154 CM C T Missense p.P595S c.1783C>T 19 36212032 STAD C T Missense p.P919S c.2755C>T 19 36213929 CM C T Missense p.R1172C c.3514C>T 19 36215974 STAD C T Missense p.R1400C c.4198C>T 19 36218419 STAD C T Missense p.R1414C c.4240C>T 19 36218461 MB C T Missense p.R1762C c.5284C>T 19 36221615 STAD C T Missense p.R2567C c.7699C>T 19 36228800 UCEC C T Missense p.R2679C c.8035C>T 19 36229345 UCEC C T Missense p.R535C c.1603C>T 19 36211852 STAD C T Missense p.R694W c.2080C>T 19 36212329 GBM C T Missense p.R970W c.2908C>T 19 36214082 UCEC C T Missense p.S1069F c.3206C>T 19 36214780 BRCA C T Missense p.S1423F c.4268C>T 19 36218489 CM C T Missense p.S1734F c.5201C>T 19 36221442 CM C T Missense p.S1946L c.5837C>T 19 36223287 BLCA C T Missense p.S2086L c.6257C>T 19 36223707 CM C T Missense p.S2111L c.6332C>T 19 36223782 CM C T Missense p.S2661F c.7982C>T 19 36229292 UCEC C T Nonsense p.Q1441* c.4321C>T 19 36218617 CM C T Nonsense p.Q1492* c.4474C>T 19 36218863 CM C T Nonsense p.Q2499* c.7495C>T 19 36228109 ESCA C T Nonsense p.Q329* c.985C>T 19 36211234 BLCA C T Nonsense p.R1705* c.5113C>T 19 36221279 UCEC C T Nonsense p.R1864* c.5590C>T 19 36222961 UCEC C T Nonsense p.R2587* c.7759C>T 19 36228979 LUAD C T Synonymous p.D1823D c.5469C>T 19 36222840 GBM C T Synonymous p.F1564F c.4692C>T 19 36219890 BLCA C T Synonymous p.F707F c.2121C>T 19 36212370 CM C T Synonymous p.H1478H c.4434C>T 19 36218823 CM C T Synonymous p.H1608H c.4824C>T 19 36220104 BRCA C T Synonymous p.H968H c.2904C>T 19 36214078 STAD C T Synonymous p.I1865I c.5595C>T 19 36222966 CM C T Synonymous p.L1070L c.3210C>T 19 36214784 CM C T Synonymous p.L1193L c.3579C>T 19 36216171 UCEC C T Synonymous p.L1501L c.4501C>T 19 36219002 UCEC C T Synonymous p.L2475L c.7423C>T 19 36228037 CM C T Synonymous p.N729N c.2187C>T 19 36212436 HNSC C T Synonymous p.P1064P c.3192C>T 19 36214766 CM C T Synonymous p.P248P c.744C>T 19 36210993 CM C T Synonymous p.P750P c.2250C>T 19 36212499 LUAD C T Synonymous p.R1302R c.3906C>T 19 36217157 UCEC C T Synonymous p.T1243T c.3729C>T 19 36216466 HNSC G A Missense p.A1510T c.4528G>A 19 36219029 THCA G A Missense p.A676T c.2026G>A 19 36212275 HNSC G A Missense p.D1438N c.4312G>A 19 36218608 LUAD G A Missense p.D1687N c.5059G>A 19 36221009 BLCA G A Missense p.E1182K c.3544G>A 19 36216136 BRCA G A Missense p.G125D c.374G>A 19 36210381 UCEC G A Missense p.G1335R c.4003G>A 19 36217254 CM G A Missense p.G1648D c.4943G>A 19 36220893 CM G A Missense p.G2466S c.7396G>A 19 36228010 CM G A Missense p.G958S c.2872G>A 19 36214046 ESCA G A Missense p.R1078H c.3233G>A 19 36214807 CM G A Missense p.R1235Q c.3704G>A 19 36216441 LGG G A Missense p.R150Q c.449G>A 19 36210698 COREAD G A Missense p.R154H c.461G>A 19 36210710 STAD G A Missense p.R1597Q c.4790G>A 19 36220070 UCEC G A Missense p.R199Q c.596G>A 19 36210845 UCEC G A Missense p.R2332H c.6995G>A 19 36224533 UCEC G A Missense p.R2450Q c.7349G>A 19 36227864 CM G A Missense p.R2649H c.7946G>A 19 36229256 HNSC G A Missense p.R843Q c.2528G>A 19 36213331 STAD G A Missense p.R867H c.2600G>A 19 36213498 LUSC G A Missense p.R962H c.2885G>A 19 36214059 BLCA G A Missense p.S703N c.2108G>A 19 36212357 GBM G A Missense p.V1609I c.4825G>A 19 36220105 BRCA G A Nonsense p.W1314* c.3941G>A 19 36217192 CM G A Nonsense p.W2382* c.7145G>A 19 36224759 UCEC G A SpliceDonorSNV . c.3789+1G>A 19 36216527 STAD G A Synonymous p.A2462A c.7386G>A 19 36228000 BRCA G A Synonymous p.E1317E c.3951G>A 19 36217202 CM G A Synonymous p.E558E c.1674G>A 19 36211923 LUAD G A Synonymous p.G1588G c.4764G>A 19 36219962 GBM G A Synonymous p.P1963P c.5889G>A 19 36223339 LUSC G A Synonymous p.V1426V c.4278G>A 19 36218499 OV G C Missense p.D131H c.391G>C 19 36210398 BRCA G C Missense p.D2069H c.6205G>C 19 36223655 LUSC G C Missense p.E2006Q c.6016G>C 19 36223466 BLCA G C Missense p.G2447A c.7340G>C 19 36227855 ESCA G C Missense p.G322A c.965G>C 19 36211214 BRCA G C Missense p.K2700N c.8100G>C 19 36229410 UCEC G C Missense p.K716N c.2148G>C 19 36212397 BLCA G C SpliceDonorSNV . c.7742+1G>C 19 36228844 HNSC G C Synonymous p.L1405L c.4215G>C 19 36218436 BLCA G C Synonymous p.L1405L c.4215G>C 19 36218436 LUSC G - Frameshift p.G1879Vfs*16 c.5636delG 19 36223002 STAD GGGCCTGCGCCAGGTGCTCCA - InFrameDeletion p.R1414_L1420delRQVLQGL c.4241_4261delGCCAGGTGCTCCAGGGCCTGC 19 36218454 HNSC G T Missense p.A192S c.574G>T 19 36210823 LUSC G T Missense p.D2640Y c.7918G>T 19 36229228 BRCA G T Missense p.G1636W c.4906G>T 19 36220186 CLL G T Missense p.G2080C c.6238G>T 19 36223688 LUAD G T Missense p.R1327S c.3981G>T 19 36217232 HNSC G T Missense p.S2391I c.7172G>T 19 36227603 LUAD G T Nonsense p.E1377* c.4129G>T 19 36218350 LUSC G T Nonsense p.E1605* c.4813G>T 19 36220093 BRCA G T Nonsense p.E1711* c.5131G>T 19 36221297 STAD G T Nonsense p.E2027* c.6079G>T 19 36223529 CM G T Nonsense p.E373* c.1117G>T 19 36211366 UCEC G T SpliceAcceptorSNV . c.3430-1G>T 19 36215889 STAD G T SpliceDonorSNV . c.3334+1G>T 19 36214909 HNSC G T SpliceDonorSNV . c.4687+1G>T 19 36219791 CM G T SpliceDonorSNV . c.7658+1G>T 19 36228645 UCEC G T Synonymous p.V2039V c.6117G>T 19 36223567 OV T A Missense p.L2136H c.6407T>A 19 36223857 GBM T C 3-UTRSNV . c.8145+1T>C 19 36229456 UCEC T C Missense p.S936P c.2806T>C 19 36213980 UCEC T C Synonymous p.C1297C c.3891T>C 19 36217142 HNSC T C Synonymous p.H332H c.996T>C 19 36211245 OV T - Frameshift p.N1156Mfs*26 c.3462delT 19 36215919 HNSC T - Frameshift p.V1132Cfs*50 c.3393delT 19 36215596 CM TGGCCCC - Frameshift p.G1149Lfs*31 c.3445_3451delGGCCCCT 19 36215897 HNSC TG GT Missense p.W336V c.1006_1007delinsGT 19 36211255 CM