Mutation - TCGA Type Chromosome Start Position End Position Strand Variant Classification Variant Type Reference Allele Tumor_seq Allele 1 Tumor_seq Allele 2 Tumor Sample Barcode Matched Norm Sample Barcode Genome Change cDNA Change Codon Change Protein Change ACC 8 145158503 145158503 + Silent SNP G G T TCGA-OR-A5JF-01A-11D-A29I-10 TCGA-OR-A5JF-10A-01D-A29L-10 g.chr8:145158503G>T c.154C>A c.(154-156)Cgg>Agg p.R52R ACC 8 145158503 145158503 + Silent SNP G G T TCGA-OR-A5JI-01A-11D-A29I-10 TCGA-OR-A5JI-10A-01D-A29L-10 g.chr8:145158503G>T c.154C>A c.(154-156)Cgg>Agg p.R52R ACC 8 145158503 145158503 + Silent SNP G G T TCGA-OR-A5L1-01A-11D-A30A-10 TCGA-OR-A5L1-10A-01D-A30A-10 g.chr8:145158503G>T c.154C>A c.(154-156)Cgg>Agg p.R52R BLCA 8 145153856 145153856 + Silent SNP T T C TCGA-G2-AA3F-01A-12D-A42E-08 TCGA-G2-AA3F-10A-01D-A42H-08 g.chr8:145153856T>C c.1089A>G c.(1087-1089)ccA>ccG p.P363P BLCA 8 145154091 145154091 + Nonsense_Mutation SNP G G A TCGA-FD-A3SJ-01A-12D-A22Z-08 TCGA-FD-A3SJ-10A-01D-A22Z-08 g.chr8:145154091G>A c.940C>T c.(940-942)Cag>Tag p.Q314* BLCA 8 145154703 145154703 + Missense_Mutation SNP C C T TCGA-FD-A43P-01A-31D-A23U-08 TCGA-FD-A43P-10A-01D-A23U-08 g.chr8:145154703C>T c.562G>A c.(562-564)Gag>Aag p.E188K BRCA 8 145154196 145154196 + Silent SNP A A C TCGA-AN-A0XP-01A-11D-A117-09 TCGA-AN-A0XP-10A-01D-A10G-09 g.chr8:145154196A>C c.906T>G c.(904-906)gcT>gcG p.A302A BRCA 8 145154289 145154289 + Silent SNP G G A TCGA-BH-A0H5-01A-21D-A10Y-09 TCGA-BH-A0H5-11A-62D-A10Y-09 g.chr8:145154289G>A c.813C>T c.(811-813)gtC>gtT p.V271V BRCA 8 145154965 145154965 + Missense_Mutation SNP C C G TCGA-A2-A0CR-01A-11D-A228-09 TCGA-A2-A0CR-10A-01D-A22A-09 g.chr8:145154965C>G c.384G>C c.(382-384)aaG>aaC p.K128N CESC 8 145153884 145153884 + Missense_Mutation SNP C C T TCGA-IR-A3LL-01A-11D-A20U-09 TCGA-IR-A3LL-10A-01D-A20U-09 g.chr8:145153884C>T c.1061G>A c.(1060-1062)tGt>tAt p.C354Y CESC 8 145154745 145154745 + Missense_Mutation SNP C C G TCGA-C5-A1BQ-01C-11D-A20U-09 TCGA-C5-A1BQ-10A-01D-A20U-09 g.chr8:145154745C>G c.520G>C c.(520-522)Gag>Cag p.E174Q CESC 8 145158082 145158082 + Missense_Mutation SNP C C T TCGA-Q1-A73O-01A-11D-A32I-09 TCGA-Q1-A73O-10B-01D-A32I-09 g.chr8:145158082C>T c.248G>A c.(247-249)gGc>gAc p.G83D COAD 8 145154661 145154661 + Missense_Mutation SNP G G A TCGA-G4-6628-01A-11D-1835-10 TCGA-G4-6628-10A-01D-1835-10 g.chr8:145154661G>A c.604C>T c.(604-606)Cgt>Tgt p.R202C COADREAD 8 145154661 145154661 + Missense_Mutation SNP G G A TCGA-G4-6628-01A-11D-1835-10 TCGA-G4-6628-10A-01D-1835-10 g.chr8:145154661G>A c.604C>T c.(604-606)Cgt>Tgt p.R202C ESCA 8 145154264 145154264 + Missense_Mutation SNP C C G TCGA-R6-A6Y0-01B-11D-A33E-09 TCGA-R6-A6Y0-10A-01D-A33H-09 g.chr8:145154264C>G c.838G>C c.(838-840)Gag>Cag p.E280Q ESCA 8 145154929 145154929 + Nonsense_Mutation SNP G G T TCGA-R6-A8W8-01B-11D-A37C-09 TCGA-R6-A8W8-10A-01D-A37F-09 g.chr8:145154929G>T c.420C>A c.(418-420)tgC>tgA p.C140* ESCA 8 145154940 145154940 + Missense_Mutation SNP G G T TCGA-L7-A6VZ-01A-12D-A33E-09 TCGA-L7-A6VZ-10A-01D-A33H-09 g.chr8:145154940G>T c.409C>A c.(409-411)Cca>Aca p.P137T GBMLGG 8 145153817 145153817 + Silent SNP G G T TCGA-DU-6392-01A-11D-1705-08 TCGA-DU-6392-10A-01D-1705-08 g.chr8:145153817G>T c.1128C>A c.(1126-1128)ccC>ccA p.P376P GBMLGG 8 145154071 145154071 + Silent SNP G G A TCGA-DU-6392-01A-11D-1705-08 TCGA-DU-6392-10A-01D-1705-08 g.chr8:145154071G>A c.960C>T c.(958-960)gaC>gaT p.D320D GBMLGG 8 145154909 145154909 + Missense_Mutation SNP G G A TCGA-DH-A66G-01A-21D-A31L-08 TCGA-DH-A66G-10A-01D-A31J-08 g.chr8:145154909G>A c.440C>T c.(439-441)cCc>cTc p.P147L HNSC 8 145154029 145154029 + Silent SNP G G A TCGA-CQ-6224-01A-11D-1912-08 TCGA-CQ-6224-10A-01D-1912-08 g.chr8:145154029G>A c.1002C>T c.(1000-1002)ccC>ccT p.P334P HNSC 8 145154328 145154328 + Silent SNP G G A TCGA-CV-7406-01A-11D-2078-08 TCGA-CV-7406-10A-01D-2078-08 g.chr8:145154328G>A c.774C>T c.(772-774)ttC>ttT p.F258F HNSC 8 145154650 145154650 + Silent SNP C C G TCGA-D6-6824-01A-11D-1912-08 TCGA-D6-6824-10A-01D-1912-08 g.chr8:145154650C>G c.615G>C c.(613-615)ctG>ctC p.L205L KIPAN 8 145154959 145154959 + Missense_Mutation SNP G G C TCGA-BP-4163-01A-02D-1386-10 TCGA-BP-4163-11A-01D-1251-10 g.chr8:145154959G>C c.390C>G c.(388-390)aaC>aaG p.N130K KIRC 8 145154959 145154959 + Missense_Mutation SNP G G C TCGA-BP-4163-01A-02D-1386-10 TCGA-BP-4163-11A-01D-1251-10 g.chr8:145154959G>C c.390C>G c.(388-390)aaC>aaG p.N130K LGG 8 145153817 145153817 + Silent SNP G G T TCGA-DU-6392-01A-11D-1705-08 TCGA-DU-6392-10A-01D-1705-08 g.chr8:145153817G>T c.1128C>A c.(1126-1128)ccC>ccA p.P376P LGG 8 145154071 145154071 + Silent SNP G G A TCGA-DU-6392-01A-11D-1705-08 TCGA-DU-6392-10A-01D-1705-08 g.chr8:145154071G>A c.960C>T c.(958-960)gaC>gaT p.D320D LGG 8 145154909 145154909 + Missense_Mutation SNP G G A TCGA-DH-A66G-01A-21D-A31L-08 TCGA-DH-A66G-10A-01D-A31J-08 g.chr8:145154909G>A c.440C>T c.(439-441)cCc>cTc p.P147L LUAD 8 145153865 145153865 + Silent SNP G G A TCGA-55-A4DF-01A-11D-A24D-08 TCGA-55-A4DF-10A-01D-A24F-08 g.chr8:145153865G>A c.1080C>T c.(1078-1080)atC>atT p.I360I LUAD 8 145154200 145154200 + Missense_Mutation SNP G G A TCGA-55-A4DF-01A-11D-A24D-08 TCGA-55-A4DF-10A-01D-A24F-08 g.chr8:145154200G>A c.902C>T c.(901-903)tCa>tTa p.S301L LUAD 8 145154326 145154326 + Missense_Mutation SNP G G A TCGA-55-A4DF-01A-11D-A24D-08 TCGA-55-A4DF-10A-01D-A24F-08 g.chr8:145154326G>A c.776C>T c.(775-777)tCa>tTa p.S259L LUAD 8 145158011 145158011 + Missense_Mutation SNP G G C TCGA-50-5935-01A-11D-1753-08 TCGA-50-5935-11A-01D-1753-08 g.chr8:145158011G>C c.319C>G c.(319-321)Cag>Gag p.Q107E LUSC 8 145154057 145154057 + Missense_Mutation SNP C C T TCGA-66-2767-01A-01D-1522-08 TCGA-66-2767-11A-01D-1522-08 g.chr8:145154057C>T c.974G>A c.(973-975)cGc>cAc p.R325H OV 8 145153859 145153859 + Silent SNP G G A TCGA-23-1022-01A-02W-0488-09 TCGA-23-1022-10A-01W-0488-09 g.chr8:145153859G>A c.1086C>T c.(1084-1086)gcC>gcT p.A362A OV 8 145154282 145154282 + Missense_Mutation SNP G G A TCGA-23-2645-01A-01W-1091-09 TCGA-23-2645-10A-01W-1091-09 g.chr8:145154282G>A c.820C>T c.(820-822)Cgg>Tgg p.R274W PAAD 8 145154701 145154701 + Missense_Mutation SNP C C G TCGA-HZ-7918-01A-11D-2154-08 TCGA-HZ-7918-10A-01D-2154-08 g.chr8:145154701C>G c.564G>C c.(562-564)gaG>gaC p.E188D PRAD 8 145154289 145154289 + Silent SNP G G A TCGA-ZG-A9KY-01A-11D-A41K-08 TCGA-ZG-A9KY-10A-01D-A41N-08 g.chr8:145154289G>A c.813C>T c.(811-813)gtC>gtT p.V271V SARC 8 145154476 145154476 + Silent SNP C C T TCGA-VT-AB3D-01A-12D-A417-09 TCGA-VT-AB3D-10A-01D-A41A-09 g.chr8:145154476C>T c.705G>A c.(703-705)gcG>gcA p.A235A SARC 8 145154939 145154939 + Missense_Mutation SNP G G A TCGA-DX-A8BJ-01A-11D-A417-09 TCGA-DX-A8BJ-10B-01D-A41A-09 g.chr8:145154939G>A c.410C>T c.(409-411)cCa>cTa p.P137L SKCM 8 145153831 145153831 + Missense_Mutation SNP T T A TCGA-D3-A3BZ-06A-12D-A196-08 TCGA-D3-A3BZ-10A-01D-A198-08 g.chr8:145153831T>A c.1114A>T c.(1114-1116)Agc>Tgc p.S372C SKCM 8 145154268 145154269 + Frame_Shift_Del DEL CA CA - TCGA-EE-A3JI-06A-11D-A21A-08 TCGA-EE-A3JI-10A-01D-A21A-08 g.chr8:145154268_145154269delCA c.833_834delTG c.(832-834)gtgfs p.V278fs

Mutation - ICGC Project Code Chromosome Chromosome Start Chromosome End Mutation Type Mutated from Allele Mutated to Allele Consequence Type AA Mutation CDS Mutation BLCA-CN 8 145152017 145152017 single base substitution C T downstream_gene_variant BLCA-CN 8 145154147 145154147 single base substitution A C downstream_gene_variant BLCA-CN 8 145154147 145154147 single base substitution A C intron_variant BLCA-CN 8 145154488 145154488 single base substitution G A downstream_gene_variant BLCA-CN 8 145154488 145154488 single base substitution G A exon_variant BLCA-CN 8 145154488 145154488 single base substitution G A synonymous_variant A231A 693C>T BLCA-CN 8 145154488 145154488 single base substitution G A upstream_gene_variant BLCA-CN 8 145158073 145158073 single base substitution T A exon_variant BLCA-CN 8 145158073 145158073 single base substitution T A missense_variant Q86L 257A>T BLCA-CN 8 145158073 145158073 single base substitution T A upstream_gene_variant BLCA-CN 8 145161364 145161364 single base substitution A G intron_variant BLCA-CN 8 145161364 145161364 single base substitution A G upstream_gene_variant BLCA-US 8 145151087 145151087 single base substitution C T downstream_gene_variant BLCA-US 8 145152190 145152190 single base substitution A G downstream_gene_variant BLCA-US 8 145154091 145154091 single base substitution G A downstream_gene_variant BLCA-US 8 145154091 145154091 single base substitution G A intron_variant BLCA-US 8 145154091 145154091 single base substitution G A stop_gained Q22* 64C>T BLCA-US 8 145154091 145154091 single base substitution G A stop_gained Q314* 940C>T BLCA-US 8 145161270 145161270 single base substitution C A intron_variant BLCA-US 8 145161270 145161270 single base substitution C A upstream_gene_variant BOCA-FR 8 145149869 145149869 single base substitution C T downstream_gene_variant BOCA-FR 8 145163035 145163035 single base substitution G A upstream_gene_variant BRCA-EU 8 145148879 145148879 single base substitution A T downstream_gene_variant BRCA-EU 8 145149935 145149935 single base substitution C G downstream_gene_variant BRCA-EU 8 145150084 145150084 single base substitution C T downstream_gene_variant BRCA-EU 8 145152937 145152937 single base substitution C A downstream_gene_variant BRCA-EU 8 145153802 145153802 single base substitution G A 3_prime_UTR_variant BRCA-EU 8 145153802 145153802 single base substitution G A downstream_gene_variant BRCA-EU 8 145153802 145153802 single base substitution G A synonymous_variant P381P 1143C>T BRCA-EU 8 145153802 145153802 single base substitution G A synonymous_variant P89P 267C>T BRCA-EU 8 145154512 145154512 single base substitution G C downstream_gene_variant BRCA-EU 8 145154512 145154512 single base substitution G C exon_variant BRCA-EU 8 145154512 145154512 single base substitution G C synonymous_variant V223V 669C>G BRCA-EU 8 145154512 145154512 single base substitution G C upstream_gene_variant BRCA-EU 8 145156413 145156413 single base substitution G A downstream_gene_variant BRCA-EU 8 145156413 145156413 single base substitution G A intron_variant BRCA-EU 8 145156413 145156413 single base substitution G A upstream_gene_variant BRCA-EU 8 145156517 145156517 single base substitution C A downstream_gene_variant BRCA-EU 8 145156517 145156517 single base substitution C A intron_variant BRCA-EU 8 145156517 145156517 single base substitution C A upstream_gene_variant BRCA-EU 8 145156654 145156654 single base substitution C G downstream_gene_variant BRCA-EU 8 145156654 145156654 single base substitution C G intron_variant BRCA-EU 8 145156654 145156654 single base substitution C G upstream_gene_variant BRCA-EU 8 145157269 145157269 single base substitution G A downstream_gene_variant BRCA-EU 8 145157269 145157269 single base substitution G A intron_variant BRCA-EU 8 145157269 145157269 single base substitution G A upstream_gene_variant BRCA-EU 8 145157993 145157993 deletion of <=200bp C - downstream_gene_variant BRCA-EU 8 145157993 145157993 deletion of <=200bp C - exon_variant BRCA-EU 8 145157993 145157993 deletion of <=200bp C - frameshift_variant A113 BRCA-EU 8 145157993 145157993 deletion of <=200bp C - upstream_gene_variant BRCA-EU 8 145157997 145157997 single base substitution C A downstream_gene_variant BRCA-EU 8 145157997 145157997 single base substitution C A exon_variant BRCA-EU 8 145157997 145157997 single base substitution C A synonymous_variant R111R 333G>T BRCA-EU 8 145157997 145157997 single base substitution C A upstream_gene_variant BRCA-EU 8 145158573 145158573 single base substitution C G exon_variant BRCA-EU 8 145158573 145158573 single base substitution C G intron_variant BRCA-EU 8 145158573 145158573 single base substitution C G synonymous_variant V28V 84G>C BRCA-EU 8 145158573 145158573 single base substitution C G upstream_gene_variant BRCA-EU 8 145158619 145158619 single base substitution G A exon_variant BRCA-EU 8 145158619 145158619 single base substitution G A intron_variant BRCA-EU 8 145158619 145158619 single base substitution G A missense_variant S13L 38C>T BRCA-EU 8 145158619 145158619 single base substitution G A upstream_gene_variant BRCA-EU 8 145159104 145159104 single base substitution C A 5_prime_UTR_premature_start_codon_gain_variant BRCA-EU 8 145159104 145159104 single base substitution C A exon_variant BRCA-EU 8 145159104 145159104 single base substitution C A intron_variant BRCA-EU 8 145159104 145159104 single base substitution C A upstream_gene_variant BRCA-EU 8 145160082 145160082 single base substitution C G intron_variant BRCA-EU 8 145160082 145160082 single base substitution C G upstream_gene_variant BRCA-EU 8 145161762 145161762 single base substitution G C intron_variant BRCA-EU 8 145161762 145161762 single base substitution G C upstream_gene_variant BRCA-EU 8 145162939 145162939 single base substitution G A exon_variant BRCA-EU 8 145162939 145162939 single base substitution G A upstream_gene_variant BRCA-EU 8 145163416 145163416 single base substitution G T upstream_gene_variant BRCA-EU 8 145163682 145163682 single base substitution C A upstream_gene_variant BRCA-EU 8 145163786 145163786 single base substitution G A upstream_gene_variant BRCA-EU 8 145164614 145164614 single base substitution G A upstream_gene_variant BRCA-EU 8 145165448 145165448 single base substitution G A upstream_gene_variant BRCA-EU 8 145165952 145165952 single base substitution G T upstream_gene_variant BRCA-EU 8 145166212 145166212 single base substitution G C upstream_gene_variant BRCA-EU 8 145166243 145166243 single base substitution G A upstream_gene_variant BRCA-EU 8 145166951 145166951 single base substitution G A upstream_gene_variant BRCA-FR 8 145148879 145148879 single base substitution A T downstream_gene_variant BRCA-FR 8 145156517 145156517 single base substitution C A downstream_gene_variant BRCA-FR 8 145156517 145156517 single base substitution C A intron_variant BRCA-FR 8 145156517 145156517 single base substitution C A upstream_gene_variant BRCA-FR 8 145158573 145158573 single base substitution C G exon_variant BRCA-FR 8 145158573 145158573 single base substitution C G intron_variant BRCA-FR 8 145158573 145158573 single base substitution C G synonymous_variant V28V 84G>C BRCA-FR 8 145158573 145158573 single base substitution C G upstream_gene_variant BRCA-FR 8 145164081 145164081 single base substitution G C upstream_gene_variant BRCA-KR 8 145165591 145165591 single base substitution C G upstream_gene_variant BRCA-KR 8 145167022 145167022 single base substitution G A upstream_gene_variant BRCA-US 8 145151386 145151386 single base substitution C T downstream_gene_variant BRCA-US 8 145151520 145151520 single base substitution C T downstream_gene_variant BRCA-US 8 145154196 145154196 single base substitution A C downstream_gene_variant BRCA-US 8 145154196 145154196 single base substitution A C exon_variant BRCA-US 8 145154196 145154196 single base substitution A C synonymous_variant A10A 30T>G BRCA-US 8 145154196 145154196 single base substitution A C synonymous_variant A302A 906T>G BRCA-US 8 145154289 145154289 single base substitution G A downstream_gene_variant BRCA-US 8 145154289 145154289 single base substitution G A exon_variant BRCA-US 8 145154289 145154289 single base substitution G A synonymous_variant V271V 813C>T BRCA-US 8 145154289 145154289 single base substitution G A upstream_gene_variant BRCA-US 8 145154965 145154965 single base substitution C G downstream_gene_variant BRCA-US 8 145154965 145154965 single base substitution C G exon_variant BRCA-US 8 145154965 145154965 single base substitution C G missense_variant K128N 384G>C BRCA-US 8 145154965 145154965 single base substitution C G upstream_gene_variant BRCA-US 8 145160613 145160613 single base substitution T C intron_variant BRCA-US 8 145160613 145160613 single base substitution T C upstream_gene_variant BRCA-US 8 145161369 145161369 single base substitution T G intron_variant BRCA-US 8 145161369 145161369 single base substitution T G upstream_gene_variant BRCA-US 8 145161923 145161923 single base substitution T G intron_variant BRCA-US 8 145161923 145161923 single base substitution T G upstream_gene_variant BRCA-US 8 145162933 145162933 single base substitution G T exon_variant BRCA-US 8 145162933 145162933 single base substitution G T upstream_gene_variant BTCA-JP 8 145151666 145151667 deletion of <=200bp GG - downstream_gene_variant BTCA-JP 8 145155019 145155019 single base substitution C T downstream_gene_variant BTCA-JP 8 145155019 145155019 single base substitution C T intron_variant BTCA-JP 8 145155019 145155019 single base substitution C T upstream_gene_variant BTCA-JP 8 145158139 145158139 single base substitution G T intron_variant BTCA-JP 8 145158139 145158139 single base substitution G T upstream_gene_variant BTCA-JP 8 145160567 145160567 single base substitution G A intron_variant BTCA-JP 8 145160567 145160567 single base substitution G A upstream_gene_variant BTCA-JP 8 145160716 145160716 single base substitution G A exon_variant BTCA-JP 8 145160716 145160716 single base substitution G A upstream_gene_variant BTCA-JP 8 145162571 145162571 single base substitution A G intron_variant BTCA-JP 8 145162571 145162571 single base substitution A G upstream_gene_variant BTCA-JP 8 145163519 145163519 single base substitution C T upstream_gene_variant BTCA-JP 8 145164265 145164265 single base substitution C T upstream_gene_variant BTCA-JP 8 145164716 145164716 single base substitution C A upstream_gene_variant BTCA-JP 8 145164945 145164945 single base substitution C T upstream_gene_variant BTCA-JP 8 145164992 145164992 single base substitution G A upstream_gene_variant BTCA-JP 8 145166669 145166669 single base substitution C T upstream_gene_variant CESC-US 8 145151377 145151377 single base substitution C G downstream_gene_variant CESC-US 8 145153884 145153884 single base substitution C T downstream_gene_variant CESC-US 8 145153884 145153884 single base substitution C T exon_variant CESC-US 8 145153884 145153884 single base substitution C T missense_variant C354Y 1061G>A CESC-US 8 145153884 145153884 single base substitution C T missense_variant C62Y 185G>A CESC-US 8 145154745 145154745 single base substitution C G downstream_gene_variant CESC-US 8 145154745 145154745 single base substitution C G missense_variant E174Q 520G>C CESC-US 8 145154745 145154745 single base substitution C G splice_region_variant CESC-US 8 145154745 145154745 single base substitution C G upstream_gene_variant CESC-US 8 145158082 145158082 single base substitution C T exon_variant CESC-US 8 145158082 145158082 single base substitution C T missense_variant G83D 248G>A CESC-US 8 145158082 145158082 single base substitution C T upstream_gene_variant CESC-US 8 145160643 145160643 single base substitution G A exon_variant CESC-US 8 145160643 145160643 single base substitution G A upstream_gene_variant CESC-US 8 145160803 145160803 single base substitution G A intron_variant CESC-US 8 145160803 145160803 single base substitution G A upstream_gene_variant CESC-US 8 145163617 145163617 single base substitution G T upstream_gene_variant CESC-US 8 145163767 145163767 single base substitution C T upstream_gene_variant CESC-US 8 145164292 145164292 single base substitution C T upstream_gene_variant CESC-US 8 145166328 145166328 single base substitution G T upstream_gene_variant CLLE-ES 8 145167200 145167200 single base substitution G A upstream_gene_variant COAD-US 8 145150101 145150101 single base substitution T G downstream_gene_variant COAD-US 8 145150875 145150875 insertion of <=200bp - C downstream_gene_variant COAD-US 8 145150876 145150876 deletion of <=200bp C - downstream_gene_variant COAD-US 8 145151144 145151144 single base substitution G C downstream_gene_variant COAD-US 8 145154661 145154661 single base substitution G A downstream_gene_variant COAD-US 8 145154661 145154661 single base substitution G A exon_variant COAD-US 8 145154661 145154661 single base substitution G A missense_variant R202C 604C>T COAD-US 8 145154661 145154661 single base substitution G A upstream_gene_variant COAD-US 8 145158503 145158503 single base substitution G T exon_variant COAD-US 8 145158503 145158503 single base substitution G T intron_variant COAD-US 8 145158503 145158503 single base substitution G T synonymous_variant R52R 154C>A COAD-US 8 145158503 145158503 single base substitution G T upstream_gene_variant COAD-US 8 145161278 145161278 single base substitution A G intron_variant COAD-US 8 145161278 145161278 single base substitution A G upstream_gene_variant COAD-US 8 145161286 145161286 single base substitution G A intron_variant COAD-US 8 145161286 145161286 single base substitution G A upstream_gene_variant COCA-CN 8 145150789 145150789 single base substitution G A downstream_gene_variant COCA-CN 8 145151349 145151349 single base substitution C A downstream_gene_variant COCA-CN 8 145151693 145151693 single base substitution A C downstream_gene_variant COCA-CN 8 145153041 145153041 single base substitution G A downstream_gene_variant COCA-CN 8 145153801 145153801 single base substitution G A 3_prime_UTR_variant COCA-CN 8 145153801 145153801 single base substitution G A downstream_gene_variant COCA-CN 8 145153801 145153801 single base substitution G A missense_variant L382F 1144C>T COCA-CN 8 145153801 145153801 single base substitution G A missense_variant L90F 268C>T COCA-CN 8 145154812 145154812 single base substitution C A downstream_gene_variant COCA-CN 8 145154812 145154812 single base substitution C A intron_variant COCA-CN 8 145154812 145154812 single base substitution C A upstream_gene_variant COCA-CN 8 145158018 145158018 single base substitution G A downstream_gene_variant COCA-CN 8 145158018 145158018 single base substitution G A exon_variant COCA-CN 8 145158018 145158018 single base substitution G A synonymous_variant L104L 312C>T COCA-CN 8 145158018 145158018 single base substitution G A upstream_gene_variant COCA-CN 8 145160980 145160980 single base substitution C T intron_variant COCA-CN 8 145160980 145160980 single base substitution C T upstream_gene_variant COCA-CN 8 145162087 145162087 single base substitution G A intron_variant COCA-CN 8 145162087 145162087 single base substitution G A upstream_gene_variant COCA-CN 8 145163145 145163145 single base substitution G A upstream_gene_variant COCA-CN 8 145164008 145164008 single base substitution G A upstream_gene_variant COCA-CN 8 145164060 145164060 single base substitution C A upstream_gene_variant COCA-CN 8 145164591 145164591 single base substitution G A upstream_gene_variant COCA-CN 8 145165094 145165094 single base substitution C T upstream_gene_variant COCA-CN 8 145165369 145165369 single base substitution G A upstream_gene_variant COCA-CN 8 145165448 145165448 single base substitution G A upstream_gene_variant COCA-CN 8 145165641 145165641 single base substitution C T upstream_gene_variant COCA-CN 8 145167209 145167209 single base substitution C T upstream_gene_variant ESAD-UK 8 145149975 145149975 single base substitution G C downstream_gene_variant ESAD-UK 8 145152591 145152591 single base substitution C T downstream_gene_variant ESAD-UK 8 145152891 145152891 single base substitution G A downstream_gene_variant ESAD-UK 8 145153206 145153206 single base substitution T C downstream_gene_variant ESAD-UK 8 145156168 145156168 single base substitution C G downstream_gene_variant ESAD-UK 8 145156168 145156168 single base substitution C G intron_variant ESAD-UK 8 145156168 145156168 single base substitution C G upstream_gene_variant ESAD-UK 8 145157068 145157068 single base substitution G C downstream_gene_variant ESAD-UK 8 145157068 145157068 single base substitution G C intron_variant ESAD-UK 8 145157068 145157068 single base substitution G C upstream_gene_variant ESAD-UK 8 145157226 145157226 single base substitution G A downstream_gene_variant ESAD-UK 8 145157226 145157226 single base substitution G A intron_variant ESAD-UK 8 145157226 145157226 single base substitution G A upstream_gene_variant ESAD-UK 8 145158075 145158075 single base substitution G C exon_variant ESAD-UK 8 145158075 145158075 single base substitution G C synonymous_variant T85T 255C>G ESAD-UK 8 145158075 145158075 single base substitution G C upstream_gene_variant ESAD-UK 8 145158534 145158534 single base substitution C T exon_variant ESAD-UK 8 145158534 145158534 single base substitution C T intron_variant ESAD-UK 8 145158534 145158534 single base substitution C T synonymous_variant L41L 123G>A ESAD-UK 8 145158534 145158534 single base substitution C T upstream_gene_variant ESAD-UK 8 145159187 145159187 single base substitution C G intron_variant ESAD-UK 8 145159187 145159187 single base substitution C G upstream_gene_variant ESAD-UK 8 145161323 145161323 single base substitution C T intron_variant ESAD-UK 8 145161323 145161323 single base substitution C T upstream_gene_variant ESAD-UK 8 145161425 145161425 single base substitution G A intron_variant ESAD-UK 8 145161425 145161425 single base substitution G A upstream_gene_variant ESAD-UK 8 145162398 145162398 single base substitution C G intron_variant ESAD-UK 8 145162398 145162398 single base substitution C G upstream_gene_variant ESAD-UK 8 145163119 145163119 single base substitution G A upstream_gene_variant ESAD-UK 8 145164123 145164123 single base substitution C T upstream_gene_variant ESAD-UK 8 145164353 145164353 single base substitution G A upstream_gene_variant ESAD-UK 8 145164738 145164738 single base substitution G A upstream_gene_variant ESAD-UK 8 145165176 145165176 single base substitution C T upstream_gene_variant ESAD-UK 8 145166342 145166342 single base substitution C G upstream_gene_variant ESAD-UK 8 145167235 145167235 single base substitution T A upstream_gene_variant ESCA-CN 8 145150022 145150022 single base substitution C A downstream_gene_variant ESCA-CN 8 145152034 145152034 single base substitution C G downstream_gene_variant ESCA-CN 8 145154810 145154810 single base substitution A C downstream_gene_variant ESCA-CN 8 145154810 145154810 single base substitution A C intron_variant ESCA-CN 8 145154810 145154810 single base substitution A C upstream_gene_variant ESCA-CN 8 145161417 145161417 deletion of <=200bp C - intron_variant ESCA-CN 8 145161417 145161417 deletion of <=200bp C - upstream_gene_variant ESCA-CN 8 145161478 145161478 single base substitution C G intron_variant ESCA-CN 8 145161478 145161478 single base substitution C G upstream_gene_variant GBM-US 8 145151572 145151572 single base substitution T A downstream_gene_variant KIRC-US 8 145151520 145151520 single base substitution C T downstream_gene_variant KIRC-US 8 145154874 145154874 single base substitution C T downstream_gene_variant KIRC-US 8 145154874 145154874 single base substitution C T exon_variant KIRC-US 8 145154874 145154874 single base substitution C T missense_variant E159K 475G>A KIRC-US 8 145154874 145154874 single base substitution C T upstream_gene_variant KIRC-US 8 145154959 145154959 single base substitution G C downstream_gene_variant KIRC-US 8 145154959 145154959 single base substitution G C exon_variant KIRC-US 8 145154959 145154959 single base substitution G C missense_variant N130K 390C>G KIRC-US 8 145154959 145154959 single base substitution G C upstream_gene_variant LICA-CN 8 145160815 145160815 single base substitution A T intron_variant LICA-CN 8 145160815 145160815 single base substitution A T upstream_gene_variant LICA-FR 8 145158463 145158463 single base substitution G C exon_variant LICA-FR 8 145158463 145158463 single base substitution G C intron_variant LICA-FR 8 145158463 145158463 single base substitution G C missense_variant P65R 194C>G LICA-FR 8 145158463 145158463 single base substitution G C upstream_gene_variant LICA-FR 8 145160839 145160839 single base substitution G A intron_variant LICA-FR 8 145160839 145160839 single base substitution G A upstream_gene_variant LICA-FR 8 145161539 145161539 single base substitution G A intron_variant LICA-FR 8 145161539 145161539 single base substitution G A upstream_gene_variant LICA-FR 8 145166899 145166899 single base substitution G A upstream_gene_variant LINC-JP 8 145151666 145151667 deletion of <=200bp GG - downstream_gene_variant LINC-JP 8 145151846 145151846 single base substitution G C downstream_gene_variant LINC-JP 8 145161712 145161712 single base substitution A G intron_variant LINC-JP 8 145161712 145161712 single base substitution A G upstream_gene_variant LINC-JP 8 145162036 145162036 single base substitution T C intron_variant LINC-JP 8 145162036 145162036 single base substitution T C upstream_gene_variant LINC-JP 8 145162972 145162972 single base substitution C G exon_variant LINC-JP 8 145162972 145162972 single base substitution C G upstream_gene_variant LINC-JP 8 145163398 145163398 single base substitution G A upstream_gene_variant LINC-JP 8 145164442 145164442 single base substitution G C upstream_gene_variant LINC-JP 8 145165310 145165310 single base substitution G C upstream_gene_variant LIRI-JP 8 145150876 145150876 deletion of <=200bp C - downstream_gene_variant LIRI-JP 8 145151044 145151044 single base substitution A G downstream_gene_variant LIRI-JP 8 145151786 145151786 single base substitution T C downstream_gene_variant LIRI-JP 8 145151897 145151897 single base substitution A G downstream_gene_variant LIRI-JP 8 145152420 145152420 single base substitution C T downstream_gene_variant LIRI-JP 8 145152424 145152424 single base substitution A G downstream_gene_variant LIRI-JP 8 145154057 145154057 single base substitution C T downstream_gene_variant LIRI-JP 8 145154057 145154057 single base substitution C T intron_variant LIRI-JP 8 145154057 145154057 single base substitution C T missense_variant R325H 974G>A LIRI-JP 8 145154057 145154057 single base substitution C T missense_variant R33H 98G>A LIRI-JP 8 145158006 145158006 single base substitution T A downstream_gene_variant LIRI-JP 8 145158006 145158006 single base substitution T A exon_variant LIRI-JP 8 145158006 145158006 single base substitution T A missense_variant E108D 324A>T LIRI-JP 8 145158006 145158006 single base substitution T A upstream_gene_variant LIRI-JP 8 145160723 145160723 single base substitution A C exon_variant LIRI-JP 8 145160723 145160723 single base substitution A C upstream_gene_variant LIRI-JP 8 145161671 145161671 single base substitution A G intron_variant LIRI-JP 8 145161671 145161671 single base substitution A G upstream_gene_variant LIRI-JP 8 145164445 145164445 single base substitution C T upstream_gene_variant LIRI-JP 8 145167740 145167740 single base substitution G T upstream_gene_variant LUSC-KR 8 145154313 145154313 single base substitution G T downstream_gene_variant LUSC-KR 8 145154313 145154313 single base substitution G T exon_variant LUSC-KR 8 145154313 145154313 single base substitution G T missense_variant F263L 789C>A LUSC-KR 8 145154313 145154313 single base substitution G T upstream_gene_variant LUSC-KR 8 145154556 145154556 single base substitution G T downstream_gene_variant LUSC-KR 8 145154556 145154556 single base substitution G T intron_variant LUSC-KR 8 145154556 145154556 single base substitution G T upstream_gene_variant LUSC-KR 8 145164867 145164867 single base substitution G A upstream_gene_variant LUSC-KR 8 145165882 145165882 single base substitution A G upstream_gene_variant LUSC-KR 8 145166134 145166134 single base substitution C G upstream_gene_variant LUSC-US 8 145150845 145150845 single base substitution C A downstream_gene_variant LUSC-US 8 145151504 145151504 single base substitution A T downstream_gene_variant LUSC-US 8 145151528 145151528 single base substitution A T downstream_gene_variant LUSC-US 8 145151539 145151539 single base substitution C G downstream_gene_variant LUSC-US 8 145151959 145151959 single base substitution G C downstream_gene_variant LUSC-US 8 145152203 145152203 single base substitution G A downstream_gene_variant LUSC-US 8 145154057 145154057 single base substitution C T downstream_gene_variant LUSC-US 8 145154057 145154057 single base substitution C T intron_variant LUSC-US 8 145154057 145154057 single base substitution C T missense_variant R325H 974G>A LUSC-US 8 145154057 145154057 single base substitution C T missense_variant R33H 98G>A LUSC-US 8 145160625 145160625 single base substitution C T splice_region_variant LUSC-US 8 145160625 145160625 single base substitution C T upstream_gene_variant MALY-DE 8 145150306 145150306 single base substitution C T downstream_gene_variant MALY-DE 8 145153800 145153800 single base substitution A G 3_prime_UTR_variant MALY-DE 8 145153800 145153800 single base substitution A G downstream_gene_variant MALY-DE 8 145153800 145153800 single base substitution A G missense_variant L382P 1145T>C MALY-DE 8 145153800 145153800 single base substitution A G missense_variant L90P 269T>C MALY-DE 8 145161416 145161416 single base substitution G C intron_variant MALY-DE 8 145161416 145161416 single base substitution G C upstream_gene_variant MALY-DE 8 145166186 145166186 single base substitution C T upstream_gene_variant MELA-AU 8 145150344 145150344 single base substitution T C downstream_gene_variant MELA-AU 8 145150403 145150403 single base substitution G A downstream_gene_variant MELA-AU 8 145150924 145150924 single base substitution C G downstream_gene_variant MELA-AU 8 145151057 145151058 multiple base substitution (>=2bp and <=200bp) GG AA downstream_gene_variant MELA-AU 8 145151783 145151783 single base substitution G A downstream_gene_variant MELA-AU 8 145152114 145152114 single base substitution C T downstream_gene_variant MELA-AU 8 145153716 145153716 single base substitution C T 3_prime_UTR_variant MELA-AU 8 145153716 145153716 single base substitution C T downstream_gene_variant MELA-AU 8 145153716 145153716 single base substitution C T intron_variant MELA-AU 8 145153947 145153947 single base substitution G A downstream_gene_variant MELA-AU 8 145153947 145153947 single base substitution G A intron_variant MELA-AU 8 145154549 145154549 single base substitution G A downstream_gene_variant MELA-AU 8 145154549 145154549 single base substitution G A intron_variant MELA-AU 8 145154549 145154549 single base substitution G A upstream_gene_variant MELA-AU 8 145155988 145155988 single base substitution T C downstream_gene_variant MELA-AU 8 145155988 145155988 single base substitution T C intron_variant MELA-AU 8 145155988 145155988 single base substitution T C upstream_gene_variant MELA-AU 8 145155989 145155989 single base substitution C T downstream_gene_variant MELA-AU 8 145155989 145155989 single base substitution C T intron_variant MELA-AU 8 145155989 145155989 single base substitution C T upstream_gene_variant MELA-AU 8 145156878 145156878 single base substitution G A downstream_gene_variant MELA-AU 8 145156878 145156878 single base substitution G A intron_variant MELA-AU 8 145156878 145156878 single base substitution G A upstream_gene_variant MELA-AU 8 145157292 145157292 single base substitution C T downstream_gene_variant MELA-AU 8 145157292 145157292 single base substitution C T intron_variant MELA-AU 8 145157292 145157292 single base substitution C T upstream_gene_variant MELA-AU 8 145158181 145158181 single base substitution G A intron_variant MELA-AU 8 145158181 145158181 single base substitution G A upstream_gene_variant MELA-AU 8 145158739 145158739 single base substitution G A 5_prime_UTR_premature_start_codon_gain_variant MELA-AU 8 145158739 145158739 single base substitution G A intron_variant MELA-AU 8 145158739 145158739 single base substitution G A upstream_gene_variant MELA-AU 8 145159206 145159206 single base substitution G A intron_variant MELA-AU 8 145159206 145159206 single base substitution G A upstream_gene_variant MELA-AU 8 145159231 145159231 single base substitution G A intron_variant MELA-AU 8 145159231 145159231 single base substitution G A upstream_gene_variant MELA-AU 8 145160028 145160028 single base substitution C T intron_variant MELA-AU 8 145160028 145160028 single base substitution C T upstream_gene_variant MELA-AU 8 145160163 145160163 single base substitution C T intron_variant MELA-AU 8 145160163 145160163 single base substitution C T upstream_gene_variant MELA-AU 8 145161630 145161631 multiple base substitution (>=2bp and <=200bp) CC TT intron_variant MELA-AU 8 145161630 145161631 multiple base substitution (>=2bp and <=200bp) CC TT upstream_gene_variant MELA-AU 8 145161881 145161881 single base substitution C T intron_variant MELA-AU 8 145161881 145161881 single base substitution C T upstream_gene_variant MELA-AU 8 145161902 145161902 single base substitution C T intron_variant MELA-AU 8 145161902 145161902 single base substitution C T upstream_gene_variant MELA-AU 8 145162048 145162048 single base substitution C T intron_variant MELA-AU 8 145162048 145162048 single base substitution C T upstream_gene_variant MELA-AU 8 145162617 145162617 single base substitution C T intron_variant MELA-AU 8 145162617 145162617 single base substitution C T upstream_gene_variant MELA-AU 8 145162864 145162865 multiple base substitution (>=2bp and <=200bp) CC TT intron_variant MELA-AU 8 145162864 145162865 multiple base substitution (>=2bp and <=200bp) CC TT upstream_gene_variant MELA-AU 8 145162979 145162979 single base substitution C T exon_variant MELA-AU 8 145162979 145162979 single base substitution C T upstream_gene_variant MELA-AU 8 145163462 145163462 single base substitution C T upstream_gene_variant MELA-AU 8 145163936 145163936 single base substitution C T upstream_gene_variant MELA-AU 8 145163995 145163995 single base substitution G A upstream_gene_variant MELA-AU 8 145164097 145164097 single base substitution G A upstream_gene_variant MELA-AU 8 145164399 145164399 single base substitution C T upstream_gene_variant MELA-AU 8 145164863 145164863 single base substitution C T upstream_gene_variant MELA-AU 8 145165108 145165108 single base substitution C T upstream_gene_variant MELA-AU 8 145165172 145165172 single base substitution C T upstream_gene_variant MELA-AU 8 145165293 145165293 single base substitution G A upstream_gene_variant MELA-AU 8 145165384 145165384 single base substitution C T upstream_gene_variant MELA-AU 8 145165683 145165683 single base substitution G A upstream_gene_variant MELA-AU 8 145165694 145165694 single base substitution G A upstream_gene_variant MELA-AU 8 145166201 145166201 single base substitution C T upstream_gene_variant MELA-AU 8 145166398 145166398 single base substitution G A upstream_gene_variant MELA-AU 8 145166421 145166422 multiple base substitution (>=2bp and <=200bp) CC TT upstream_gene_variant MELA-AU 8 145166517 145166517 single base substitution C T upstream_gene_variant MELA-AU 8 145166701 145166701 single base substitution C T upstream_gene_variant MELA-AU 8 145166854 145166855 multiple base substitution (>=2bp and <=200bp) CC TT upstream_gene_variant MELA-AU 8 145167494 145167494 single base substitution C T upstream_gene_variant MELA-AU 8 145167700 145167700 single base substitution C T upstream_gene_variant MELA-AU 8 145167743 145167743 single base substitution G A upstream_gene_variant MELA-AU 8 145167849 145167849 single base substitution C T upstream_gene_variant OV-AU 8 145150439 145150439 single base substitution C G downstream_gene_variant OV-AU 8 145151210 145151210 single base substitution G C downstream_gene_variant OV-AU 8 145152347 145152347 single base substitution G C downstream_gene_variant OV-AU 8 145158166 145158166 single base substitution C G intron_variant OV-AU 8 145158166 145158166 single base substitution C G upstream_gene_variant OV-AU 8 145163788 145163788 single base substitution G A upstream_gene_variant OV-AU 8 145167215 145167215 single base substitution T G upstream_gene_variant OV-US 8 145153859 145153859 single base substitution G A downstream_gene_variant OV-US 8 145153859 145153859 single base substitution G A exon_variant OV-US 8 145153859 145153859 single base substitution G A synonymous_variant A362A 1086C>T OV-US 8 145153859 145153859 single base substitution G A synonymous_variant A70A 210C>T PACA-AU 8 145152506 145152506 single base substitution C G downstream_gene_variant PACA-AU 8 145161068 145161068 single base substitution A G intron_variant PACA-AU 8 145161068 145161068 single base substitution A G upstream_gene_variant PACA-AU 8 145162558 145162558 single base substitution A G intron_variant PACA-AU 8 145162558 145162558 single base substitution A G upstream_gene_variant PACA-AU 8 145165571 145165571 single base substitution G A upstream_gene_variant PACA-CA 8 145149580 145149580 single base substitution C A downstream_gene_variant PACA-CA 8 145149718 145149718 single base substitution C T downstream_gene_variant PACA-CA 8 145150875 145150875 insertion of <=200bp - C downstream_gene_variant PACA-CA 8 145151934 145151934 single base substitution C A downstream_gene_variant PACA-CA 8 145153778 145153778 single base substitution C T 3_prime_UTR_variant PACA-CA 8 145153778 145153778 single base substitution C T downstream_gene_variant PACA-CA 8 145154277 145154277 single base substitution G A downstream_gene_variant PACA-CA 8 145154277 145154277 single base substitution G A exon_variant PACA-CA 8 145154277 145154277 single base substitution G A synonymous_variant C275C 825C>T PACA-CA 8 145154277 145154277 single base substitution G A upstream_gene_variant PACA-CA 8 145165360 145165360 single base substitution C T upstream_gene_variant PACA-CA 8 145165368 145165368 single base substitution C T upstream_gene_variant PACA-CA 8 145166707 145166707 single base substitution C A upstream_gene_variant PACA-CA 8 145167319 145167319 single base substitution T G upstream_gene_variant PAEN-IT 8 145164736 145164736 single base substitution G A upstream_gene_variant PBCA-DE 8 145154711 145154711 single base substitution C T downstream_gene_variant PBCA-DE 8 145154711 145154711 single base substitution C T exon_variant PBCA-DE 8 145154711 145154711 single base substitution C T missense_variant G185D 554G>A PBCA-DE 8 145154711 145154711 single base substitution C T upstream_gene_variant PBCA-DE 8 145157142 145157142 single base substitution T C downstream_gene_variant PBCA-DE 8 145157142 145157142 single base substitution T C intron_variant PBCA-DE 8 145157142 145157142 single base substitution T C upstream_gene_variant PBCA-DE 8 145164788 145164788 single base substitution G A upstream_gene_variant PBCA-DE 8 145164852 145164852 single base substitution G A upstream_gene_variant PRAD-CA 8 145150228 145150228 single base substitution G A downstream_gene_variant PRAD-CA 8 145150229 145150229 single base substitution C G downstream_gene_variant PRAD-CA 8 145151356 145151356 single base substitution C T downstream_gene_variant PRAD-UK 8 145166177 145166177 single base substitution G T upstream_gene_variant PRAD-US 8 145150822 145150822 single base substitution G A downstream_gene_variant PRAD-US 8 145151373 145151373 deletion of <=200bp A - downstream_gene_variant RECA-EU 8 145161758 145161758 single base substitution C T intron_variant RECA-EU 8 145161758 145161758 single base substitution C T upstream_gene_variant RECA-EU 8 145162645 145162645 single base substitution G A intron_variant RECA-EU 8 145162645 145162645 single base substitution G A upstream_gene_variant SKCA-BR 8 145149883 145149883 single base substitution A C downstream_gene_variant SKCA-BR 8 145149926 145149926 single base substitution C T downstream_gene_variant SKCA-BR 8 145151665 145151692 deletion of <=200bp TGGCAGTGGGCATGTGGAATACTTCTCC - downstream_gene_variant SKCA-BR 8 145151666 145151666 single base substitution G C downstream_gene_variant SKCA-BR 8 145154801 145154801 single base substitution G C downstream_gene_variant SKCA-BR 8 145154801 145154801 single base substitution G C intron_variant SKCA-BR 8 145154801 145154801 single base substitution G C upstream_gene_variant SKCA-BR 8 145154810 145154810 single base substitution A C downstream_gene_variant SKCA-BR 8 145154810 145154810 single base substitution A C intron_variant SKCA-BR 8 145154810 145154810 single base substitution A C upstream_gene_variant SKCA-BR 8 145154817 145154817 single base substitution T C downstream_gene_variant SKCA-BR 8 145154817 145154817 single base substitution T C intron_variant SKCA-BR 8 145154817 145154817 single base substitution T C upstream_gene_variant SKCA-BR 8 145162225 145162225 single base substitution A G intron_variant SKCA-BR 8 145162225 145162225 single base substitution A G upstream_gene_variant SKCA-BR 8 145164987 145164987 single base substitution T G upstream_gene_variant SKCA-BR 8 145167844 145167844 single base substitution C T upstream_gene_variant SKCM-US 8 145151587 145151587 single base substitution C T downstream_gene_variant SKCM-US 8 145151615 145151615 single base substitution C T downstream_gene_variant SKCM-US 8 145152211 145152211 single base substitution G C downstream_gene_variant SKCM-US 8 145153831 145153831 single base substitution T A 3_prime_UTR_variant SKCM-US 8 145153831 145153831 single base substitution T A downstream_gene_variant SKCM-US 8 145153831 145153831 single base substitution T A missense_variant S372C 1114A>T SKCM-US 8 145153831 145153831 single base substitution T A missense_variant S80C 238A>T SKCM-US 8 145154268 145154269 deletion of <=200bp CA - downstream_gene_variant SKCM-US 8 145154268 145154269 deletion of <=200bp CA - exon_variant SKCM-US 8 145154268 145154269 deletion of <=200bp CA - frameshift_variant V278 SKCM-US 8 145154268 145154269 deletion of <=200bp CA - upstream_gene_variant STAD-US 8 145150773 145150773 single base substitution G A downstream_gene_variant STAD-US 8 145150852 145150852 single base substitution G C downstream_gene_variant STAD-US 8 145150906 145150908 deletion of <=200bp CCT - downstream_gene_variant STAD-US 8 145151105 145151105 single base substitution G A downstream_gene_variant STAD-US 8 145152192 145152192 single base substitution T C downstream_gene_variant STAD-US 8 145153893 145153893 single base substitution C T downstream_gene_variant STAD-US 8 145153893 145153893 single base substitution C T exon_variant STAD-US 8 145153893 145153893 single base substitution C T missense_variant S351N 1052G>A STAD-US 8 145153893 145153893 single base substitution C T missense_variant S59N 176G>A STAD-US 8 145153900 145153900 deletion of <=200bp G - downstream_gene_variant STAD-US 8 145153900 145153900 deletion of <=200bp G - intron_variant STAD-US 8 145153900 145153900 deletion of <=200bp G - splice_region_variant STAD-US 8 145154002 145154002 single base substitution G A downstream_gene_variant STAD-US 8 145154002 145154002 single base substitution G A intron_variant STAD-US 8 145154002 145154002 single base substitution G A synonymous_variant S343S 1029C>T STAD-US 8 145154002 145154002 single base substitution G A synonymous_variant S51S 153C>T STAD-US 8 145154720 145154720 deletion of <=200bp G - downstream_gene_variant STAD-US 8 145154720 145154720 deletion of <=200bp G - exon_variant STAD-US 8 145154720 145154720 deletion of <=200bp G - frameshift_variant A182 STAD-US 8 145154720 145154720 deletion of <=200bp G - upstream_gene_variant STAD-US 8 145160998 145160998 single base substitution G A intron_variant STAD-US 8 145160998 145160998 single base substitution G A upstream_gene_variant STAD-US 8 145161313 145161313 single base substitution A C intron_variant STAD-US 8 145161313 145161313 single base substitution A C upstream_gene_variant STAD-US 8 145161332 145161332 single base substitution C T intron_variant STAD-US 8 145161332 145161332 single base substitution C T upstream_gene_variant THCA-SA 8 145160851 145160851 single base substitution G A intron_variant THCA-SA 8 145160851 145160851 single base substitution G A upstream_gene_variant THCA-SA 8 145166134 145166134 single base substitution C G upstream_gene_variant THCA-SA 8 145166280 145166280 deletion of <=200bp C - upstream_gene_variant UCEC-US 8 145151387 145151387 single base substitution G A downstream_gene_variant UCEC-US 8 145151394 145151394 single base substitution C T downstream_gene_variant UCEC-US 8 145151587 145151587 single base substitution C A downstream_gene_variant UCEC-US 8 145153828 145153828 single base substitution T G 3_prime_UTR_variant UCEC-US 8 145153828 145153828 single base substitution T G downstream_gene_variant UCEC-US 8 145153828 145153828 single base substitution T G missense_variant T373P 1117A>C UCEC-US 8 145153828 145153828 single base substitution T G missense_variant T81P 241A>C UCEC-US 8 145157953 145157953 single base substitution C T downstream_gene_variant UCEC-US 8 145157953 145157953 single base substitution C T exon_variant UCEC-US 8 145157953 145157953 single base substitution C T splice_donor_variant UCEC-US 8 145157953 145157953 single base substitution C T upstream_gene_variant UCEC-US 8 145160854 145160854 single base substitution C T intron_variant UCEC-US 8 145160854 145160854 single base substitution C T upstream_gene_variant UCEC-US 8 145161332 145161332 single base substitution C T intron_variant UCEC-US 8 145161332 145161332 single base substitution C T upstream_gene_variant

Mutation - COSMIC Sample Name Mutation ID Mutation CDS Mutation AA Mutation Description Mutation Genome Position Mutation Strand SC_9047 COSM5556371 c.603T>C p.H201H Substitution - coding silent 8:144099759-144099759 - B89-12 COSM1755629 c.257A>T p.Q86L Substitution - Missense 8:144103170-144103170 - TCGA-G4-6628-01 COSM1455587 c.604C>T p.R202C Substitution - Missense 8:144099758-144099758 - CHC1539T COSM4788766 c.194C>G p.P65R Substitution - Missense 8:144103560-144103560 - S0060 COSM1193858 c.1094G>A p.R365H Substitution - Missense 8:144098948-144098948 - SC_9024 COSM5552971 c.562G>A p.E188K Substitution - Missense 8:144099800-144099800 - TCGA-23-2645-01 COSM1331114 c.820C>T p.R274W Substitution - Missense 8:144099379-144099379 - EGC8 COSM5062974 c.491G>T p.R164M Substitution - Missense 8:144099955-144099955 - ESCC_44 COSM5630213 c.709_710insC p.A238fs*43 Insertion - Frameshift 8:144099568-144099569 - ACINAR02 COSM1733313 c.806G>A p.R269H Substitution - Missense 8:144099393-144099393 - STC263 COSM5062975 c.272C>A p.P91H Substitution - Missense 8:144103155-144103155 - TCGA-BG-A0M4-01 COSM1097187 c.471A>G p.P157P Substitution - coding silent 8:144099975-144099975 - TCGA-BS-A0UJ-01 COSM1097186 c.1117A>C p.T373P Substitution - Missense 8:144098925-144098925 - Pat_22_a COSM5874186 c.497C>T p.P166L Substitution - Missense 8:144099949-144099949 - TCGA-Q1-A73O-01 COSM4835981 c.248G>A p.G83D Substitution - Missense 8:144103179-144103179 - TCGA-BH-A0H5-01 COSM454214 c.813C>T p.V271V Substitution - coding silent 8:144099386-144099386 - TCGA-C5-A1BQ-01 COSM4841921 c.520G>C p.E174Q Substitution - Missense 8:144099842-144099842 - CHC1539T COSM4788766 c.194C>G p.P65R Substitution - Missense 8:144103560-144103560 - tumor_4120193 COSM3953179 c.1145T>C p.L382P Substitution - Missense 8:144098897-144098897 - 225 COSM4425786 c.1118C>T p.T373I Substitution - Missense 8:144098924-144098924 - 1N49-VS-1T49 COSM4976491 c.1014G>A p.Q338Q Substitution - coding silent 8:144099114-144099114 - TCGA-FD-A3SJ-01 COSM3779079 c.940C>T p.Q314* Substitution - Nonsense 8:144099188-144099188 - PTC-7C COSM3763193 c.154C>A p.R52R Substitution - coding silent 8:144103600-144103600 - RMS2052 COSM5880743 c.439C>T p.P147S Substitution - Missense 8:144100007-144100007 - TCGA-66-2767-01 COSM749633 c.974G>A p.R325H Substitution - Missense 8:144099154-144099154 - SNUH_G44_S1 COSM3685343 c.932C>G p.P311R Substitution - Missense 8:144099196-144099196 - HCA7 COSM4612229 c.1004delC p.P335fs*>53 Deletion - Frameshift 8:144099124-144099124 - RK140_C01 COSM749633 c.974G>A p.R325H Substitution - Missense 8:144099154-144099154 - PD4962a COSM5788265 c.38C>T p.S13L Substitution - Missense 8:144103716-144103716 - LIM2551 COSM4614058 c.644_645insC p.P216fs*11 Insertion - Frameshift 8:144099717-144099718 - TCGA-AA-3662-01 COSM3763193 c.154C>A p.R52R Substitution - coding silent 8:144103600-144103600 - TCGA-A2-A0CR-01 COSM3834264 c.384G>C p.K128N Substitution - Missense 8:144100062-144100062 - CPCG_0184_Pr_P_P2 COSM2870833 c.568G>C p.G190R Substitution - Missense 8:144099794-144099794 - 61 COSM5738518 c.1004C>T p.P335L Substitution - Missense 8:144099124-144099124 - sysucc-918T COSM5453530 c.1144C>T p.L382F Substitution - Missense 8:144098898-144098898 - TCGA-61-1728-01 COSM117885 c.1055G>A p.W352* Substitution - Nonsense 8:144098987-144098987 - ESO-859 COSM1240186 c.516A>C p.R172S Substitution - Missense 8:144099930-144099930 - TCGA-23-1022-01 COSM76414 c.1086C>T p.A362A Substitution - coding silent 8:144098956-144098956 - PD7321a COSM5769182 c.333G>T p.R111R Substitution - coding silent 8:144103094-144103094 - ESCC_60 COSM5632802 c.535C>T p.L179L Substitution - coding silent 8:144099827-144099827 - J90_T COSM3951445 c.789C>A p.F263L Substitution - Missense 8:144099410-144099410 - YUKAT COSM5409073 c.367G>A p.G123R Substitution - Missense 8:144103060-144103060 - Pat_22_B COSM5874186 c.497C>T p.P166L Substitution - Missense 8:144099949-144099949 - 389 COSM4427753 c.597C>T p.A199A Substitution - coding silent 8:144099765-144099765 - Pat_26_A COSM2870824 c.791C>T p.P264L Substitution - Missense 8:144099408-144099408 - PD7321a COSM5802163 c.337delG p.A113fs*3 Deletion - Frameshift 8:144103090-144103090 - TCGA-BP-4163-01 COSM486204 c.390C>G p.N130K Substitution - Missense 8:144100056-144100056 - T4 COSM5618430 c.845G>C p.S282T Substitution - Missense 8:144099354-144099354 - B89-12-Tumor COSM1755629 c.257A>T p.Q86L Substitution - Missense 8:144103170-144103170 - H2009 COSM1193858 c.1094G>A p.R365H Substitution - Missense 8:144098948-144098948 - B65 COSM1745229 c.1017_1030del14 p.A341fs*24 Deletion - Frameshift 8:144099098-144099111 - TCGA-AN-A0XP-01 COSM454213 c.906T>G p.A302A Substitution - coding silent 8:144099293-144099293 - TCGA-D3-A3BZ-06 COSM3646544 c.1114A>T p.S372C Substitution - Missense 8:144098928-144098928 - TCGA-BR-6452-01 COSM3898154 c.1029C>T p.S343S Substitution - coding silent 8:144099099-144099099 - CSCC-20-T COSM4448577 c.1079_1081delTCA p.I360delI Deletion - In frame 8:144098961-144098963 - PCSI_0109_Pa_P_526 COSM4962996 c.825C>T p.C275C Substitution - coding silent 8:144099374-144099374 - TCGA-D5-6929-01 COSM3763193 c.154C>A p.R52R Substitution - coding silent 8:144103600-144103600 - sysucc-1242T COSM2870844 c.312C>T p.L104L Substitution - coding silent 8:144103115-144103115 - LIM2551 COSM4644845 c.661C>A p.L221M Substitution - Missense 8:144099617-144099617 - TCGA-B0-4707-01 COSM2870837 c.475G>A p.E159K Substitution - Missense 8:144099971-144099971 - Pat_41_B COSM5874185 c.851C>T p.A284V Substitution - Missense 8:144099348-144099348 - B34-Tumor COSM1755628 c.693C>T p.A231A Substitution - coding silent 8:144099585-144099585 - TCGA-AA-3663-01 COSM3763193 c.154C>A p.R52R Substitution - coding silent 8:144103600-144103600 - TCGA-IR-A3LL-01 COSM4849805 c.1061G>A p.C354Y Substitution - Missense 8:144098981-144098981 - TCGA-HU-A4GT-01 COSM3898153 c.1052G>A p.S351N Substitution - Missense 8:144098990-144098990 - RK214_C01 COSM3768742 c.324A>T p.E108D Substitution - Missense 8:144103103-144103103 - TCGA-AP-A051-01 COSM1097188 c.376+1G>A p.? Unknown 8:144103050-144103050 - 587284 COSM1225624 c.841C>T p.R281C Substitution - Missense 8:144099358-144099358 - B34 COSM1755628 c.693C>T p.A231A Substitution - coding silent 8:144099585-144099585 -

Mutation - CGAP UNIGENE CYTOBAND OMIM SNP Hs.529737;Hs.529755 8q24.3 611885

Mutation - IntOGen Mutated from(ref) Mutated to(alt) Consequence Type AA Mutation CDS Mutation Chr Pos Cancer A C Synonymous p.A302A c.906T>G 8 145154196 BRCA CA - Frameshift p.V278Afs*2 c.833_834delTG 8 145154268 CM C G Synonymous p.L205L c.615G>C 8 145154650 HNSC C T Missense p.A113T c.337G>A 8 145157993 MM C T Missense p.E159K c.475G>A 8 145154874 RCCC C T Missense p.R325H c.974G>A 8 145154057 LUSC C T Nonsense p.W352* c.1055G>A 8 145153890 OV G A Synonymous p.A362A c.1086C>T 8 145153859 OV G A Synonymous p.F258F c.774C>T 8 145154328 HNSC G A Synonymous p.P334P c.1002C>T 8 145154029 HNSC G A Synonymous p.V271V c.813C>T 8 145154289 BRCA G C Missense p.N130K c.390C>G 8 145154959 RCCC G C Missense p.Q107E c.319C>G 8 145158011 LUAD G - Frameshift p.A182Vfs*24 c.545delC 8 145154720 STAD T A Missense p.S372C c.1114A>T 8 145153831 CM T G Missense p.R172S c.516A>C 8 145154833 ESCA