MDM2
DNA & RNA Element - UTRdb
Gene NameTypeASPicDBUTRaspicRefseq IDGenome
MDM23'UTRe1d2e5e898BA064434NM_001145336chr12:67519897-67520481:+
MDM23'UTR2fcae7ad4dBA064435NM_001145336chr12:67519897-67520481:+
MDM23'UTRcbfb4f83e1NM_001145336chr12:67519897-67520481:+
MDM23'UTR9acfccd138NM_001145336chr12:67519897-67520481:+
MDM25'UTRe1d2e5e898CA100236NM_001145336chr12:67488247-67488524:+
MDM25'UTR2fcae7ad4dCA100237NM_001145336chr12:67489064-67489258:+
MDM25'UTRd2e34037ecNM_001145336chr12:67489064-67489258:+
MDM25'UTR5b5e30d460NM_001145336chr12:67488233-67488524:+
MDM25'UTR409f3ea042NM_001145336chr12:67488247-67488524:+
MDM25'UTRbe964d9e32NM_001145336chr12:67488247-67488524:+
MDM25'UTR89feee586aNM_001145336chr12:67489064-67489258:+
MDM25'UTRbd875b833aNM_001145336chr12:67489064-67489258:+
MDM25'UTR18966f535bNM_001145336chr12:67488233-67488524:+
MDM25'UTR7429fb288fNM_001145336chr12:67489064-67489258:+
MDM25'UTR621a8631feNM_001145336chr12:67489064-67489258:+
MDM25'UTR764e2df52aNM_001145336chr12:67488247-67488524:+
MDM25'UTR853b8968f1NM_001145336chr12:67488247-67488524:+
MDM25'UTR55322a3359NM_001145336chr12:67488233-67488524:+
MDM25'UTR43a192bc18NM_001145336chr12:67489064-67489258:+
MDM25'UTR0081e5c8c4NM_001145336chr12:67488233-67488524:+
MDM25'UTRa69a8e2422NM_001145336chr12:67488233-67488524:+
MDM25'UTR4ba7d05bd0NM_001145336chr12:67488233-67488524:+
DNA & RNA Element - AREsite
Gene NameMotifCDS AreaARE AreaEvidence
MDM2ATTTA303-17961847-1851;1863-1867;2083-2087;2437-2441;2764-2768;3217-3221;3434-3438;3526-3530;3705-3709;4173-4177;4363-4367;4624-4628;5236-5240;5388-5392;5402-5406;5409-5413;5459-5463;5465-5469;5510-5514;6025-6029;6721-6725;7259-7263
MDM2TTATTTATT303-17966719-6727
MDM2WTATTTATW303-17964171-4179;6719-6727
MDM2WWATTTAWW303-17961861-1869;3703-3711;4171-4179;5463-5471;6023-6031;6719-6727
MDM2WWTATTTATWW303-17964170-4180;6718-6728
MDM2WWWATTTAWWW303-17964170-4180;5462-5472;6022-6032;6718-6728
MDM2WWWTATTTATWWW303-17966717-6729
MDM2WWWWATTTAWWWW303-17965461-5473;6717-6729
DNA & RNA Element - circBase
circRNA IDChromStartEndStrand
hsa_circ_0027493chr126921814269218431+
hsa_circ_0002770chr126922255069230529+
hsa_circ_0027490chr126921059169210725+
hsa_circ_0027491chr126921059169218431+
hsa_circ_0027492chr126921059169222711+
hsa_circ_0004448chr126921410469218431+
hsa_circ_0027489chr126920279669229764+
hsa_circ_0027494chr126921814269222711+
hsa_circ_0000416chr126921410469222711+
DNA & RNA Element - circRNADb
circRNA IDChromStartEndStrandSamples
hsa_circ_04616chr126921410469222711+glioblastoma,cd_19
hsa_circ_16090chr126921410469218431+Hs68
hsa_circ_17700chr126922960869239320+glioblastoma
hsa_circ_19188chr126921059169222711+glioblastoma
hsa_circ_22762chr126922255069230529+glioblastoma,Hs68
hsa_circ_26070chr126921059169218431+normal brain tissue,glioblastoma
hsa_circ_26113chr126922255069239320+glioblastoma,oligodendroma
DNA & RNA Element - CircNet
Circ IDGITPositionExpressSymbolEntrezCategoryStrandRefered Name
hsa-circ-MDM2-antisense.3NM_001145337Tchr12:69202824-69210709noneMDM24193protein-coding-not_available
hsa-circ-MDM2-antisense.5NM_001145340Tchr12:69233634-69233862noneMDM24193protein-coding-not_available
hsa-circ-MDM2-antisense.9NM_001145337Tchr12:69237587-69237684noneMDM24193protein-coding-not_available
hsa-circ-MDM2-overlap.1NM_001145337Tchr12:69202817-69218422expressedMDM24193protein-coding+not_available
hsa-circ-MDM2-overlap.10NM_001145337Tchr12:69217194-69218431expressedMDM24193protein-coding+not_available
hsa-circ-MDM2-overlap.11NM_001145339Tchr12:69222516-69233581expressedMDM24193protein-coding+not_available
hsa-circ-MDM2-overlap.21NM_001145339Tchr12:69222550-69223222expressedMDM24193protein-coding+not_available
hsa-circ-MDM2-overlap.3NM_002392Tchr12:69202122-69233237expressedMDM24193protein-coding+not_available
hsa-circ-MDM2-overlap.33NM_001145340Tchr12:69222550-69239320expressedMDM24193protein-codingxnot_available
hsa-circ-MDM2-overlap.4NM_001145337Tchr12:69222550-69233581expressedMDM24193protein-coding+hsa_circ_0099105
hsa-circ-MDM2-overlap.42NM_001278462Tchr12:69222551-69233581expressedMDM24193protein-coding+not_available
hsa-circ-MDM2-overlap.48NM_001145340Tchr12:69229569-69229726expressedMDM24193protein-coding+not_available
hsa-circ-MDM2-overlap.5NM_001145337Tchr12:69229608-69233581expressedMDM24193protein-coding+hsa_circ_0099106
hsa-circ-MDM2-overlap.51NM_001145337Tchr12:69235454-69236719expressedMDM24193protein-coding+not_available
hsa-circ-MDM2-overlap.55NM_002392Tchr12:69235461-69235670expressedMDM24193protein-coding+not_available
hsa-circ-MDM2-overlap.6NM_002392Tchr12:69210682-69218431expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.1NM_001145337Tchr12:69229608-69230529expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.13NM_001145337Tchr12:69210591-69214154expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.15NM_002392Tchr12:69207333-69210725expressedMDM24193protein-codingnot_availablenot_available
hsa-circ-MDM2.18NM_001145337Tchr12:69218142-69222711noneMDM24193protein-coding+hsa_circ_0027494
hsa-circ-MDM2.20NM_002392Tchr12:69207333-69218431expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.22NM_002392Tchr12:69214104-69222711noneMDM24193protein-codingnot_availablenot_available
hsa-circ-MDM2.23NM_001145339Tchr12:69214104-69222711expressedMDM24193protein-codingnot_availablenot_available
hsa-circ-MDM2.25NM_001278462Tchr12:69229608-69230529expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.26NM_002392Tchr12:69214104-69218431noneMDM24193protein-coding+hsa_circ_0004448
hsa-circ-MDM2.28NM_002392Tchr12:69222550-69230529noneMDM24193protein-coding+hsa_circ_0002770
hsa-circ-MDM2.29NM_001145337Tchr12:69218142-69218431noneMDM24193protein-codingnot_availablenot_available
hsa-circ-MDM2.37NM_001145339Tchr12:69202257-69233628expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.40NM_001145340Tchr12:69202796-69229764noneMDM24193protein-coding+hsa_circ_0027489
hsa-circ-MDM2.41NM_002392Tchr12:69210592-69222711noneMDM24193protein-codingnot_availablenot_available
hsa-circ-MDM2.42NM_002392Tchr12:69202257-69233628expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.43NM_001145337Tchr12:69210591-69218431noneMDM24193protein-coding+hsa_circ_0027491
hsa-circ-MDM2.47NM_001145339Tchr12:69222550-69229764expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.50NM_001145337Tchr12:69222553-69230529expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.53NM_001145337Tchr12:69202987-69214154expressedMDM24193protein-codingxchr12:69202987-69214154_HeLa_S3_poly(A)-
hsa-circ-MDM2.57NM_002392Tchr12:69202987-69210725expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.58NM_001145339Tchr12:69207333-69222711expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.59NM_001145337Tchr12:69207333-69222711expressedMDM24193protein-coding+not_available
hsa-circ-MDM2.65NM_001145337Tchr12:69207333-69214154expressedMDM24193protein-codingxchr12:69207333-69214154_PA1_RNaseR
hsa-circ-MDM2.7NM_001145339Tchr12:69210592-69222711noneMDM24193protein-codingnot_availablenot_available
hsa-circ-MDM2.9NM_002392Tchr12:69210591-69210725noneMDM24193protein-coding+hsa_circ_0027490
DNA & RNA Element - miRTarBase
Target Gene (Entrez ID)miRTarBase IDmiRNASpecies (miRNA)Target GeneSpecies (Target Gene)ExperimentsSupport TypeReferences (PMID)
MIRT006631hsa-miR-32-5pHomo sapiensMDM24193Homo sapiensLuciferase reporter assay//qRT-PCR//Western blotFunctional MTI22431589
MIRT006631hsa-miR-32-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT006632hsa-miR-25-3pHomo sapiensMDM24193Homo sapiensLuciferase reporter assay//qRT-PCR//Western blotFunctional MTI22431589
MIRT006632hsa-miR-25-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT007256hsa-miR-143-3pHomo sapiensMDM24193Homo sapiensLuciferase reporter assayFunctional MTI22330136
MIRT007257hsa-miR-145-5pHomo sapiensMDM24193Homo sapiensLuciferase reporter assayFunctional MTI22330136
MIRT007287hsa-miR-18b-5pHomo sapiensMDM24193Homo sapiensLuciferase reporter assayFunctional MTI23365201
MIRT016157hsa-miR-605-5pHomo sapiensMDM24193Homo sapiensReporter assay;Western blotFunctional MTI21217645
MIRT016256hsa-miR-504-5pHomo sapiensMDM24193Homo sapiensWestern blot;qRT-PCRNon-Functional MTI20542001
MIRT028860hsa-miR-26b-5pHomo sapiensMDM24193Homo sapiensSequencing//PAR-CLIPFunctional MTI (Weak)20371350
MIRT028860hsa-miR-26b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIP//HITS-CLIPFunctional MTI (Weak)21572407
MIRT028860hsa-miR-26b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT028860hsa-miR-26b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT028860hsa-miR-26b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT041992hsa-miR-484Homo sapiensMDM24193Homo sapiensCLASHFunctional MTI (Weak)23622248
MIRT049315hsa-miR-92a-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT049315hsa-miR-92a-3pHomo sapiensMDM24193Homo sapiensCLASHFunctional MTI (Weak)23622248
MIRT052891hsa-miR-3929Homo sapiensMDM24193Homo sapiensCLASHFunctional MTI (Weak)23622248
MIRT054137hsa-miR-410-3pHomo sapiensMDM24193Homo sapiensLuciferase reporter assay//qRT-PCR//Western blotFunctional MTI25136862
MIRT437932hsa-miR-17-5pHomo sapiensMDM24193Homo sapiensIn situ hybridization//Western blot//Luciferase reporter assayFunctional MTI23391506
MIRT437932hsa-miR-17-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT437932hsa-miR-17-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT438230hsa-miR-221-3pHomo sapiensMDM24193Homo sapiensLuciferase reporter assay//qRT-PCR//Western blotFunctional MTI24324033
MIRT438230hsa-miR-221-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT438230hsa-miR-221-3pHomo sapiensMDM24193Homo sapiensPAR-CLIP//HITS-CLIPFunctional MTI (Weak)21572407
MIRT438230hsa-miR-221-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT438230hsa-miR-221-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT438230hsa-miR-221-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT438539hsa-miR-661Homo sapiensMDM24193Homo sapiensqRT-PCR//Western blotFunctional MTI24141721
MIRT438539hsa-miR-661Homo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT440264hsa-miR-218-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23212916
MIRT452689hsa-miR-6516-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT452690hsa-miR-500a-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT452691hsa-miR-6499-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT452691hsa-miR-6499-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT452692hsa-miR-767-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT452693hsa-miR-92b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT452694hsa-miR-367-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT452695hsa-miR-363-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT452696hsa-miR-508-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT452696hsa-miR-508-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT452697hsa-miR-3145-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486451hsa-miR-4776-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486452hsa-miR-192-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486453hsa-miR-223-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486454hsa-miR-4697-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486455hsa-miR-4470Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486456hsa-miR-935Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486457hsa-miR-4692Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486458hsa-miR-4514Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486459hsa-miR-6715b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486460hsa-miR-4269Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486461hsa-miR-4742-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486462hsa-miR-330-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486463hsa-miR-205-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486464hsa-miR-4465Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT486464hsa-miR-4465Homo sapiensMDM24193Homo sapiensPAR-CLIP//HITS-CLIPFunctional MTI (Weak)21572407
MIRT486464hsa-miR-4465Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT486464hsa-miR-4465Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486464hsa-miR-4465Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT486465hsa-miR-26a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT486465hsa-miR-26a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIP//HITS-CLIPFunctional MTI (Weak)21572407
MIRT486465hsa-miR-26a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT486465hsa-miR-26a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486465hsa-miR-26a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT486466hsa-miR-1297Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT486466hsa-miR-1297Homo sapiensMDM24193Homo sapiensPAR-CLIP//HITS-CLIPFunctional MTI (Weak)21572407
MIRT486466hsa-miR-1297Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT486466hsa-miR-1297Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486466hsa-miR-1297Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT486467hsa-miR-222-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT486467hsa-miR-222-3pHomo sapiensMDM24193Homo sapiensPAR-CLIP//HITS-CLIPFunctional MTI (Weak)21572407
MIRT486467hsa-miR-222-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT486467hsa-miR-222-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486467hsa-miR-222-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT486468hsa-miR-6074Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT486468hsa-miR-6074Homo sapiensMDM24193Homo sapiensPAR-CLIP//HITS-CLIPFunctional MTI (Weak)21572407
MIRT486468hsa-miR-6074Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT486468hsa-miR-6074Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486468hsa-miR-6074Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT486469hsa-miR-4272Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT486469hsa-miR-4272Homo sapiensMDM24193Homo sapiensPAR-CLIP//HITS-CLIPFunctional MTI (Weak)21572407
MIRT486469hsa-miR-4272Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT486469hsa-miR-4272Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT486469hsa-miR-4272Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT486470hsa-miR-5580-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT486470hsa-miR-5580-3pHomo sapiensMDM24193Homo sapiensPAR-CLIP//HITS-CLIPFunctional MTI (Weak)21572407
MIRT486470hsa-miR-5580-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT486470hsa-miR-5580-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23592263
MIRT498791hsa-miR-3692-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498792hsa-miR-6505-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498793hsa-miR-202-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498794hsa-miR-432-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498795hsa-miR-335-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498796hsa-miR-6859-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498797hsa-miR-3916Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498798hsa-miR-3125Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498799hsa-miR-6864-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT498799hsa-miR-6864-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498800hsa-miR-6126Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT498800hsa-miR-6126Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498801hsa-miR-1252-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT498801hsa-miR-1252-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498802hsa-miR-1322Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT498802hsa-miR-1322Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498803hsa-miR-651-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT498803hsa-miR-651-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498804hsa-miR-3662Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT498804hsa-miR-3662Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498805hsa-miR-4537Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT498806hsa-miR-483-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)24398324
MIRT503556hsa-miR-335-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503556hsa-miR-335-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT503556hsa-miR-335-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT503556hsa-miR-335-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503557hsa-miR-4711-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503557hsa-miR-4711-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503558hsa-miR-93-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503558hsa-miR-93-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503559hsa-miR-526b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503559hsa-miR-526b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503560hsa-miR-519d-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503560hsa-miR-519d-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503561hsa-miR-20b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503561hsa-miR-20b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503562hsa-miR-20a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503562hsa-miR-20a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503563hsa-miR-106b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503563hsa-miR-106b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503564hsa-miR-106a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503564hsa-miR-106a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503565hsa-miR-548ah-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503565hsa-miR-548ah-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT503566hsa-miR-3609Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT503566hsa-miR-3609Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT514915hsa-miR-5682Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT514915hsa-miR-5682Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT514915hsa-miR-5682Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT514916hsa-miR-6871-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT514916hsa-miR-6871-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT514916hsa-miR-6871-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT514917hsa-miR-29c-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT514917hsa-miR-29c-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT514917hsa-miR-29c-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT514918hsa-miR-29b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT514918hsa-miR-29b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT514918hsa-miR-29b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT514919hsa-miR-29a-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT514919hsa-miR-29a-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT514919hsa-miR-29a-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT514920hsa-miR-376c-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT514920hsa-miR-376c-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT514920hsa-miR-376c-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)23446348
MIRT526525hsa-miR-3926Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526525hsa-miR-3926Homo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23313552
MIRT526526hsa-miR-6817-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)19536157
MIRT526526hsa-miR-6817-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526526hsa-miR-6817-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT526527hsa-miR-7110-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)19536157
MIRT526527hsa-miR-7110-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526527hsa-miR-7110-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT526528hsa-miR-95-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)19536157
MIRT526528hsa-miR-95-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526528hsa-miR-95-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT526529hsa-miR-1278Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526530hsa-miR-522-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526530hsa-miR-522-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT526531hsa-miR-224-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526531hsa-miR-224-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT526532hsa-miR-4694-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526532hsa-miR-4694-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT526533hsa-miR-7850-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526534hsa-miR-552-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT526534hsa-miR-552-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526535hsa-miR-620Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526536hsa-miR-1270Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526537hsa-miR-4531Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526538hsa-miR-664b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT526538hsa-miR-664b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526539hsa-miR-579-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT526539hsa-miR-579-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526540hsa-miR-5192Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526541hsa-miR-4644Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526542hsa-miR-4306Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526543hsa-miR-185-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526544hsa-miR-496Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526545hsa-miR-8067Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT526546hsa-miR-6508-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)22012620
MIRT543491hsa-miR-656-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543492hsa-miR-5680Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543493hsa-miR-590-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543494hsa-miR-758-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT543494hsa-miR-758-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543495hsa-miR-6808-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT543495hsa-miR-6808-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543496hsa-miR-542-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT543496hsa-miR-542-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543497hsa-miR-4504Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT543497hsa-miR-4504Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543498hsa-miR-4307Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT543498hsa-miR-4307Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543499hsa-miR-4729Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT543499hsa-miR-4729Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543500hsa-miR-561-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT543500hsa-miR-561-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT543501hsa-miR-548at-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT543501hsa-miR-548at-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550055hsa-miR-5696Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550056hsa-miR-4266Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550057hsa-miR-499a-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550058hsa-miR-208b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550059hsa-miR-208a-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550060hsa-miR-1255b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550061hsa-miR-1255aHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550062hsa-miR-571Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550063hsa-miR-556-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550064hsa-miR-4433b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550065hsa-miR-4797-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550066hsa-miR-944Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550067hsa-miR-641Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT550068hsa-miR-3617-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)21572407
MIRT562993hsa-miR-1305Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT562994hsa-miR-550a-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT562995hsa-miR-200c-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573525hsa-miR-5010-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573526hsa-miR-2113Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573527hsa-miR-1185-2-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573528hsa-let-7f-2-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573529hsa-miR-1185-1-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573530hsa-miR-4789-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573531hsa-miR-98-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573532hsa-let-7f-1-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573533hsa-let-7b-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573534hsa-let-7a-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573535hsa-miR-381-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573536hsa-miR-4666a-3pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573537hsa-miR-300Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573538hsa-miR-526b-5pHomo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT573539hsa-miR-4635Homo sapiensMDM24193Homo sapiensPAR-CLIPFunctional MTI (Weak)20371350
MIRT613509hsa-miR-6873-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)19536157
MIRT613509hsa-miR-6873-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT636913hsa-miR-6879-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT636914hsa-miR-3620-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT636915hsa-miR-6865-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT643174hsa-miR-127-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT643175hsa-miR-7843-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT643176hsa-miR-1324Homo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT643177hsa-miR-2052Homo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23824327
MIRT682750hsa-miR-1273g-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682751hsa-miR-7703Homo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682752hsa-miR-6720-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682753hsa-miR-6512-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682754hsa-miR-6729-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682755hsa-miR-4649-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682756hsa-miR-1273aHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682757hsa-miR-3117-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682758hsa-miR-4486Homo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682759hsa-miR-4793-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682760hsa-miR-766-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682761hsa-miR-939-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682762hsa-miR-6849-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT682763hsa-miR-425-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23706177
MIRT690502hsa-miR-8055Homo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23313552
MIRT690503hsa-miR-548sHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23313552
MIRT690504hsa-miR-3606-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23313552
MIRT690505hsa-miR-1233-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23313552
MIRT690506hsa-miR-1225-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23313552
MIRT690507hsa-miR-3190-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23313552
MIRT690508hsa-miR-6500-3pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23313552
MIRT690509hsa-miR-3614-5pHomo sapiensMDM24193Homo sapiensHITS-CLIPFunctional MTI (Weak)23313552
DNA & RNA Element - microRNA
Mirbase AccmiRNA NameGene IDGene SymbolmiRNA AlignmentAlignmentGene AlignmentmiRNA StartmiRNA EndGene StartGene EndGenome CoordinatesConservationAlign ScoreSeed CatEnergymirSVR Score
MIMAT0004481hsa-let-7a*4193MDM2cuuucUGU-CAUCUAACAUAUc |:| ||: |||||||| cucccAUAUGUGAAUUGUAUAu21737273748[hg19:12:69237356-69237377:+]0.52111557-8.83-0.1043
MIMAT0004481hsa-let-7a*4193MDM2cuuucUGU-CAUCUAACAUAUc |:| ||: |||||||| cucccAUAUGUGAAUUGUAUAu21736713692[hg19:12:69237356-69237377:+]0.52111557-8.83-0.1078
MIMAT0004481hsa-let-7a*4193MDM2cuUUC--UGUCAUCUAACAUAUc ||| ||| | |||||||| agAAGCAACAACAUAUUGUAUAu220297319[hg19:12:69210641-69210663:+]0.73051587-8.93-1.2460
MIMAT0004482hsa-let-7b*4193MDM2cccuuccguCAUCCAACAUAUc ||: ||||||| cucccauauGUGAAUUGUAUAu21437273748[hg19:12:69237356-69237377:+]0.52111457-6.41-0.1053
MIMAT0004482hsa-let-7b*4193MDM2cccuuccguCAUCCAACAUAUc ||: ||||||| cucccauauGUGAAUUGUAUAu21436713692[hg19:12:69237356-69237377:+]0.52111457-6.41-0.1089
MIMAT0004482hsa-let-7b*4193MDM2ccCUUC--CGUCAUCCAACAUAUc |||| || | ||||||| gaGAAGCAACAACAUAUUGUAUAu221296319[hg19:12:69210640-69210663:+]0.73051477-7.41-1.2484
MIMAT0004483hsa-let-7c*4193MDM2auugAGGGUCCCACAUUGAGAu ||:|| || ||||||| cgcaUCUCAUUGU-UAACUCUu21927072727[hg19:12:69236336-69236356:+]0.50581567-15.58-0.1206
MIMAT0004483hsa-let-7c*4193MDM2auugAGGGUCCCACAUUGAGAu ||:|| || ||||||| cgcaUCUCAUUGU-UAACUCUu21926512671[hg19:12:69236336-69236356:+]0.50581567-15.58-0.1247
MIMAT0004483hsa-let-7c*4193MDM2auugAGGGUCCCACAUUGAGAu ||:|| || ||||||| cgcaUCUCAUUGU-UAACUCUu21928652885[hg19:12:69236336-69236356:+]0.50581567-15.58-0.1097
MIMAT0004486hsa-let-7f-1*4193MDM2cccuuccguUAUCUAACAUAUc :|: |||||||| cucccauauGUGAAUUGUAUAu21437273748[hg19:12:69237356-69237377:+]0.52111497-6.38-0.1043
MIMAT0004486hsa-let-7f-1*4193MDM2cccuuccguUAUCUAACAUAUc :|: |||||||| cucccauauGUGAAUUGUAUAu21436713692[hg19:12:69237356-69237377:+]0.52111497-6.38-0.1078
MIMAT0004486hsa-let-7f-1*4193MDM2ccCUUC--CGUUAUCUAACAUAUc |||| ||| | |||||||| gaGAAGCAACAACAUAUUGUAUAu221296319[hg19:12:69210640-69210663:+]0.73051637-10.35-1.2460
MIMAT0004487hsa-let-7f-2*4193MDM2ccUUUC--UGUCAUCUGACAUAUc :||| ||| | |:|||||| gaGAAGCAACAACAUAUUGUAUAu221296319[hg19:12:69210640-69210663:+]0.73051436-9.35-0.1807
MIMAT0004488hsa-miR-15a*4193MDM2acuccGUCGUGUUAUACCGGAc :|| |||| ||||||| ugucuUAGAACAAAAUGGCCUu21829863007[hg19:12:69236615-69236636:+]0.50611657-17.47-0.2444
MIMAT0004488hsa-miR-15a*4193MDM2acuccGUCGUGUUAUACCGGAc :|| |||| ||||||| ugucuUAGAACAAAAUGGCCUu21829302951[hg19:12:69236615-69236636:+]0.50611657-17.47-0.2519
MIMAT0004488hsa-miR-15a*4193MDM2acuccGUCGUGUUAUACCGGAc :|| |||| ||||||| ugucuUAGAACAAAAUGGCCUu21831443165[hg19:12:69236615-69236636:+]0.50611657-17.47-0.2243
MIMAT0004488hsa-miR-15a*4193MDM2acuccGUCGUGU--UAUACCGGAc ||| ||| |||||||| caaaaCAGGACAUCUUAUGGCCUg2184164[hg19:12:69233512-69233535:+]0.76601567-26.01-0.1418
MIMAT0004489hsa-miR-16-1*4193MDM2aguCGUCGUGUCAAUUAUGACc | ||: || |||||||| auuGGAGUUCA--UAAUACUGa22040994118[hg19:12:69237728-69237747:+]0.49821527-10.63-0.1202
MIMAT0004489hsa-miR-16-1*4193MDM2aguCGUCGUGUCAAUUAUGACc | ||: || |||||||| auuGGAGUUCA--UAAUACUGa22040434062[hg19:12:69237728-69237747:+]0.49821527-10.63-0.1243
MIMAT0004489hsa-miR-16-1*4193MDM2aguCGUCGUGUCAAUUAUGACc | ||: || |||||||| auuGGAGUUCA--UAAUACUGa22042574276[hg19:12:69237728-69237747:+]0.49821527-10.63-0.1094
MIMAT0004490hsa-miR-19a*4193MDM2acAUCACGUUG-AUACGUUUUGa || || | | || ||||||| aaUA-UGAAUCUUAAGCAAAACa22136743695[hg19:12:69237303-69237324:+]0.51791537-9.01-0.4409
MIMAT0004490hsa-miR-19a*4193MDM2acAUCACGUUG-AUACGUUUUGa || || | | || ||||||| aaUA-UGAAUCUUAAGCAAAACa22136183639[hg19:12:69237303-69237324:+]0.51791537-9.01-0.4519
MIMAT0004490hsa-miR-19a*4193MDM2acAUCACGUUG-AUACGUUUUGa || || | | || ||||||| aaUA-UGAAUCUUAAGCAAAACa22138323853[hg19:12:69237303-69237324:+]0.51791537-9.01-0.4106
MIMAT0004491hsa-miR-19b-1*4193MDM2cgaccUACGUUUGGA---CGUUUUGa || ::||:|| ||||||| uuuaaAUAUGAAUCUUAAGCAAAACa21936703695[hg19:12:69237299-69237324:+]0.51791537-11.28-0.4442
MIMAT0004491hsa-miR-19b-1*4193MDM2cgaccUACGUUUGGA---CGUUUUGa || ::||:|| ||||||| uuuaaAUAUGAAUCUUAAGCAAAACa21936143639[hg19:12:69237299-69237324:+]0.51791537-11.28-0.4552
MIMAT0004491hsa-miR-19b-1*4193MDM2cgaccUACGUUUGGA---CGUUUUGa || ::||:|| ||||||| uuuaaAUAUGAAUCUUAAGCAAAACa21938283853[hg19:12:69237299-69237324:+]0.51791537-11.28-0.4137
MIMAT0004492hsa-miR-19b-2*4193MDM2acUUUACGUUUGGA---CGUUUUGa |||| ::||:|| ||||||| uuAAAUAUGAAUCUUAAGCAAAACa22136713695[hg19:12:69237300-69237324:+]0.51791637-13.08-0.4442
MIMAT0004492hsa-miR-19b-2*4193MDM2acUUUACGUUUGGA---CGUUUUGa |||| ::||:|| ||||||| uuAAAUAUGAAUCUUAAGCAAAACa22136153639[hg19:12:69237300-69237324:+]0.51791637-13.08-0.4552
MIMAT0004492hsa-miR-19b-2*4193MDM2acUUUACGUUUGGA---CGUUUUGa |||| ::||:|| ||||||| uuAAAUAUGAAUCUUAAGCAAAACa22138293853[hg19:12:69237300-69237324:+]0.51791637-13.08-0.4137
MIMAT0004499hsa-miR-26a-1*4193MDM2gcacGUUCA--UUGGUUCUU-AUCc || || |:||||||| ||| ccacCAUGUCCAGCCAAGAAUUAGu219943967[hg19:12:69234572-69234596:+]0.51611290-13.94-0.1059
MIMAT0004499hsa-miR-26a-1*4193MDM2gcacGUUCA--UUGGUUCUU-AUCc || || |:||||||| ||| ccacCAUGUCCAGCCAAGAAUUAGu219887911[hg19:12:69234572-69234596:+]0.51611290-13.94-0.1100
MIMAT0004500hsa-miR-26b*4193MDM2cuCGGUUCAUUAC---CUCUU-GUCc ||| || |||| |||| ||| gaGCCUAGCAAUGAUCUAGAAGCAGa22131833208[hg19:12:69236812-69236837:+]0.50811230-17.13-0.1343
MIMAT0004500hsa-miR-26b*4193MDM2cuCGGUUCAUUAC---CUCUU-GUCc ||| || |||| |||| ||| gaGCCUAGCAAUGAUCUAGAAGCAGa22131273152[hg19:12:69236812-69236837:+]0.50811230-17.13-0.1388
MIMAT0004500hsa-miR-26b*4193MDM2cuCGGUUCAUUAC---CUCUU-GUCc ||| || |||| |||| ||| gaGCCUAGCAAUGAUCUAGAAGCAGa22133413366[hg19:12:69236812-69236837:+]0.50811230-17.13-0.1223
MIMAT0004501hsa-miR-27a*4193MDM2acgagUGUUCGUCGAUUCGGGa | ||| | ||||||| uaaagAAAAGGA-AUAAGCCCu21885105[hg19:12:69233556-69233576:+]0.76171477-15.98-0.1584
MIMAT0004505hsa-miR-32*4193MDM2uuuauAGUGUGUGUGAUUUAAc |:| | | ||||||| gagacUUAGAACCUCUAAAUUa21825912612[hg19:12:69236220-69236241:+]0.51071497-5.30-0.1261
MIMAT0004505hsa-miR-32*4193MDM2uuuauAGUGUGUGUGAUUUAAc |:| | | ||||||| gagacUUAGAACCUCUAAAUUa21825352556[hg19:12:69236220-69236241:+]0.51071497-5.30-0.1303
MIMAT0004505hsa-miR-32*4193MDM2uuuauAGUGUGUGUGAUUUAAc |:| | | ||||||| gagacUUAGAACCUCUAAAUUa21827492770[hg19:12:69236220-69236241:+]0.51071497-5.30-0.1147
MIMAT0004512hsa-miR-100*4193MDM2guAUGGA-UAUCUAUGUUCGAAc | ||| :|||| |||||||| caUUCCUGGUAGA-ACAAGCUUu22131543175[hg19:12:69236783-69236804:+]0.50711657-19.94-0.1085
MIMAT0004512hsa-miR-100*4193MDM2guAUGGA-UAUCUAUGUUCGAAc | ||| :|||| |||||||| caUUCCUGGUAGA-ACAAGCUUu22130983119[hg19:12:69236783-69236804:+]0.50711657-19.94-0.1122
MIMAT0004512hsa-miR-100*4193MDM2guAUGGAUAUCUAUGUUCGAAc |:::|: | ||||||| uuUGUUUGGCGUGCCAAGCUUc221343364[hg19:12:69210687-69210708:+]0.72061447-12.32-0.2327
MIMAT0004515hsa-miR-29b-2*4193MDM2gauucGGUGGUACA-CU-UUGGUc ||| :|||| || ||||| ccugcCCAGUAUGUAGACAACCAa218103126[hg19:12:69233574-69233597:+]0.76171280-18.17-0.3733
MIMAT0009196hsa-miR-103-2*4193MDM2guuccgucgUGACAUUUC-UUCGa || |||||| |||| caaaauaaaACCGUAAAGCAAGC-21555605582[hg19:12:69239189-69239211:+]0.49181260-11.55-0.1202
MIMAT0009196hsa-miR-103-2*4193MDM2guuccgucgUGACAUUUC-UUCGa || |||||| |||| caaaauaaaACCGUAAAGCAAGC-21555045526[hg19:12:69239189-69239211:+]0.49181260-11.55-0.1243
MIMAT0009196hsa-miR-103-2*4193MDM2guuccgucGUG-ACAUUUCUUCGa ||: || |||||||| cugcuuuaCAUGUGCAAAGAAGCu2166285[hg19:12:69233533-69233556:+]0.76171547-17.24-0.1905
MIMAT0009196hsa-miR-103-2*4193MDM2guuccgucgUGACAUUUC-UUCGa || |||||| |||| caaaauaaaACCGUAAAGCAAGC-21557185740[hg19:12:69239189-69239211:+]0.49181260-11.55-0.1093
MIMAT0009196hsa-miR-103-2*4193MDM2guuccgucgugACAUUUCUUCGa || :|||||| aaacgauuauaUGAUGAGAAGCa213281303[hg19:12:69210625-69210647:+]0.74051286-9.25-0.6244
MIMAT0004517hsa-miR-106a*4193MDM2caUUCUUCACG-AAUGUA-ACGUc | |: ||| |||||| |||| uuAUGGCCUGCUUUACAUGUGCAa2215578[hg19:12:69233526-69233549:+]0.76171270-11.64-0.1796
MIMAT0004518hsa-miR-16-2*4193MDM2auuUCGUCGUGUCA-UUAUAACc | || ||:| | |||||| agcAACAACAUAUUGUAUAUUGu220300322[hg19:12:69210644-69210666:+]0.73051266-7.94-0.1488
MIMAT0000232hsa-miR-199a-3p4193MDM2auUGGUUACACG-UCUGAUGACa ||:| | : | ||||||| gaACUAUGGAAUAAAACUACUGa22123112333[hg19:12:69235940-69235962:+]0.51021437-13.44-0.2357
MIMAT0000232hsa-miR-199a-3p4193MDM2auUGGUUACACG-UCUGAUGACa ||:| | : | ||||||| gaACUAUGGAAUAAAACUACUGa22122552277[hg19:12:69235940-69235962:+]0.51021437-13.44-0.2429
MIMAT0000232hsa-miR-199a-3p4193MDM2auUGGUUACACG-UCUGAUGACa ||:| | : | ||||||| gaACUAUGGAAUAAAACUACUGa22124692491[hg19:12:69235940-69235962:+]0.51021437-13.44-0.2162
MIMAT0000232hsa-miR-199a-3p4193MDM2auUGGU--UACACGUCU-GAUGACa |||| |||| :: | |||||| auACCAACAUGUCUGUACCUACUGa2211236[hg19:12:69202999-69203023:+]0.68341276-15.21-0.6511
MIMAT0004549hsa-miR-148a*4193MDM2ucAGCCUCACAGAGUCUUGAAa || || || | ||||||| gaUCCCAG-GU-UAAGAACUUc221180199[hg19:12:69208402-69208421:+]0.61131487-10.19-0.6790
MIMAT0004550hsa-miR-30c-2*4193MDM2ucUCAUUUGUCGGAAGAGGGUc | | |::: ::|||||||| ugAUUUAGUGUUUUUCUCCCAu22137123733[hg19:12:69237341-69237362:+]0.52111567-16.00-0.2183
MIMAT0004550hsa-miR-30c-2*4193MDM2ucUCAUUUGUCGGAAGAGGGUc | | |::: ::|||||||| ugAUUUAGUGUUUUUCUCCCAu22136563677[hg19:12:69237341-69237362:+]0.52111567-16.00-0.2252
MIMAT0004550hsa-miR-30c-2*4193MDM2ucUCAUUUGUCGGAAGAGGGUc | | |::: ::|||||||| ugAUUUAGUGUUUUUCUCCCAu22138703891[hg19:12:69237341-69237362:+]0.52111567-16.00-0.2000
MIMAT0000251hsa-miR-1474193MDM2cgucuucguaaaGGUGUGUg ||||||| uuuuuuuuaaagCCACACAa2932503269[hg19:12:69236879-69236898:+]0.50851407-12.56-0.1070
MIMAT0000251hsa-miR-1474193MDM2cgucuucguaaaGGUGUGUg ||||||| uuuuuuuuaaagCCACACAa2931943213[hg19:12:69236879-69236898:+]0.50851407-12.56-0.1107
MIMAT0004553hsa-miR-7-1*4193MDM2auaccgucugaCACUAAACAAc | |||||||| ugaucuucuagGAGAUUUGUUu212328349[hg19:12:69210672-69210693:+]0.72061477-9.32-0.4572
MIMAT0004553hsa-miR-7-1*4193MDM2auaccGUCUGACACUA-AACAAc || |:||| || ||||| aacaaCAUAUUGU-AUAUUGUUc218303324[hg19:12:69210647-69210668:+]0.73051230-7.80-1.2650
MIMAT0004554hsa-miR-7-2*4193MDM2aauccaucugaCCCUAAACAAc | |||||||| ugaucuucuagGAGAUUUGUUu212328349[hg19:12:69210672-69210693:+]0.72061477-11.46-0.4539
MIMAT0004556hsa-miR-10b*4193MDM2uaaggGGAUCUUAGCUUAGACa ||||| | ||||||| uagaaCCUAG--UAGAAUCUGu21840504069[hg19:12:69237679-69237698:+]0.50041547-20.08-0.1054
MIMAT0004556hsa-miR-10b*4193MDM2uaaggGGAUCUUAGCUUAGACa ||||| | ||||||| uagaaCCUAG--UAGAAUCUGu21839944013[hg19:12:69237679-69237698:+]0.50041547-20.08-0.1091
MIMAT0004560hsa-miR-183*4193MDM2aauaccgggaagCCAUUAAGUg | ||||||| gaauucagaaaaGUUAAUUCAg21118651886[hg19:12:69235494-69235515:+]0.53851427-4.62-0.1396
MIMAT0004560hsa-miR-183*4193MDM2aauaccgggaagCCAUUAAGUg | ||||||| gaauucagaaaaGUUAAUUCAg21118091830[hg19:12:69235494-69235515:+]0.53851427-4.62-0.1443
MIMAT0004560hsa-miR-183*4193MDM2aauaccgggaagCCAUUAAGUg | ||||||| gaauucagaaaaGUUAAUUCAg21120232044[hg19:12:69235494-69235515:+]0.53851427-4.62-0.1272
MIMAT0004563hsa-miR-199b-3p4193MDM2auUGGUUACACG-UCUGAUGACa ||:| | : | ||||||| gaACUAUGGAAUAAAACUACUGa22123112333[hg19:12:69235940-69235962:+]0.51021437-13.44-0.2357
MIMAT0004563hsa-miR-199b-3p4193MDM2auUGGUUACACG-UCUGAUGACa ||:| | : | ||||||| gaACUAUGGAAUAAAACUACUGa22122552277[hg19:12:69235940-69235962:+]0.51021437-13.44-0.2429
MIMAT0004563hsa-miR-199b-3p4193MDM2auUGGUUACACG-UCUGAUGACa ||:| | : | ||||||| gaACUAUGGAAUAAAACUACUGa22124692491[hg19:12:69235940-69235962:+]0.51021437-13.44-0.2162
MIMAT0004563hsa-miR-199b-3p4193MDM2auUGGU--UACACGUCU-GAUGACa |||| |||| :: | |||||| auACCAACAUGUCUGUACCUACUGa2211236[hg19:12:69202999-69203023:+]0.68341276-15.21-0.6511
MIMAT0004565hsa-miR-218-1*4193MDM2gguaccaCGAACUGCCUUGGUa | | | ||||||| aagggagGAUAUAAGGAACCAa21628932914[hg19:12:69236522-69236543:+]0.50611437-14.41-0.3254
MIMAT0004565hsa-miR-218-1*4193MDM2gguaccaCGAACUGCCUUGGUa | | | ||||||| aagggagGAUAUAAGGAACCAa21628372858[hg19:12:69236522-69236543:+]0.50611437-14.41-0.3346
MIMAT0004565hsa-miR-218-1*4193MDM2gguaccaCGAACUGCCUUGGUa | | | ||||||| aagggagGAUAUAAGGAACCAa21630513072[hg19:12:69236522-69236543:+]0.50611437-14.41-0.3004
MIMAT0004569hsa-miR-222*4193MDM2uccUAGAUGUGACCGAUGACUc :|||::|| ||||||| cauGUCUGUAC---CUACUGAu2201937[hg19:12:69203006-69203024:+]0.68341517-15.63-0.2734
MIMAT0009198hsa-miR-224*4193MDM2acaucAGUGAU--CCCGUGGUAAAa |||:|| ||||||| aaaucUCAUUAUCUAUAACCAUUUc21925392563[hg19:12:69236168-69236192:+]0.51021417-11.04-0.2379
MIMAT0009198hsa-miR-224*4193MDM2acaucAGUGAU--CCCGUGGUAAAa |||:|| ||||||| aaaucUCAUUAUCUAUAACCAUUUc21924832507[hg19:12:69236168-69236192:+]0.51021417-11.04-0.2452
MIMAT0009198hsa-miR-224*4193MDM2acaucAGUGAU--CCCGUGGUAAAa |||:|| ||||||| aaaucUCAUUAUCUAUAACCAUUUc21926972721[hg19:12:69236168-69236192:+]0.51021417-11.04-0.2183
MIMAT0004593hsa-miR-130a*4193MDM2cgucuGUCAUCGUG-UUACACUu |:||||||: ||||||| aguauCGGUAGCAUAAAUGUGAu21841544176[hg19:12:69237783-69237805:+]0.50561687-23.38-0.1151
MIMAT0004593hsa-miR-130a*4193MDM2cgucuGUCAUCGUG-UUACACUu |:||||||: ||||||| aguauCGGUAGCAUAAAUGUGAu21840984120[hg19:12:69237783-69237805:+]0.50561687-23.38-0.1190
MIMAT0004593hsa-miR-130a*4193MDM2cgucuGUCAUCGUG-UUACACUu |:||||||: ||||||| aguauCGGUAGCAUAAAUGUGAu21843124334[hg19:12:69237783-69237805:+]0.50561687-23.38-0.1046
MIMAT0004601hsa-miR-145*4193MDM2ucuUGUCAUAAAGGUCCU-UAGg ||:| | |:||||| ||| acuACGGAAAGUUCAGGACAUCa22024062428[hg19:12:69236035-69236057:+]0.51021270-16.52-0.1076
MIMAT0004601hsa-miR-145*4193MDM2ucuUGUCAUAAAGGUCCU-UAGg ||:| | |:||||| ||| acuACGGAAAGUUCAGGACAUCa22023502372[hg19:12:69236035-69236057:+]0.51021270-16.52-0.1113
MIMAT0000453hsa-miR-154*4193MDM2uuAUCCAG-UUGGC--ACAUACUAa || | | || || | |||||| auUAUGACUAAACGAUUAUAUGAUg221272296[hg19:12:69210616-69210640:+]0.74051226-6.61-0.2405
MIMAT0004615hsa-miR-195*4193MDM2ccUCGUCGUGUCGGUUAUAACc | || ||:| : |||||| gcAACAACAUAUUGUAUAUUGu221301322[hg19:12:69210645-69210666:+]0.73051286-8.01-0.1502
MIMAT0004657hsa-miR-200c*4193MDM2ggUUUGUGACGACCCA-UUCUGc | |:||| | ||| ||||| guAUAUACU--UAGGUGAAGACa22137433763[hg19:12:69237372-69237392:+]0.52111210-11.61-0.1811
MIMAT0004657hsa-miR-200c*4193MDM2ggUUUGUGACGACCCA-UUCUGc | |:||| | ||| ||||| guAUAUACU--UAGGUGAAGACa22136873707[hg19:12:69237372-69237392:+]0.52111210-11.61-0.1870
MIMAT0004657hsa-miR-200c*4193MDM2ggUUUGUGACGACCCA-UUCUGc | |:||| | ||| ||||| guAUAUACU--UAGGUGAAGACa22139013921[hg19:12:69237372-69237392:+]0.52111210-11.61-0.1655
MIMAT0004674hsa-miR-30c-1*4193MDM2ccUCAUUUGUUGGGAGAGGGUc | | |::: :::||||||| ugAUUUAGUGUUUUUCUCCCAu22137123733[hg19:12:69237341-69237362:+]0.52111527-16.42-0.2203
MIMAT0004674hsa-miR-30c-1*4193MDM2ccUCAUUUGUUGGGAGAGGGUc | | |::: :::||||||| ugAUUUAGUGUUUUUCUCCCAu22136563677[hg19:12:69237341-69237362:+]0.52111527-16.42-0.2272
MIMAT0004674hsa-miR-30c-1*4193MDM2ccUCAUUUGUUGGGAGAGGGUc | | |::: :::||||||| ugAUUUAGUGUUUUUCUCCCAu22138703891[hg19:12:69237341-69237362:+]0.52111527-16.42-0.2019
MIMAT0004675hsa-miR-219-2-3p4193MDM2uguCUACA--GGUCG-GUGU-UAAGa | ||| ||| | |||| |||| gguGCUGUAACCACCUCACAGAUUCc2203863[hg19:12:69203025-69203050:+]0.68341210-12.92-0.5137
MIMAT0004677hsa-miR-34c-3p4193MDM2ggaccggcACACCAAUCACUAa | ||| ||||||| caaaaauuUAUGGCUAGUGAUa21528232844[hg19:12:69236452-69236473:+]0.50611547-11.84-0.1125
MIMAT0004677hsa-miR-34c-3p4193MDM2ggaccggcACACCAAUCACUAa | ||| ||||||| caaaaauuUAUGGCUAGUGAUa21527672788[hg19:12:69236452-69236473:+]0.50611547-11.84-0.1163
MIMAT0004677hsa-miR-34c-3p4193MDM2ggaccggcACACCAAUCACUAa | ||| ||||||| caaaaauuUAUGGCUAGUGAUa21529813002[hg19:12:69236452-69236473:+]0.50611547-11.84-0.1022
MIMAT0004680hsa-miR-130b*4193MDM2caucacguuGUCCCUUUCUCa | | ||||||| caagcuucuCUGUGAAAGAGc213357377[hg19:12:69210701-69210721:+]0.72061447-10.62-0.6555
MIMAT0004680hsa-miR-130b*4193MDM2caucacguUGUCCCUUUCUCa || ||||||| acacuuauACUAUGAAAGAGg214141161[hg19:12:69207389-69207408,69208383-69208383:+]0.64811417-8.79-1.0615
MIMAT0004681hsa-miR-26a-2*4193MDM2cuUUGUUCA--UUAGUUCUU-AUCc | || || |: |||||| ||| ccACCAUGUCCAGCCAAGAAUUAGu221943967[hg19:12:69234572-69234596:+]0.51611230-8.00-0.1059
MIMAT0004681hsa-miR-26a-2*4193MDM2cuUUGUUCA--UUAGUUCUU-AUCc | || || |: |||||| ||| ccACCAUGUCCAGCCAAGAAUUAGu221887911[hg19:12:69234572-69234596:+]0.51611230-8.00-0.1100
MIMAT0004686hsa-miR-367*4193MDM2ucucaACGUA-UAAUCGUUGUca || || | ||||||| uuauaUG-AUGAGAAGCAACAac318287308[hg19:12:69210631-69210652:+]0.74051260-8.54-0.3984
MIMAT0000721hsa-miR-369-3p4193MDM2uuucuAGUUGGU-ACAUAAUAa |:::||| | |||||| uuaucUUGGCCAGUAUAUUAUg217256277[hg19:12:69210600-69210621:+]0.74051276-7.68-0.1601
MIMAT0000725hsa-miR-373*4193MDM2ccuuucgcGGGGGUAAAACUCa ::::: ||||||| uuuuuuuuUUUUUUUUUUGAGa2159961017[hg19:12:69234625-69234646:+]0.50521427-8.35-0.2755
MIMAT0000725hsa-miR-373*4193MDM2ccuuucgcggggguAAAACUCa ||||||| uaacuuauuauuuuUUUUGAGa29296317[hg19:12:69233925-69233946:+]0.47201407-8.35-0.1641
MIMAT0000725hsa-miR-373*4193MDM2ccuuucgcggggguAAAACUCa ||||||| uauuuuuauuuauuUUUUGAGa2949184939[hg19:12:69238547-69238568:+]0.50581407-8.35-0.2345
MIMAT0000725hsa-miR-373*4193MDM2ccuuucgcGGGGGUAAAACUCa ::::: ||||||| uuuuuuuuUUUUUUUUUUGAGa215940961[hg19:12:69234625-69234646:+]0.50521427-8.35-0.2846
MIMAT0000725hsa-miR-373*4193MDM2ccuuucgcggggguAAAACUCa ||||||| uaacuuauuauuuuUUUUGAGa29240261[hg19:12:69233925-69233946:+]0.47201407-8.35-0.1701
MIMAT0000725hsa-miR-373*4193MDM2ccuuucgcggggguAAAACUCa ||||||| uauuuuuauuuauuUUUUGAGa2948624883[hg19:12:69238547-69238568:+]0.50581407-8.35-0.2417
MIMAT0000725hsa-miR-373*4193MDM2ccuuucgcGGGGGUAAAACUCa ::::: ||||||| uuuuuuuuUUUUUUUUUUGAGa21511541175[hg19:12:69234625-69234646:+]0.50521427-8.35-0.2509
MIMAT0000725hsa-miR-373*4193MDM2ccuuucgcggggguAAAACUCa ||||||| uaacuuauuauuuuUUUUGAGa29454475[hg19:12:69233925-69233946:+]0.47201407-8.35-0.1481
MIMAT0000725hsa-miR-373*4193MDM2ccuuucgcggggguAAAACUCa ||||||| uauuuuuauuuauuUUUUGAGa2950765097[hg19:12:69238547-69238568:+]0.50581407-8.35-0.2151
MIMAT0000735hsa-miR-3804193MDM2uucuaCACCU--GGUAUAAUGUAu ||||| |:: ||||||| uauggGUGGAUGCUGAAUUACAUu21852615284[hg19:12:69238946-69238969:+]0.51301567-14.93-0.1023
MIMAT0000750hsa-miR-340*4193MDM2cgAUAUUUCAUUGACUCUGCCu ||| | | :|||||||| uuUAUUUAUUUUUUGAGACGGa22149224943[hg19:12:69238551-69238572:+]0.50581567-19.55-0.2786
MIMAT0000750hsa-miR-340*4193MDM2cgAUAUUUCAUUGACUCUGCCu ||| | | :|||||||| uuUAUUUAUUUUUUGAGACGGa22148664887[hg19:12:69238551-69238572:+]0.50581567-19.55-0.2868
MIMAT0000750hsa-miR-340*4193MDM2cgAUAUUUCAUUGACUCUGCCu ||| | | :|||||||| uuUAUUUAUUUUUUGAGACGGa22150805101[hg19:12:69238551-69238572:+]0.50581567-19.55-0.2563
MIMAT0000751hsa-miR-330-3p4193MDM2agagacguccggcacACGAAACg ||||||| augaacuccaaauaaUGCUUUGa2933813403[hg19:12:69237010-69237032:+]0.50611407-11.59-0.1007
MIMAT0000751hsa-miR-330-3p4193MDM2agagacguccggcacACGAAACg ||||||| augaacuccaaauaaUGCUUUGa2933253347[hg19:12:69237010-69237032:+]0.50611407-11.59-0.1042
MIMAT0004701hsa-miR-338-5p4193MDM2gugagUCGUGGUCCUAUAACAa |||| || ||||||| ugagaAGCAACAACAUAUUGUa218295316[hg19:12:69210639-69210660:+]0.74051617-11.73-1.2430
MIMAT0004703hsa-miR-335*4193MDM2ccAGUCCUCGUUA---UUACUUUUu |: || || || |||||||| uaUUUGGUGCUAUGUAAAUGAAAAu22113781402[hg19:12:69235007-69235031:+]0.51651557-8.93-0.1487
MIMAT0004703hsa-miR-335*4193MDM2ccAGUCCUCGUUA---UUACUUUUu |: || || || |||||||| uaUUUGGUGCUAUGUAAAUGAAAAu22113221346[hg19:12:69235007-69235031:+]0.51651557-8.93-0.1542
MIMAT0004703hsa-miR-335*4193MDM2ccAGUCCUCGUUA---UUACUUUUu |: || || || |||||||| uaUUUGGUGCUAUGUAAAUGAAAAu22115361560[hg19:12:69235007-69235031:+]0.51651557-8.93-0.1345
MIMAT0001639hsa-miR-409-3p4193MDM2uccccaaguggcUCGUUGUAag | |||||| augaugagaagcAACAACAUau311291312[hg19:12:69210635-69210656:+]0.74051220-8.12-0.2044
MIMAT0002170hsa-miR-4124193MDM2ugccgaucaccuGGUCCACUUCa ::|||||||| aauuguauauacUUAGGUGAAGa21237393761[hg19:12:69237368-69237390:+]0.52111477-14.31-0.3201
MIMAT0002170hsa-miR-4124193MDM2ugccgaucaccuGGUCCACUUCa ::|||||||| aauuguauauacUUAGGUGAAGa21236833705[hg19:12:69237368-69237390:+]0.52111477-14.31-0.3292
MIMAT0002170hsa-miR-4124193MDM2ugccgaucaccuGGUCCACUUCa ::|||||||| aauuguauauacUUAGGUGAAGa21238973919[hg19:12:69237368-69237390:+]0.52111477-14.31-0.2955
MIMAT0002176hsa-miR-485-3p4193MDM2ucucuccUCUCGGCACAUACUg | ||:: ||||||| ggaaccaACAGUU-UGUAUGAa21629072927[hg19:12:69236536-69236556:+]0.50611457-10.18-0.2564
MIMAT0002176hsa-miR-485-3p4193MDM2ucucuccUCUCGGCACAUACUg | ||:: ||||||| ggaaccaACAGUU-UGUAUGAa21628512871[hg19:12:69236536-69236556:+]0.50611457-10.18-0.2641
MIMAT0002176hsa-miR-485-3p4193MDM2ucucuccUCUCGGCACAUACUg | ||:: ||||||| ggaaccaACAGUU-UGUAUGAa21630653085[hg19:12:69236536-69236556:+]0.50611457-10.18-0.2355
MIMAT0002178hsa-miR-487a4193MDM2uugaccuacagggacAUACUAa |||||| augacuaaacgauuaUAUGAUg28275296[hg19:12:69210619-69210640:+]0.74051206-5.85-0.2470
MIMAT0004765hsa-miR-491-3p4193MDM2caUCUUCCCUUAGAAC--GUAUUc ||||| ||| : || ||||| acAGAAGUGAAAUGUGGACAUAAa22127472770[hg19:12:69236376-69236399:+]0.50611200-9.47-0.1061
MIMAT0004765hsa-miR-491-3p4193MDM2caUCUUCCCUUAGAAC--GUAUUc ||||| ||| : || ||||| acAGAAGUGAAAUGUGGACAUAAa22126912714[hg19:12:69236376-69236399:+]0.50611200-9.47-0.1098
MIMAT0002808hsa-miR-5114193MDM2acugACGUCUCGUUUUCUGUg |||| | |||||||| uuggUGCACA--AAAAGACAc218126144[hg19:12:69207374-69207392:+]0.68491547-16.90-1.0855
MIMAT0003161hsa-miR-4934193MDM2ggaccGUGUGUCAUCUGGA-AGu | | :||| ||||| || uauuuCCCCUAGUUGACCUGUCu218147169[hg19:12:69233618-69233640:+]0.59511210-11.37-0.1925
MIMAT0002842hsa-miR-518f4193MDM2ggagauuucUCUUCGCGAAAg || ||||||| aaaguuuuuAGUUGCGCUUUa21352985318[hg19:12:69238927-69238947:+]0.51571447-12.83-0.1753
MIMAT0002842hsa-miR-518f4193MDM2ggagauuucUCUUCGCGAAAg || ||||||| aaaguuuuuAGUUGCGCUUUa21352425262[hg19:12:69238927-69238947:+]0.51571447-12.83-0.1810
MIMAT0002842hsa-miR-518f4193MDM2ggagauuucUCUUCGCGAAAg || ||||||| aaaguuuuuAGUUGCGCUUUa21354565476[hg19:12:69238927-69238947:+]0.51571447-12.83-0.1601
MIMAT0002844hsa-miR-518b4193MDM2uggagauuuccccuCGCGAAAc ||||||| aaaaguuuuuaguuGCGCUUUa2952975318[hg19:12:69238926-69238947:+]0.51571407-11.95-0.1753
MIMAT0002844hsa-miR-518b4193MDM2uggagauuuccccuCGCGAAAc ||||||| aaaaguuuuuaguuGCGCUUUa2952415262[hg19:12:69238926-69238947:+]0.51571407-11.95-0.1810
MIMAT0002844hsa-miR-518b4193MDM2uggagauuuccccuCGCGAAAc ||||||| aaaaguuuuuaguuGCGCUUUa2954555476[hg19:12:69238926-69238947:+]0.51571407-11.95-0.1601
MIMAT0002848hsa-miR-518c4193MDM2ugugagauuucUCUUCGCGAAAc || ||||||| gaaaaguuuuuAGUUGCGCUUUa21352965318[hg19:12:69238925-69238947:+]0.51571447-11.53-0.1753
MIMAT0002848hsa-miR-518c4193MDM2ugugagauuucUCUUCGCGAAAc || ||||||| gaaaaguuuuuAGUUGCGCUUUa21352405262[hg19:12:69238925-69238947:+]0.51571447-11.53-0.1810
MIMAT0002848hsa-miR-518c4193MDM2ugugagauuucUCUUCGCGAAAc || ||||||| gaaaaguuuuuAGUUGCGCUUUa21354545476[hg19:12:69238925-69238947:+]0.51571447-11.53-0.1601
MIMAT0005457hsa-miR-518a-5p4193MDM2cuuucccgAAGGGAAACGUc ||::||||||| aaguaaaaUUUUCUUUGCAg21328512870[hg19:12:69236480-69236499:+]0.50611527-16.37-0.2113
MIMAT0005457hsa-miR-518a-5p4193MDM2cuuucccgAAGGGAAACGUc ||::||||||| aaguaaaaUUUUCUUUGCAg21327952814[hg19:12:69236480-69236499:+]0.50611527-16.37-0.2179
MIMAT0005457hsa-miR-518a-5p4193MDM2cuuucccgAAGGGAAACGUc ||::||||||| aaguaaaaUUUUCUUUGCAg21330093028[hg19:12:69236480-69236499:+]0.50611527-16.37-0.1934
MIMAT0002863hsa-miR-518a-3p4193MDM2aggucguuucccuuCGCGAAAg ||||||| aaaaguuuuuaguuGCGCUUUa2952975318[hg19:12:69238926-69238947:+]0.51571407-11.03-0.1770
MIMAT0002863hsa-miR-518a-3p4193MDM2aggucguuucccuuCGCGAAAg ||||||| aaaaguuuuuaguuGCGCUUUa2952415262[hg19:12:69238926-69238947:+]0.51571407-11.03-0.1827
MIMAT0002863hsa-miR-518a-3p4193MDM2aggucguuucccuuCGCGAAAg ||||||| aaaaguuuuuaguuGCGCUUUa2954555476[hg19:12:69238926-69238947:+]0.51571407-11.03-0.1616
MIMAT0002864hsa-miR-518d-3p4193MDM2cgagguuucccuuCGCGAAAc ||||||| aaaguuuuuaguuGCGCUUUa2952985318[hg19:12:69238927-69238947:+]0.51571407-11.29-0.1770
MIMAT0002864hsa-miR-518d-3p4193MDM2cgagguuucccuuCGCGAAAc ||||||| aaaguuuuuaguuGCGCUUUa2952425262[hg19:12:69238927-69238947:+]0.51571407-11.29-0.1827
MIMAT0002864hsa-miR-518d-3p4193MDM2cgagguuucccuuCGCGAAAc ||||||| aaaguuuuuaguuGCGCUUUa2954565476[hg19:12:69238927-69238947:+]0.51571407-11.29-0.1616
MIMAT0002868hsa-miR-5224193MDM2ugugagauuucccUUGGUAAAa |||||||| ucucauuaucuauAACCAUUUc21025422563[hg19:12:69236171-69236192:+]0.51021457-10.02-0.2422
MIMAT0002868hsa-miR-5224193MDM2ugugagauuucccUUGGUAAAa |||||||| ucucauuaucuauAACCAUUUc21024862507[hg19:12:69236171-69236192:+]0.51021457-10.02-0.2496
MIMAT0002868hsa-miR-5224193MDM2ugugagauuucccUUGGUAAAa |||||||| ucucauuaucuauAACCAUUUc21027002721[hg19:12:69236171-69236192:+]0.51021457-10.02-0.2223
MIMAT0002862hsa-miR-5274193MDM2cuuucccgAAGGGAAACGUc ||::||||||| aaguaaaaUUUUCUUUGCAg21328512870[hg19:12:69236480-69236499:+]0.50611527-16.37-0.2113
MIMAT0002862hsa-miR-5274193MDM2cuuucccgAAGGGAAACGUc ||::||||||| aaguaaaaUUUUCUUUGCAg21327952814[hg19:12:69236480-69236499:+]0.50611527-16.37-0.2179
MIMAT0002862hsa-miR-5274193MDM2cuuucccgAAGGGAAACGUc ||::||||||| aaguaaaaUUUUCUUUGCAg21330093028[hg19:12:69236480-69236499:+]0.50611527-16.37-0.1934
MIMAT0002871hsa-miR-500*4193MDM2gucuuaggaacggguCCACGUa |||||| uuauuaaagucuguuGGUGCAc28113134[hg19:12:69207361-69207382:+]0.68491206-12.19-0.2408
MIMAT0004774hsa-miR-501-3p4193MDM2ucuUAGGAACGGGC--CCACGUaa ||: |:|:| |||||| guuAUUAAAGUCUGUUGGUGCAca320112135[hg19:12:69207360-69207383:+]0.68491260-14.39-0.3803
MIMAT0004775hsa-miR-502-3p4193MDM2acUUAGGAACGGGUCCACGUaa || :| ||:: |||||| uaAAGUC-UGUU--GGUGCAca321117135[hg19:12:69207365-69207383:+]0.68491230-11.99-0.3576
MIMAT0004777hsa-miR-513a-3p4193MDM2ggaaGAGUCU-UUCCACUUUAAAu :|:||| || |||||||| ggaaUUUAGACAACCUGAAAUUUa2204871[hg19:12:69233677-69233700:+]0.55531627-11.87-0.2053
MIMAT0004777hsa-miR-513a-3p4193MDM2ggaaGAGUCUUUCCA-------CUUUAAAu :||||||| || ||||||| ugaaUUCAGAAAAGUUAAUUCAGAAAUUUg22018641893[hg19:12:69235493-69235522:+]0.53851507-14.16-0.1106
MIMAT0004777hsa-miR-513a-3p4193MDM2ggaaGAGUCUUUCCA-------CUUUAAAu :||||||| || ||||||| ugaaUUCAGAAAAGUUAAUUCAGAAAUUUg22018081837[hg19:12:69235493-69235522:+]0.53851507-14.16-0.1144
MIMAT0004777hsa-miR-513a-3p4193MDM2ggaaGAGUCU-UUCCACUUUAAAu :|:||| || |||||||| ggaaUUUAGACAACCUGAAAUUUa220206229[hg19:12:69233677-69233700:+]0.55531627-11.87-0.1846
MIMAT0004777hsa-miR-513a-3p4193MDM2ggaaGAGUCUUUCCA-------CUUUAAAu :||||||| || ||||||| ugaaUUCAGAAAAGUUAAUUCAGAAAUUUg22020222051[hg19:12:69235493-69235522:+]0.53851507-14.16-0.1005
MIMAT0002879hsa-miR-5074193MDM2aaGUGAGGUUUUCCACGUUUu ::||:: | | ||||||| ccUGCUUU-ACAUGUGCAAAg2206180[hg19:12:69233532-69233551:+]0.76171497-12.31-0.1471
MIMAT0004785hsa-miR-545*4193MDM2aguaGAUUAUUUGUAAAUGACu :|: ||| : ||||||| cucaUUGUUAACUCUUUACUGa21927122733[hg19:12:69236341-69236362:+]0.50581547-13.24-0.1256
MIMAT0004785hsa-miR-545*4193MDM2aguaGAUUAUUUGUAAAUGACu :|: ||| : ||||||| cucaUUGUUAACUCUUUACUGa21926562677[hg19:12:69236341-69236362:+]0.50581547-13.24-0.1298
MIMAT0004785hsa-miR-545*4193MDM2aguaGAUUAUUUGUAAAUGACu :|: ||| : ||||||| cucaUUGUUAACUCUUUACUGa21928702891[hg19:12:69236341-69236362:+]0.50581547-13.24-0.1143
MIMAT0003165hsa-miR-5454193MDM2cgugugUUAUUUACAAAC-GACu |||||: ||||| ||| gagccgAAUAAG-GUUUGCCUGa21730233044[hg19:12:69236708-69236729:+]0.50611260-15.59-0.1017
MIMAT0003221hsa-miR-5574193MDM2ucuguuCCGGGUGGGCACGUUUg | :::|| :||||||| uggccuGCUUUACAUGUGCAAAg2185880[hg19:12:69233529-69233551:+]0.76171537-19.26-0.1500
MIMAT0003225hsa-miR-5614193MDM2ugaaguuccuagaaUUUGAAAc ||||||| cauaaaugucacaaAAACUUUa2921662187[hg19:12:69235795-69235816:+]0.51111407-4.36-0.2754
MIMAT0003225hsa-miR-5614193MDM2ugaaguuccuagaaUUUGAAAc ||||||| cauaaaugucacaaAAACUUUa2921102131[hg19:12:69235795-69235816:+]0.51111407-4.36-0.2835
MIMAT0003225hsa-miR-5614193MDM2ugaaguuccuagaaUUUGAAAc ||||||| cauaaaugucacaaAAACUUUa2923242345[hg19:12:69235795-69235816:+]0.51111407-4.36-0.2533
MIMAT0003226hsa-miR-5624193MDM2cgUUUACCAUGUCGA-UGAAa ||||| | ||| |||| ucAAAUGAUUGUGCUAACUUa219128148[hg19:12:69233599-69233619:+]0.69621220-11.23-0.2208
MIMAT0003231hsa-miR-5674193MDM2caagacaggaCCUUCUUGUAUGa | || ||||||: augaugagaaGCAACAACAUAUu214291313[hg19:12:69210635-69210657:+]0.74051330-11.11-0.1230
MIMAT0004794hsa-miR-551b*4193MDM2ccAGAGUGGGUGCGAACUAAAg |:|:| : : |||||||| uuUUUUAGGUUUUCUUGAUUUa22114041425[hg19:12:69235033-69235054:+]0.50551527-11.64-0.1011
MIMAT0004794hsa-miR-551b*4193MDM2ccAGAGUGGGUGCGAACUAAAg | || :::|: :||||||| aaUAUCUUUUAU-UUUGAUUUu22129402960[hg19:12:69236569-69236589:+]0.50611507-9.76-0.3727
MIMAT0004794hsa-miR-551b*4193MDM2ccaGAGUGGGUG-CGAACUAAAg || | ::|| :||||||| augCUGAAUUACAUUUUGAUUUg22053265348[hg19:12:69238955-69238977:+]0.51301507-10.36-0.1263
MIMAT0004794hsa-miR-551b*4193MDM2ccagagUGGGUG-CGAACUAAAg |:: || |||||||| cuguggAUUAACUUCUUGAUUUa21736453667[hg19:12:69237274-69237296:+]0.51791477-10.83-0.1513
MIMAT0004794hsa-miR-551b*4193MDM2ccAGAGUGGGUGCGAACUAAAg |:|:| : : |||||||| uuUUUUAGGUUUUCUUGAUUUa22113481369[hg19:12:69235033-69235054:+]0.50551527-11.64-0.1050
MIMAT0004794hsa-miR-551b*4193MDM2ccAGAGUGGGUGCGAACUAAAg | || :::|: :||||||| aaUAUCUUUUAU-UUUGAUUUu22128842904[hg19:12:69236569-69236589:+]0.50611507-9.76-0.3828
MIMAT0004794hsa-miR-551b*4193MDM2ccaGAGUGGGUG-CGAACUAAAg || | ::|| :||||||| augCUGAAUUACAUUUUGAUUUg22052705292[hg19:12:69238955-69238977:+]0.51301507-10.36-0.1305
MIMAT0004794hsa-miR-551b*4193MDM2ccagagUGGGUG-CGAACUAAAg |:: || |||||||| cuguggAUUAACUUCUUGAUUUa21735893611[hg19:12:69237274-69237296:+]0.51791477-10.83-0.1563
MIMAT0004794hsa-miR-551b*4193MDM2ccAGAGUGGGUGCGAACUAAAg | || :::|: :||||||| aaUAUCUUUUAU-UUUGAUUUu22130983118[hg19:12:69236569-69236589:+]0.50611507-9.76-0.3453
MIMAT0004794hsa-miR-551b*4193MDM2ccaGAGUGGGUG-CGAACUAAAg || | ::|| :||||||| augCUGAAUUACAUUUUGAUUUg22054845506[hg19:12:69238955-69238977:+]0.51301507-10.36-0.1149
MIMAT0004794hsa-miR-551b*4193MDM2ccagagUGGGUG-CGAACUAAAg |:: || |||||||| cuguggAUUAACUUCUUGAUUUa21738033825[hg19:12:69237274-69237296:+]0.51791477-10.83-0.1379
MIMAT0003236hsa-miR-5714193MDM2gagugagucuaccGGUUGAGu ||||||| cucauccuuuacaCCAACUCc29192212[hg19:12:69233821-69233841:+]0.51981407-14.72-0.1719
MIMAT0003236hsa-miR-5714193MDM2gagugagucuaccGGUUGAGu ||||||| cucauccuuuacaCCAACUCc29136156[hg19:12:69233821-69233841:+]0.51981407-14.72-0.1782
MIMAT0003236hsa-miR-5714193MDM2gagugagucuaccGGUUGAGu ||||||| cucauccuuuacaCCAACUCc29350370[hg19:12:69233821-69233841:+]0.51981407-14.72-0.1552
MIMAT0003240hsa-miR-5754193MDM2cgaggacaggUUGACCGAg |||||||| aaaacaaaaaAACUGGCUu21048044822[hg19:12:69238433-69238451:+]0.50621457-13.20-0.1637
MIMAT0003240hsa-miR-5754193MDM2cgaggacaggUUGACCGAg |||||||| aaaacaaaaaAACUGGCUu21047484766[hg19:12:69238433-69238451:+]0.50621457-13.20-0.1691
MIMAT0003240hsa-miR-5754193MDM2cgaggacaggUUGACCGAg |||||||| aaaacaaaaaAACUGGCUu21049624980[hg19:12:69238433-69238451:+]0.50621457-13.20-0.1494
MIMAT0003242hsa-miR-5774193MDM2guccaugguuAUAAAAUAGAu | |||||||| auagagguucUUUUUUAUCUu212242262[hg19:12:69208464-69208469,69210592-69210606:+]0.66101477-12.11-0.8816
MIMAT0003244hsa-miR-5794193MDM2uuagcgccaaaUAUGGUUUACUu || :||||||| guagacaaccaAU-UCAAAUGAu213115136[hg19:12:69233586-69233607:+]0.69621427-7.28-0.2424
MIMAT0003244hsa-miR-5794193MDM2uuAGCGCCAAAUAUGGUUUACUu |:|: ||:| :||||||| uaUUGUAUAUUGU-UCAAAUGAu222310331[hg19:12:69210654-69210675:+]0.73051517-11.59-1.2276
MIMAT0003245hsa-miR-5804193MDM2ggaUUACUAAGUAGUAAGAGUu || || :: ||||||| uuaAAAGAAGUGCAAUUCUCAa22021852206[hg19:12:69235814-69235835:+]0.51021477-9.91-0.1165
MIMAT0003245hsa-miR-5804193MDM2ggaUUACUAAGUAGUAAGAGUu || || :: ||||||| uuaAAAGAAGUGCAAUUCUCAa22021292150[hg19:12:69235814-69235835:+]0.51021477-9.91-0.1204
MIMAT0003245hsa-miR-5804193MDM2ggaUUACUAAGUAGUAAGAGUu || || :: ||||||| uuaAAAGAAGUGCAAUUCUCAa22023432364[hg19:12:69235814-69235835:+]0.51021477-9.91-0.1059
MIMAT0003247hsa-miR-582-5p4193MDM2ucAUUGACCA--ACUUGUUG-ACAUu ||| |||| | :||||| |||| guUAA-UGGUACUAGACAACAUGUAa22227872811[hg19:12:69236416-69236440:+]0.50611300-14.94-0.2058
MIMAT0003247hsa-miR-582-5p4193MDM2ucauuGACCAACUUGUUGAC-AUu || || |:|||||| || gcauuCU-GUAAAGCAACUGCUAa21922252247[hg19:12:69235854-69235876:+]0.50921200-13.11-0.1275
MIMAT0003247hsa-miR-582-5p4193MDM2ucAUUGACCA--ACUUGUUG-ACAUu ||| |||| | :||||| |||| guUAA-UGGUACUAGACAACAUGUAa22227312755[hg19:12:69236416-69236440:+]0.50611300-14.94-0.2123
MIMAT0003247hsa-miR-582-5p4193MDM2ucauuGACCAACUUGUUGAC-AUu || || |:|||||| || gcauuCU-GUAAAGCAACUGCUAa21921692191[hg19:12:69235854-69235876:+]0.50921200-13.11-0.1318
MIMAT0003247hsa-miR-582-5p4193MDM2ucAUUGACCA--ACUUGUUG-ACAUu ||| |||| | :||||| |||| guUAA-UGGUACUAGACAACAUGUAa22229452969[hg19:12:69236416-69236440:+]0.50611300-14.94-0.1883
MIMAT0003247hsa-miR-582-5p4193MDM2ucauuGACCAACUUGUUGAC-AUu || || |:|||||| || gcauuCU-GUAAAGCAACUGCUAa21923832405[hg19:12:69235854-69235876:+]0.50921200-13.11-0.1160
MIMAT0003254hsa-miR-548b-3p4193MDM2uguuuucguuGACUCCAAGAAc || |||||||| ugucugauuuCUUAGGUUCUUu21342754296[hg19:12:69237904-69237925:+]0.51221527-11.67-0.2189
MIMAT0003254hsa-miR-548b-3p4193MDM2uguuuucguuGACUCCAAGAAc || |||||||| ugucugauuuCUUAGGUUCUUu21342194240[hg19:12:69237904-69237925:+]0.51221527-11.67-0.2257
MIMAT0003254hsa-miR-548b-3p4193MDM2uguuuucguuGACUCCAAGAAc || |||||||| ugucugauuuCUUAGGUUCUUu21344334454[hg19:12:69237904-69237925:+]0.51221527-11.67-0.2005
MIMAT0003254hsa-miR-548b-3p4193MDM2uguuuuCGUUGACUCCAAGAAc | :|: ||||||||| cuuucuGGGAUAGAGGUUCUUu217233254[hg19:12:69208455-69208469,69210592-69210598:+]0.64501567-14.11-1.0467
MIMAT0003255hsa-miR-5884193MDM2caAGAUUGGGUAACACCGGUu ||| :::|| |||||| guUCUUUUUUAUCUUGGCCAg220248268[hg19:12:69210592-69210612:+]0.74051276-20.51-0.2697
MIMAT0003256hsa-miR-589*4193MDM2agacccuuggccGUAAACAAGACu :| |||||||| uuugaucucuuuUAAUUGUUCUGa21330383061[hg19:12:69236667-69236690:+]0.50611487-13.54-0.1635
MIMAT0003256hsa-miR-589*4193MDM2agacccuuggccGUAAACAAGACu :| |||||||| uuugaucucuuuUAAUUGUUCUGa21329823005[hg19:12:69236667-69236690:+]0.50611487-13.54-0.1688
MIMAT0003256hsa-miR-589*4193MDM2agacccuuggccGUAAACAAGACu :| |||||||| uuugaucucuuuUAAUUGUUCUGa21331963219[hg19:12:69236667-69236690:+]0.50611487-13.54-0.1491
MIMAT0003261hsa-miR-593*4193MDM2cgACUCGUUACGGACCGACCACGga | | :|| |:|| |:|||||| agUUAUUAAAGUCU-GUUGGUGCac324111134[hg19:12:69207359-69207382:+]0.68491450-19.76-0.1968
MIMAT0003263hsa-miR-5954193MDM2ucuguguggugccgUGUGAAg |||||| uggugcacaaaaagACACUUa28127147[hg19:12:69207375-69207395:+]0.68491206-13.82-0.3611
MIMAT0003271hsa-miR-6034193MDM2cgUUUUCAUUAACGUCACACAc |||: ||||| ||||||| uuAAAGAUAAUU--AGUGUGUa22152305249[hg19:12:69238859-69238878:+]0.51341657-13.50-0.1588
MIMAT0003271hsa-miR-6034193MDM2cgUUUUCAUUAACGUCACACAc |||: ||||| ||||||| uuAAAGAUAAUU--AGUGUGUa22151745193[hg19:12:69238859-69238878:+]0.51341657-13.50-0.1641
MIMAT0003271hsa-miR-6034193MDM2cgUUUUCAUUAACGUCACACAc |||: ||||| ||||||| uuAAAGAUAAUU--AGUGUGUa22153885407[hg19:12:69238859-69238878:+]0.51341657-13.50-0.1449
MIMAT0003273hsa-miR-6054193MDM2uccUCUUCCGUGGUACCCUAAAu | || | ::||||||||| aaaAAAAUCCUUUAUGGGAUUUa22117121734[hg19:12:69235341-69235363:+]0.50451607-15.91-0.1503
MIMAT0003273hsa-miR-6054193MDM2uccUCUUCCGUGGUACCCUAAAu | || | ::||||||||| aaaAAAAUCCUUUAUGGGAUUUa22116561678[hg19:12:69235341-69235363:+]0.50451607-15.91-0.1553
MIMAT0003273hsa-miR-6054193MDM2uccUCUUCCGUGGUACCCUAAAu | || | ::||||||||| aaaAAAAUCCUUUAUGGGAUUUa22118701892[hg19:12:69235341-69235363:+]0.50451607-15.91-0.1370
MIMAT0003275hsa-miR-6074193MDM2caaUAUCUAGACCUAAACUUg :|:|||:|| ||||||| acaGUGGAUUUGAAUUUGAAa21922582278[hg19:12:69235887-69235907:+]0.50921707-16.71-0.2686
MIMAT0003275hsa-miR-6074193MDM2caAUAUCUAGACCUAAACUUg | || ||:| ||||||| uuUCUAUAUUUACAUUUGAAa22025602580[hg19:12:69236189-69236209:+]0.51021597-6.15-0.1435
MIMAT0003275hsa-miR-6074193MDM2caaUAUCUAGACCUAAACUUg ||||| | ||||||| aaaAUAGAAAU-UAUUUGAAu21943774396[hg19:12:69238006-69238025:+]0.51541527-9.32-0.2234
MIMAT0003275hsa-miR-6074193MDM2caaUAUCUAGACCUAAACUUg :|:|||:|| ||||||| acaGUGGAUUUGAAUUUGAAa21922022222[hg19:12:69235887-69235907:+]0.50921707-16.71-0.2766
MIMAT0003275hsa-miR-6074193MDM2caAUAUCUAGACCUAAACUUg | || ||:| ||||||| uuUCUAUAUUUACAUUUGAAa22025042524[hg19:12:69236189-69236209:+]0.51021597-6.15-0.1483
MIMAT0003275hsa-miR-6074193MDM2caaUAUCUAGACCUAAACUUg ||||| | ||||||| aaaAUAGAAAU-UAUUUGAAu21943214340[hg19:12:69238006-69238025:+]0.51541527-9.32-0.2304
MIMAT0003275hsa-miR-6074193MDM2caaUAUCUAGACCUAAACUUg :|:|||:|| ||||||| acaGUGGAUUUGAAUUUGAAa21924162436[hg19:12:69235887-69235907:+]0.50921707-16.71-0.2469
MIMAT0003275hsa-miR-6074193MDM2caAUAUCUAGACCUAAACUUg | || ||:| ||||||| uuUCUAUAUUUACAUUUGAAa22027182738[hg19:12:69236189-69236209:+]0.51021597-6.15-0.1307
MIMAT0003275hsa-miR-6074193MDM2caaUAUCUAGACCUAAACUUg ||||| | ||||||| aaaAUAGAAAU-UAUUUGAAu21945354554[hg19:12:69238006-69238025:+]0.51541527-9.32-0.2048
MIMAT0003284hsa-miR-616*4193MDM2uucAGUGACUUCCCAAAACUCa |:|:| | ||||||| aacUUAUU-AUUUUUUUUGAGa220297317[hg19:12:69233926-69233946:+]0.47201417-6.28-0.1579
MIMAT0003284hsa-miR-616*4193MDM2uucagugacuucccAAAACUCa ||||||| uuuuuuuuuuuuuuUUUUGAGa299961017[hg19:12:69234625-69234646:+]0.50521407-5.71-0.2707
MIMAT0003284hsa-miR-616*4193MDM2uucagugacuucccAAAACUCa ||||||| uauuuuuauuuauuUUUUGAGa2949184939[hg19:12:69238547-69238568:+]0.50581407-5.92-0.2241
MIMAT0003284hsa-miR-616*4193MDM2uucAGUGACUUCCCAAAACUCa |:|:| | ||||||| aacUUAUU-AUUUUUUUUGAGa220241261[hg19:12:69233926-69233946:+]0.47201417-6.28-0.1637
MIMAT0003284hsa-miR-616*4193MDM2uucagugacuucccAAAACUCa ||||||| uuuuuuuuuuuuuuUUUUGAGa29940961[hg19:12:69234625-69234646:+]0.50521407-5.71-0.2798
MIMAT0003284hsa-miR-616*4193MDM2uucagugacuucccAAAACUCa ||||||| uauuuuuauuuauuUUUUGAGa2948624883[hg19:12:69238547-69238568:+]0.50581407-5.92-0.2311
MIMAT0003284hsa-miR-616*4193MDM2uucAGUGACUUCCCAAAACUCa |:|:| | ||||||| aacUUAUU-AUUUUUUUUGAGa220455475[hg19:12:69233926-69233946:+]0.47201417-6.28-0.1424
MIMAT0003284hsa-miR-616*4193MDM2uucagugacuucccAAAACUCa ||||||| uuuuuuuuuuuuuuUUUUGAGa2911541175[hg19:12:69234625-69234646:+]0.50521407-5.71-0.2465
MIMAT0003284hsa-miR-616*4193MDM2uucagugacuucccAAAACUCa ||||||| uauuuuuauuuauuUUUUGAGa2950765097[hg19:12:69238547-69238568:+]0.50581407-5.92-0.2054
MIMAT0003285hsa-miR-548c-3p4193MDM2cguuuucAUUAACUCUAAAAAc ||||| |||||||| cauuauaUAAUUAAGAUUUUUu21648724893[hg19:12:69238501-69238522:+]0.51231677-8.12-0.3135
MIMAT0003285hsa-miR-548c-3p4193MDM2cguuuucAUUAACUCUAAAAAc ||||| |||||||| cauuauaUAAUUAAGAUUUUUu21648164837[hg19:12:69238501-69238522:+]0.51231677-8.12-0.3224
MIMAT0003285hsa-miR-548c-3p4193MDM2cguuuucAUUAACUCUAAAAAc ||||| |||||||| cauuauaUAAUUAAGAUUUUUu21650305051[hg19:12:69238501-69238522:+]0.51231677-8.12-0.2892
MIMAT0003293hsa-miR-624*4193MDM2acuuguguUCCAUGACCAUGAu :| || ||||||| cgcuauuuGGUUAAUGGUACUa21527782799[hg19:12:69236407-69236428:+]0.50611507-17.67-0.1833
MIMAT0003293hsa-miR-624*4193MDM2acuuguguUCCAUGACCAUGAu :| || ||||||| cgcuauuuGGUUAAUGGUACUa21527222743[hg19:12:69236407-69236428:+]0.50611507-17.67-0.1892
MIMAT0003293hsa-miR-624*4193MDM2acuuguguUCCAUGACCAUGAu :| || ||||||| cgcuauuuGGUUAAUGGUACUa21529362957[hg19:12:69236407-69236428:+]0.50611507-17.67-0.1675
MIMAT0004810hsa-miR-6294193MDM2ucAAGAGGGUUG-CAU-UUGGGu | :|:|:||| || ||||| uaUAUUUCUAACUAUAUAACCCu2202446[hg19:12:69233653-69233675:+]0.55951220-14.28-0.1541
MIMAT0004810hsa-miR-6294193MDM2ucAAGAGGGUUG-CAU-UUGGGu | :|:|:||| || ||||| uaUAUUUCUAACUAUAUAACCCu220182204[hg19:12:69233653-69233675:+]0.55951220-14.28-0.1278
MIMAT0003312hsa-miR-6424193MDM2guucuGUGUAAACCUCUCCCUg :|:|| | ||||||| ucaauUAUAUGU-AAGAGGGAc21854345454[hg19:12:69239063-69239083:+]0.54141477-20.06-0.1314
MIMAT0003312hsa-miR-6424193MDM2guucuGUGUAAACCUCUCCCUg :|:|| | ||||||| ucaauUAUAUGU-AAGAGGGAc21853785398[hg19:12:69239063-69239083:+]0.54141477-20.06-0.1359
MIMAT0003312hsa-miR-6424193MDM2guucuGUGUAAACCUCUCCCUg :|:|| | ||||||| ucaauUAUAUGU-AAGAGGGAc21855925612[hg19:12:69239063-69239083:+]0.54141477-20.06-0.1197
MIMAT0003314hsa-miR-6444193MDM2cgAGAUUCUUUCGGUGUGa |:| |||||||||| uuUUUUUUAAAGCCACACa21832503268[hg19:12:69236879-69236897:+]0.50851577-16.29-0.2888
MIMAT0003314hsa-miR-6444193MDM2cgAGAUUCUUUCGGUGUGa |:| |||||||||| uuUUUUUUAAAGCCACACa21831943212[hg19:12:69236879-69236897:+]0.50851577-16.29-0.2972
MIMAT0003314hsa-miR-6444193MDM2cgAGAUUCUUUCGGUGUGa |:| |||||||||| uuUUUUUUAAAGCCACACa21834083426[hg19:12:69236879-69236897:+]0.50851577-16.29-0.2659
MIMAT0003319hsa-miR-6494193MDM2cuGAGAACUUGUUGUGUC-CAAa ||:|| | :::|||| ||| caCUUUUAAUGGGUACAGAGUUa22133263348[hg19:12:69236955-69236977:+]0.50891240-11.95-0.1718
MIMAT0003319hsa-miR-6494193MDM2cuGAGAACUUGUUGUGUC-CAAa ||:|| | :::|||| ||| caCUUUUAAUGGGUACAGAGUUa22132703292[hg19:12:69236955-69236977:+]0.50891240-11.95-0.1774
MIMAT0003319hsa-miR-6494193MDM2cuGAGAACUUGUUGUGUC-CAAa ||:|| | :::|||| ||| caCUUUUAAUGGGUACAGAGUUa22134843506[hg19:12:69236955-69236977:+]0.50891240-11.95-0.1568
MIMAT0003323hsa-miR-548d-3p4193MDM2cgUUUUCUU--UGACACCAAAAAc | :|||| ||| |||||||| aaAUGAGAAGUACU-UGGUUUUUu221241263[hg19:12:69233870-69233892:+]0.47831617-13.30-0.2314
MIMAT0003323hsa-miR-548d-3p4193MDM2cgUUUUCUU--UGACACCAAAAAc | :|||| ||| |||||||| aaAUGAGAAGUACU-UGGUUUUUu221185207[hg19:12:69233870-69233892:+]0.47831617-13.30-0.2394
MIMAT0003323hsa-miR-548d-3p4193MDM2cgUUUUCUU--UGACACCAAAAAc | :|||| ||| |||||||| aaAUGAGAAGUACU-UGGUUUUUu221399421[hg19:12:69233870-69233892:+]0.47831617-13.30-0.2100
MIMAT0003332hsa-miR-6564193MDM2ucuccaacugacaUAUUAUAa ||||||| gaaaauagcucaaAUAAUAUc2929252945[hg19:12:69236554-69236574:+]0.50611407-3.34-0.1515
MIMAT0003332hsa-miR-6564193MDM2ucuccaacugacaUAUUAUAa ||||||| gaaaauagcucaaAUAAUAUc2928692889[hg19:12:69236554-69236574:+]0.50611407-3.34-0.1565
MIMAT0003332hsa-miR-6564193MDM2ucuccaacugacaUAUUAUAa ||||||| gaaaauagcucaaAUAAUAUc2930833103[hg19:12:69236554-69236574:+]0.50611407-3.34-0.1381
MIMAT0003338hsa-miR-6604193MDM2guugagGCUAUACGUUACCCAu | | | :||||||| acaaaaCCACUUUUAAUGGGUa21733193340[hg19:12:69236948-69236969:+]0.50891447-16.87-0.2168
MIMAT0003338hsa-miR-6604193MDM2guugagGCUAUACGUUACCCAu | | | :||||||| acaaaaCCACUUUUAAUGGGUa21732633284[hg19:12:69236948-69236969:+]0.50891447-16.87-0.2236
MIMAT0003338hsa-miR-6604193MDM2guugagGCUAUACGUUACCCAu | | | :||||||| acaaaaCCACUUUUAAUGGGUa21734773498[hg19:12:69236948-69236969:+]0.50891447-16.87-0.1986
MIMAT0005791hsa-miR-12644193MDM2uuGUCCACGAGUUU-AUUC-UGAAc | || | ||:: |||| |||| ccCUGGAUCCCAGGUUAAGAACUUc222175199[hg19:12:69208397-69208421:+]0.61131200-10.54-0.6471
MIMAT0003882hsa-miR-767-5p4193MDM2guACGAGUCU-GUUGG-UACCACGu ||: :: | | ||: ||||||| caUGUCUGUACCUACUGAUGGUGCu2221943[hg19:12:69203006-69203030:+]0.68341477-18.11-0.4882
MIMAT0003882hsa-miR-767-5p4193MDM2guacgagucuguugguACCACGu |||||| aguuauuaaagucuguUGGUGCa28111133[hg19:12:69207359-69207381:+]0.68491206-16.07-0.1933
MIMAT0005795hsa-miR-13234193MDM2ucUUUUACGGGGAGUCAAA-ACu ||| ||::: ||||| || aaAAAUUGUUUAAAAGUUUGUGa22153845406[hg19:12:69239013-69239035:+]0.49391200-9.79-0.2897
MIMAT0005795hsa-miR-13234193MDM2ucUUUUACGGGGAGUCAAA-ACu ||| ||::: ||||| || aaAAAUUGUUUAAAAGUUUGUGa22153285350[hg19:12:69239013-69239035:+]0.49391200-9.79-0.2982
MIMAT0005795hsa-miR-13234193MDM2ucUUUUACGGGGAGUCAAA-ACu ||| ||::: ||||| || aaAAAUUGUUUAAAAGUUUGUGa22155425564[hg19:12:69239013-69239035:+]0.49391200-9.79-0.2668
MIMAT0003887hsa-miR-769-3p4193MDM2uugguucUGGGGCCUCUAGGGUc |:||| | ||||||| cuugggcAUCCCUG-GAUCCCAg217166187[hg19:12:69208388-69208409:+]0.61131547-26.46-0.1672
MIMAT0009206hsa-miR-21134193MDM2cacugucucgguuCGUGUUUa ||||||| aaagucuguugguGCACAAAa29118138[hg19:12:69207366-69207386:+]0.68491407-9.74-1.2177
MIMAT0003945hsa-miR-7654193MDM2guaguGGAA-GGAAGAG-GAGGu |||| :||||| |||| cugauCCUUAGUUUCUCUCUCCa21713181340[hg19:12:69234947-69234969:+]0.51061230-22.06-0.2761
MIMAT0003945hsa-miR-7654193MDM2guaguGGAA-GGAAGAG-GAGGu |||| :||||| |||| cugauCCUUAGUUUCUCUCUCCa21712621284[hg19:12:69234947-69234969:+]0.51061230-22.06-0.2853
MIMAT0003945hsa-miR-7654193MDM2guaguGGAA-GGAAGAG-GAGGu |||| :||||| |||| cugauCCUUAGUUUCUCUCUCCa21714761498[hg19:12:69234947-69234969:+]0.51061230-22.06-0.2515
MIMAT0004901hsa-miR-2984193MDM2acccucuuggagggacGAAGACGa ||||||| gaucccagguuaagaaCUUCUGCa29180203[hg19:12:69208402-69208425:+]0.61131407-18.75-1.1166
MIMAT0004910hsa-miR-450b-3p4193MDM2auaccuacguuuuaCUAGGGUu ||||||| cuugggcaucccugGAUCCCAg29166187[hg19:12:69208388-69208409:+]0.61131407-17.52-0.1834
MIMAT0004918hsa-miR-892b4193MDM2agaugggucuuuccUCGGUCAc :|||||| uucuuuuuuaucuuGGCCAGUa29249270[hg19:12:69210593-69210614:+]0.74051246-11.94-0.6645
MIMAT0004919hsa-miR-541*4193MDM2ucacccuggcugucgucUUAGGAAa ||||||| auaauuaagauuuuuuaAAUCCUUa2948784902[hg19:12:69238507-69238531:+]0.49441407-7.80-0.5471
MIMAT0004919hsa-miR-541*4193MDM2ucacccuggcugucgucUUAGGAAa ||||||| auaauuaagauuuuuuaAAUCCUUa2948224846[hg19:12:69238507-69238531:+]0.49441407-7.80-0.5592
MIMAT0004919hsa-miR-541*4193MDM2ucacccuggcugucgucUUAGGAAa ||||||| auaauuaagauuuuuuaAAUCCUUa2950365060[hg19:12:69238507-69238531:+]0.49441407-7.80-0.5135
MIMAT0004925hsa-miR-876-3p4193MDM2acUUAAUGAAACAUUUGGUGGu :|| :: ||| ||||||| cuGAUGGUGCUGU-AACCACCu2213353[hg19:12:69203020-69203040:+]0.68341507-15.60-0.4275
MIMAT0004946hsa-miR-744*4193MDM2uccaacuccaaucacCGUUGUc |||||| auuauaugaugagaaGCAACAa28286307[hg19:12:69210630-69210651:+]0.74051206-8.86-0.4033
MIMAT0004956hsa-miR-374b*4193MDM2uuacUAUUAUGUUGGACGAUUc :||| :||| ||||||| uucuGUAAAGCAA-CUGCUAAu21921722192[hg19:12:69235857-69235877:+]0.50921607-11.72-0.1017
MIMAT0004977hsa-miR-9344193MDM2ggucacagaGGUCAU-CAUCUGu |||||| |||||| aagcccugcCCAGUAUGUAGACa21499121[hg19:12:69233570-69233592:+]0.76171296-23.31-0.3221
MIMAT0004985hsa-miR-9424193MDM2guguaccgguuuuguCUCUUCu |||||| aaacgauuauaugauGAGAAGc28281302[hg19:12:69210625-69210646:+]0.74051206-10.23-0.3791
MIMAT0004987hsa-miR-9444193MDM2gaguaGGCUACAUGUUAUUAAa |: || | ||||||| aacucCUAAUUUUAAAUAAUUu218207228[hg19:12:69233836-69233857:+]0.51981497-7.07-0.1694
MIMAT0004987hsa-miR-9444193MDM2gaguaGGCUACAUGUUAUUAAa |: || | ||||||| aacucCUAAUUUUAAAUAAUUu218151172[hg19:12:69233836-69233857:+]0.51981497-7.07-0.1756
MIMAT0004987hsa-miR-9444193MDM2gaguaGGCUACAUGUUAUUAAa |: || | ||||||| aacucCUAAUUUUAAAUAAUUu218365386[hg19:12:69233836-69233857:+]0.51981497-7.07-0.1530
MIMAT0005827hsa-miR-11824193MDM2caguguagggagggUUCUGGGAg :||||||| cagcuucggaacaaGAGACCCUg2106385[hg19:12:69203050-69203072:+]0.69381417-15.28-0.4487
MIMAT0005828hsa-miR-11834193MDM2acgggugagagugguaguggAUGUCAc |||||| cugcacuagagauacaugagUACAGUa28199225[hg19:12:69208421-69208447:+]0.61221206-13.44-0.1372
MIMAT0005871hsa-miR-1207-5p4193MDM2ggggagggucggaGGGACGGu ||||||| gaaaaggaauaagCCCUGCCc2989109[hg19:12:69233560-69233580:+]0.76171407-15.08-0.1253
MIMAT0005872hsa-miR-1207-3p4193MDM2cuuuacucccGGUCGACu ||||||| uaccaccauaCCAGCUGa2911441161[hg19:12:69234773-69234790:+]0.50841407-15.67-0.3989
MIMAT0005872hsa-miR-1207-3p4193MDM2cuuuacucccGGUCGACu ||||||| uaccaccauaCCAGCUGa2910881105[hg19:12:69234773-69234790:+]0.50841407-15.67-0.4106
MIMAT0005872hsa-miR-1207-3p4193MDM2cuuuacucccGGUCGACu ||||||| uaccaccauaCCAGCUGa2913021319[hg19:12:69234773-69234790:+]0.50841407-15.67-0.3670
MIMAT0005873hsa-miR-12084193MDM2aggcggacagacUUGUCACu ||||||| aaucuuaagcaaAACAGUGa2936803699[hg19:12:69237309-69237328:+]0.51791407-11.98-0.5037
MIMAT0005873hsa-miR-12084193MDM2aggcggacagacUUGUCACu ||||||| aaucuuaagcaaAACAGUGa2936243643[hg19:12:69237309-69237328:+]0.51791407-11.98-0.5155
MIMAT0005873hsa-miR-12084193MDM2aggcggacagacUUGUCACu ||||||| aaucuuaagcaaAACAGUGa2938383857[hg19:12:69237309-69237328:+]0.51791407-11.98-0.4713
MIMAT0005876hsa-miR-12854193MDM2uccagagugaaacaACGGGUCu ||||||| aaaggaauaagcccUGCCCAGu2991112[hg19:12:69233562-69233583:+]0.76171407-15.37-0.1037
MIMAT0005878hsa-miR-12874193MDM2cugagcuuGGUGACU-AGGUCGu :||| || |||||| uaaccaccUCACAGAUUCCAGCu2154567[hg19:12:69203032-69203054:+]0.68861226-16.14-0.5160
MIMAT0005880hsa-miR-12904193MDM2agggacuaggUUUUUAGGu |||||||| ucacacacaaAAAAAUCCu21017041722[hg19:12:69235333-69235351:+]0.49801457-7.35-0.1247
MIMAT0005880hsa-miR-12904193MDM2agggacuaggUUUUUAGGu |||||||| ucacacacaaAAAAAUCCu21016481666[hg19:12:69235333-69235351:+]0.49801457-7.35-0.1289
MIMAT0005880hsa-miR-12904193MDM2agggacuaggUUUUUAGGu |||||||| ucacacacaaAAAAAUCCu21018621880[hg19:12:69235333-69235351:+]0.49801457-7.35-0.1134
MIMAT0005882hsa-miR-548k4193MDM2ucguuUUAGGCGUUCAUGAAAa |||:: : ||||||| uggcuAAUUU-UUUGUACUUUu218456476[hg19:12:69234085-69234105:+]0.50691437-10.21-0.1305
MIMAT0005882hsa-miR-548k4193MDM2ucguuUUAGGCGUUCAUGAAAa |||:: : ||||||| uggcuAAUUU-UUUGUACUUUu218400420[hg19:12:69234085-69234105:+]0.50691437-10.21-0.1354
MIMAT0005882hsa-miR-548k4193MDM2ucguuUUAGGCGUUCAUGAAAa |||:: : ||||||| uggcuAAUUU-UUUGUACUUUu218614634[hg19:12:69234085-69234105:+]0.50691437-10.21-0.1174
MIMAT0005884hsa-miR-12944193MDM2ucUGUUGUUACG--GUUGGAGUGu |::::: ||: | ||||||| ugAUGGUGCUGUAACCACCUCACa2213457[hg19:12:69203021-69203044:+]0.68341477-19.14-0.7359
MIMAT0005892hsa-miR-13044193MDM2guguagagugacauCGGAGUUu ||||||| caaagugagaaaauGCCUCAAu2983104[hg19:12:69233712-69233733:+]0.52951407-10.90-0.1276
MIMAT0005892hsa-miR-13044193MDM2guguagagugacauCGGAGUUu ||||||| caaagugagaaaauGCCUCAAu292748[hg19:12:69233712-69233733:+]0.52951407-10.90-0.1560
MIMAT0005892hsa-miR-13044193MDM2guguagagugacauCGGAGUUu ||||||| caaagugagaaaauGCCUCAAu29241262[hg19:12:69233712-69233733:+]0.52951407-10.90-0.1148
MIMAT0005893hsa-miR-13054193MDM2agAGAGGGUAAUCUCAACUUUu |:|||| || |||||||| ugUUUCCCCCUA-AGUUGAAAa22117461766[hg19:12:69235375-69235395:+]0.51631667-19.44-0.1764
MIMAT0005893hsa-miR-13054193MDM2agagaggguaaUCUCAACUUUu | |||||||| augcagugaagACAGUUGAAAa21223332354[hg19:12:69235962-69235983:+]0.51021477-9.66-0.1295
MIMAT0005893hsa-miR-13054193MDM2agAGAGG-GUAAU---CUCAACUUUu |||:: :| || | ||||||| guUCUUUAUAGUACACGUGUUGAAAa22142904315[hg19:12:69237919-69237944:+]0.53471467-12.39-0.2675
MIMAT0005893hsa-miR-13054193MDM2agAGAGGGUAAUCUCAACUUUu |:|||| || |||||||| ugUUUCCCCCUA-AGUUGAAAa22116901710[hg19:12:69235375-69235395:+]0.51631667-19.44-0.1821
MIMAT0005893hsa-miR-13054193MDM2agagaggguaaUCUCAACUUUu | |||||||| augcagugaagACAGUUGAAAa21222772298[hg19:12:69235962-69235983:+]0.51021477-9.66-0.1339
MIMAT0005893hsa-miR-13054193MDM2agAGAGG-GUAAU---CUCAACUUUu |||:: :| || | ||||||| guUCUUUAUAGUACACGUGUUGAAAa22142344259[hg19:12:69237919-69237944:+]0.53471467-12.39-0.2755
MIMAT0005893hsa-miR-13054193MDM2agAGAGGGUAAUCUCAACUUUu |:|||| || |||||||| ugUUUCCCCCUA-AGUUGAAAa22119041924[hg19:12:69235375-69235395:+]0.51631667-19.44-0.1611
MIMAT0005893hsa-miR-13054193MDM2agagaggguaaUCUCAACUUUu | |||||||| augcagugaagACAGUUGAAAa21224912512[hg19:12:69235962-69235983:+]0.51021477-9.66-0.1178
MIMAT0005893hsa-miR-13054193MDM2agAGAGG-GUAAU---CUCAACUUUu |||:: :| || | ||||||| guUCUUUAUAGUACACGUGUUGAAAa22144484473[hg19:12:69237919-69237944:+]0.53471467-12.39-0.2460
MIMAT0005896hsa-miR-12444193MDM2uugguAGAGUAUGUUUGGUUGA-UGAa | |:|| :||| |||| ||| agaauUGUUAUUUAAA--AACUAACUg22219001924[hg19:12:69235529-69235553:+]0.53091220-13.03-0.1697
MIMAT0005896hsa-miR-12444193MDM2uugguAGAGUAUGUUUGGUUGA-UGAa | |:|| :||| |||| ||| agaauUGUUAUUUAAA--AACUAACUg22218441868[hg19:12:69235529-69235553:+]0.53091220-13.03-0.1752
MIMAT0005896hsa-miR-12444193MDM2uugguAGAGUAUGUUUGGUUGA-UGAa | |:|| :||| |||| ||| agaauUGUUAUUUAAA--AACUAACUg22220582082[hg19:12:69235529-69235553:+]0.53091220-13.03-0.1549
MIMAT0005898hsa-miR-12464193MDM2ggacGAGG-UUUUUAG-GUAa :||| ||||||| ||| agguUUCCUAAAAAUCUCAUu21625282548[hg19:12:69236157-69236177:+]0.51021260-13.09-0.1192
MIMAT0005898hsa-miR-12464193MDM2ggacGAGG-UUUUUAG-GUAa :||| ||||||| ||| agguUUCCUAAAAAUCUCAUu21624722492[hg19:12:69236157-69236177:+]0.51021260-13.09-0.1233
MIMAT0005898hsa-miR-12464193MDM2ggacGAGG-UUUUUAG-GUAa :||| ||||||| ||| agguUUCCUAAAAAUCUCAUu21626862706[hg19:12:69236157-69236177:+]0.51021260-13.09-0.1084
MIMAT0005904hsa-miR-12534193MDM2acGUCCGACUAGAAGAAGAGa || : ||| |||||||| uuCACAUAGAU-UUCUUCUCu220104123[hg19:12:69233733-69233752:+]0.51101537-14.38-0.2308
MIMAT0005904hsa-miR-12534193MDM2acGUCCGACUAGAAGAAGAGa || : ||| |||||||| uuCACAUAGAU-UUCUUCUCu2204867[hg19:12:69233733-69233752:+]0.51101537-14.38-0.2255
MIMAT0005904hsa-miR-12534193MDM2acGUCCGACUAGAAGAAGAGa || : ||| |||||||| uuCACAUAGAU-UUCUUCUCu220262281[hg19:12:69233733-69233752:+]0.51101537-14.38-0.2094
MIMAT0005905hsa-miR-12544193MDM2ugacguCCGAGGUCGAAGGU-CCGa ||:| || : |||| ||| aaaaauGGUUGCAUUGUCCAUGGCa2191842[hg19:12:69233489-69233513:+]0.77041220-16.74-0.2616
MIMAT0005908hsa-miR-12574193MDM2ccagUCUUGGGUAG-UAAGUGa | ||: | || |||||| ugagAAAAUGCCUCAAUUCACa21888109[hg19:12:69233717-69233738:+]0.52951216-11.79-0.1633
MIMAT0005908hsa-miR-12574193MDM2ccagUCUUGGGUAG-UAAGUGa | ||: | || |||||| ugagAAAAUGCCUCAAUUCACa2183253[hg19:12:69233717-69233738:+]0.52951216-11.79-0.1574
MIMAT0005908hsa-miR-12574193MDM2ccagUCUUGGGUAG-UAAGUGa | ||: | || |||||| ugagAAAAUGCCUCAAUUCACa218246267[hg19:12:69233717-69233738:+]0.52951216-11.79-0.1473
MIMAT0005910hsa-miR-12594193MDM2uuuUCGAUUCAGUAGUAUAUa | :|:| | |||||||| auuAUUUGAAU-AUCAUAUAu21943864405[hg19:12:69238015-69238034:+]0.51541527-9.75-0.1486
MIMAT0005910hsa-miR-12594193MDM2uuuUCGAUUCAGUAGUAUAUa | :|:| | |||||||| auuAUUUGAAU-AUCAUAUAu21943304349[hg19:12:69238015-69238034:+]0.51541527-9.75-0.1535
MIMAT0005910hsa-miR-12594193MDM2uuuUCGAUUCAGUAGUAUAUa | :|:| | |||||||| auuAUUUGAAU-AUCAUAUAu21945444563[hg19:12:69238015-69238034:+]0.51541527-9.75-0.1354
MIMAT0005912hsa-miR-548g4193MDM2caUGUUUUCAUUAA--UGU-CAAAa :|||| | :||| ||| |||| cuGCAAAUG-GAUUCAACAUGUUUa22142374260[hg19:12:69237866-69237889:+]0.52081210-7.08-0.1233
MIMAT0005912hsa-miR-548g4193MDM2caUGUUUUCAUUAA--UGU-CAAAa :|||| | :||| ||| |||| cuGCAAAUG-GAUUCAACAUGUUUa22141814204[hg19:12:69237866-69237889:+]0.52081210-7.08-0.1274
MIMAT0005912hsa-miR-548g4193MDM2caUGUUUUCAUUAA--UGU-CAAAa :|||| | :||| ||| |||| cuGCAAAUG-GAUUCAACAUGUUUa22143954418[hg19:12:69237866-69237889:+]0.52081210-7.08-0.1121
MIMAT0005917hsa-miR-548m4193MDM2guuUUUGGUGUUUAUG-GAAAc |||:: :|:|||| |||| uuuAAAUUUUAGAUACUCUUUu219969990[hg19:12:69234598-69234619:+]0.51391300-9.89-0.3306
MIMAT0005917hsa-miR-548m4193MDM2guuuuuGGUGUUUAUG-GAAAc ||| |||||| |||| cucucuCCA-AAAUACUCUUUc21613321352[hg19:12:69234961-69234981:+]0.51061250-10.12-0.1650
MIMAT0005917hsa-miR-548m4193MDM2guuUUUGGUGUUUAUG-GAAAc |||:: :|:|||| |||| uuuAAAUUUUAGAUACUCUUUu219913934[hg19:12:69234598-69234619:+]0.51391300-9.89-0.3411
MIMAT0005917hsa-miR-548m4193MDM2guuuuuGGUGUUUAUG-GAAAc ||| |||||| |||| cucucuCCA-AAAUACUCUUUc21612761296[hg19:12:69234961-69234981:+]0.51061250-10.12-0.1710
MIMAT0005917hsa-miR-548m4193MDM2guuUUUGGUGUUUAUG-GAAAc |||:: :|:|||| |||| uuuAAAUUUUAGAUACUCUUUu21911271148[hg19:12:69234598-69234619:+]0.51391300-9.89-0.3025
MIMAT0005917hsa-miR-548m4193MDM2guuuuuGGUGUUUAUG-GAAAc ||| |||||| |||| cucucuCCA-AAAUACUCUUUc21614901510[hg19:12:69234961-69234981:+]0.51061250-10.12-0.1489
MIMAT0005941hsa-miR-12844193MDM2cuUUUCG--GUCCCA-GACAUAUcu :|||| || | :|||||| gaGAAGCAACAACAUAUUGUAUAuu321296320[hg19:12:69210640-69210664:+]0.73051260-10.93-0.1314
MIMAT0005944hsa-miR-12524193MDM2auuUACUUAAGUUAAAGGAAGa ||| | ||| |||||||| auuAUGCA-UCAUUUUCCUUCa22019601980[hg19:12:69235589-69235609:+]0.53911657-13.17-0.2612
MIMAT0005944hsa-miR-12524193MDM2auuUACUUAAGUUAAAGGAAGa ||| | ||| |||||||| auuAUGCA-UCAUUUUCCUUCa22019041924[hg19:12:69235589-69235609:+]0.53911657-13.17-0.2690
MIMAT0005944hsa-miR-12524193MDM2auuUACUUAAGUUAAAGGAAGa ||| | ||| |||||||| auuAUGCA-UCAUUUUCCUUCa22021182138[hg19:12:69235589-69235609:+]0.53911657-13.17-0.2400
MIMAT0005788hsa-miR-513b4193MDM2uauuUACUG-UGGAGGA-ACACUu :|| | | ||:|| ||||| uggcGUGCCAAGCUUCUCUGUGAa219349372[hg19:12:69210693-69210716:+]0.72061210-16.53-0.5951
MIMAT0005953hsa-miR-13224193MDM2gucguagucguCGUAGUAg ||||||| ucagaaauuauGCAUCAUu2919541972[hg19:12:69235583-69235601:+]0.53911407-13.34-0.1170
MIMAT0005953hsa-miR-13224193MDM2gucguagucguCGUAGUAg ||||||| ucagaaauuauGCAUCAUu2918981916[hg19:12:69235583-69235601:+]0.53911407-13.34-0.1210
MIMAT0005953hsa-miR-13224193MDM2gucguagucguCGUAGUAg ||||||| ucagaaauuauGCAUCAUu2921122130[hg19:12:69235583-69235601:+]0.53911407-13.34-0.1064
MIMAT0006767hsa-miR-18274193MDM2uaAGUUAGAUGACGGAGu |:|:|:| ||||||| guUUAGUUUUCUGCCUCa21747204737[hg19:12:69238349-69238366:+]0.48461607-21.22-0.2422
MIMAT0006767hsa-miR-18274193MDM2uaAGUUAGAUGACGGAGu |:|:|:| ||||||| guUUAGUUUUCUGCCUCa21746644681[hg19:12:69238349-69238366:+]0.48461607-21.22-0.2496
MIMAT0006767hsa-miR-18274193MDM2uaAGUUAGAUGACGGAGu |:|:|:| ||||||| guUUAGUUUUCUGCCUCa21748784895[hg19:12:69238349-69238366:+]0.48461607-21.22-0.2222
MIMAT0007884hsa-miR-19104193MDM2uccgccgucCGUGUCCUGACc | |:||||||| guaagcuuaGAAUAGGACUGa21337813801[hg19:12:69237410-69237430:+]0.52111487-16.63-0.1730
MIMAT0007884hsa-miR-19104193MDM2uccgccgucCGUGUCCUGACc | |:||||||| guaagcuuaGAAUAGGACUGa21337253745[hg19:12:69237410-69237430:+]0.52111487-16.63-0.1786
MIMAT0007884hsa-miR-19104193MDM2uccgccgucCGUGUCCUGACc | |:||||||| guaagcuuaGAAUAGGACUGa21339393959[hg19:12:69237410-69237430:+]0.52111487-16.63-0.1579
MIMAT0009447hsa-miR-19724193MDM2acucggugacacggACCGGACu ||||||| aacaggacaucuuaUGGCCUGc294465[hg19:12:69233515-69233536:+]0.76601407-14.79-0.1553
MIMAT0009979hsa-miR-20544193MDM2uuaUUUAAUUUAAAUAUAA-UGUc || |:|| || |||| ||| gacAACCUGAAAUU-UAUUCACAu2215678[hg19:12:69233685-69233707:+]0.55291220-4.67-0.1735
MIMAT0009979hsa-miR-20544193MDM2uuAU-UUAAUUUAAAUAU-AAUGUc || || | | |||| ||||| ucUAUAACCAUUUCUAUAUUUACAu22225502574[hg19:12:69236179-69236203:+]0.51021200-2.37-0.1616
MIMAT0009979hsa-miR-20544193MDM2uuAU-UUAAUUUAAAUAU-AAUGUc || || | | |||| ||||| ucUAUAACCAUUUCUAUAUUUACAu22224942518[hg19:12:69236179-69236203:+]0.51021200-2.37-0.1669
MIMAT0009979hsa-miR-20544193MDM2uuaUUUAAUUUAAAUAUAA-UGUc || |:|| || |||| ||| gacAACCUGAAAUU-UAUUCACAu221214236[hg19:12:69233685-69233707:+]0.55291220-4.67-0.1576
MIMAT0009979hsa-miR-20544193MDM2uuAU-UUAAUUUAAAUAU-AAUGUc || || | | |||| ||||| ucUAUAACCAUUUCUAUAUUUACAu22227082732[hg19:12:69236179-69236203:+]0.51021200-2.37-0.1474
MIMAT0011160hsa-miR-21164193MDM2ucuggAGGAUACGAUUCUUGg ||| | |:||||||| cuggaUCCCAGGUUAAGAACu217177197[hg19:12:69208399-69208419:+]0.61131607-19.84-0.6031
MIMAT0013802hsa-miR-28614193MDM2ggcgggugGCGGUCCGGGg | :||||||| cuagauuaCAUCAGGCCCu21216821700[hg19:12:69235311-69235329:+]0.49151437-21.36-0.1115
MIMAT0013802hsa-miR-28614193MDM2ggcgggugGCGGUCCGGGg | :||||||| cuagauuaCAUCAGGCCCu21216261644[hg19:12:69235311-69235329:+]0.49151437-21.36-0.1153
MIMAT0013802hsa-miR-28614193MDM2ggcgggugGCGGUCCGGGg | :||||||| cuagauuaCAUCAGGCCCu21218401858[hg19:12:69235311-69235329:+]0.49151437-21.36-0.1014
MIMAT0014987hsa-miR-548s4193MDM2uuuuauugacgucAAAACCGGUa | ||||||| agguucuuuuuuaUCUUGGCCAg211246268[hg19:12:69208468-69208469,69210592-69210612:+]0.66101427-10.47-0.9960
MIMAT0014991hsa-miR-31284193MDM2uacucucAAAAAAU-GAA-CGGUCu ||||||| ||| ||||| gagguucUUUUUUAUCUUGGCCAGu217245269[hg19:12:69208467-69208469,69210592-69210613:+]0.66101350-18.36-1.2059
MIMAT0014992hsa-miR-31294193MDM2uuugguuagagaUGUGAUGACg | ||||||| aacuauggaauaAAACUACUGa21123122333[hg19:12:69235941-69235962:+]0.51021427-12.88-0.2400
MIMAT0014992hsa-miR-31294193MDM2uuugguuagagaUGUGAUGACg | ||||||| aacuauggaauaAAACUACUGa21122562277[hg19:12:69235941-69235962:+]0.51021427-12.88-0.2473
MIMAT0014992hsa-miR-31294193MDM2uuugguuagagaUGUGAUGACg | ||||||| aacuauggaauaAAACUACUGa21124702491[hg19:12:69235941-69235962:+]0.51021427-12.88-0.2202
MIMAT0014992hsa-miR-31294193MDM2uuUGGU--UAGAGAUGU-GAUGACg |||| || |||::| |||||| auACCAACAUGUCUGUACCUACUGa2211236[hg19:12:69202999-69203023:+]0.68341356-21.12-0.6549
MIMAT0014994hsa-miR-3130-3p4193MDM2aaugggUCAGA-GGCCACGUcg ||||| ::|||||| uauuaaAGUCUGUUGGUGCAca316114135[hg19:12:69207362-69207383:+]0.68491380-20.02-0.3714
MIMAT0014998hsa-miR-31334193MDM2uaACCCAAAAUUCUCAAGAAAu || || | || ||||||| ucUGAUUUCUUAG-GUUCUUUa22142774297[hg19:12:69237906-69237926:+]0.51221547-9.43-0.1341
MIMAT0014998hsa-miR-31334193MDM2uaACCCAAAAUUCUCAAGAAAu || || | || ||||||| ucUGAUUUCUUAG-GUUCUUUa22142214241[hg19:12:69237906-69237926:+]0.51221547-9.43-0.1386
MIMAT0014998hsa-miR-31334193MDM2uaACCCAAAAUUCUCAAGAAAu || || | || ||||||| ucUGAUUUCUUAG-GUUCUUUa22144354455[hg19:12:69237906-69237926:+]0.51221547-9.43-0.1220
MIMAT0014998hsa-miR-31334193MDM2uaACCCAAAAUUCUCAAGAAAu |||| ||: :||||||| ucUGGG--AUAGAGGUUCUUUu221236255[hg19:12:69208458-69208469,69210592-69210599:+]0.66101537-15.66-0.7309
MIMAT0015016hsa-miR-31454193MDM2guUAAGGUUUGUGAGUUUUAU-AGa :||:| | | ||||||| || uaGUUUCUCUCUC-CAAAAUACUCu22313261349[hg19:12:69234955-69234978:+]0.51061200-13.71-0.1040
MIMAT0015016hsa-miR-31454193MDM2guUAAGGUUUGUGAGUUUUAU-AGa :||:| | | ||||||| || uaGUUUCUCUCUC-CAAAAUACUCu22312701293[hg19:12:69234955-69234978:+]0.51061200-13.71-0.1080
MIMAT0015016hsa-miR-31454193MDM2guUAAGGUUUGUGAGUUUUA-UAGa ||| :| |: |: |||| ||| auAUUGUAUAUUGUUCAAAUGAUCu223309333[hg19:12:69210653-69210677:+]0.73051220-10.55-1.1129
MIMAT0015027hsa-miR-30744193MDM2gccacgGAUGACUCGACUAUAg || :| | ||||||| uguuaaCUCUUUA-CUGAUAUg21727172737[hg19:12:69236346-69236366:+]0.50601467-9.60-0.1027
MIMAT0015027hsa-miR-30744193MDM2gccacgGAUGACUCGACUAUAg || :| | ||||||| uguuaaCUCUUUA-CUGAUAUg21726612681[hg19:12:69236346-69236366:+]0.50601467-9.60-0.1063
MIMAT0015030hsa-miR-31564193MDM2acagagggugaagguCUAGAAa |||||| guauauuguucaaauGAUCUUc28314335[hg19:12:69210658-69210679:+]0.73051206-8.05-0.2212
MIMAT0015032hsa-miR-31584193MDM2caggacgUCUCUCCUUCGGGAa | :|| ||||||| uaaagaaAAGGAAUAAGCCCUg21685106[hg19:12:69233556-69233577:+]0.76171477-15.34-0.1438
MIMAT0015037hsa-miR-31634193MDM2caGAAUGA---CGGGAGUAAAAUAu |||| | | ::|:||||||| ucCUUAAUAAGGGUUUUAUUUUAUu22148974921[hg19:12:69238526-69238550:+]0.49631557-11.80-0.2668
MIMAT0015037hsa-miR-31634193MDM2caGAAUGACGGGAGUAAA-AUAu :| ||| :|:| |||| ||| gaUUAACU-UCUUGAUUUAUAUu22136503671[hg19:12:69237279-69237300:+]0.51791220-6.87-0.1302
MIMAT0015037hsa-miR-31634193MDM2caGAAUGA---CGGGAGUAAAAUAu |||| | | ::|:||||||| ucCUUAAUAAGGGUUUUAUUUUAUu22148414865[hg19:12:69238526-69238550:+]0.49631557-11.80-0.2747
MIMAT0015037hsa-miR-31634193MDM2caGAAUGACGGGAGUAAA-AUAu :| ||| :|:| |||| ||| gaUUAACU-UCUUGAUUUAUAUu22135943615[hg19:12:69237279-69237300:+]0.51791220-6.87-0.1346
MIMAT0015037hsa-miR-31634193MDM2caGAAUGA---CGGGAGUAAAAUAu |||| | | ::|:||||||| ucCUUAAUAAGGGUUUUAUUUUAUu22150555079[hg19:12:69238526-69238550:+]0.49631557-11.80-0.2452
MIMAT0015037hsa-miR-31634193MDM2caGAAUGACGGGAGUAAA-AUAu :| ||| :|:| |||| ||| gaUUAACU-UCUUGAUUUAUAUu22138083829[hg19:12:69237279-69237300:+]0.51791220-6.87-0.1185
MIMAT0001630hsa-miR-323b-5p4193MDM2acgCUUGAGUGGUGCCUGUUGGa |||:|:| ||||||| uagGAAUUUA-----GACAACCu2214663[hg19:12:69233675-69233692:+]0.55531427-16.39-0.2715
MIMAT0001630hsa-miR-323b-5p4193MDM2acgcuUGAGUGGUGC--CUGUUGGa :| || :|:| ||||||| gcccuGCCCAGUAUGUAGACAACCa219101125[hg19:12:69233572-69233596:+]0.76171497-16.42-0.6192
MIMAT0001630hsa-miR-323b-5p4193MDM2acgCUUGAGUGGUGCCUGUUGGa |||:|:| ||||||| uagGAAUUUA-----GACAACCu221204221[hg19:12:69233675-69233692:+]0.55531427-16.39-0.2461
MIMAT0015053hsa-miR-31764193MDM2ggccAUCAGGGUCCGGUCa | | :: ||||||| acuuUUGCUUAAGGCCAGu21618331851[hg19:12:69235462-69235480:+]0.53851437-16.50-0.1049
MIMAT0015053hsa-miR-31764193MDM2ggccAUCAGGGUCCGGUCa | | :: ||||||| acuuUUGCUUAAGGCCAGu21617771795[hg19:12:69235462-69235480:+]0.53851437-16.50-0.1085
MIMAT0015053hsa-miR-31764193MDM2ggccaucaggguCCGGUCa |||||| cuuuuuuaucuuGGCCAGu28251269[hg19:12:69210595-69210613:+]0.74051206-15.79-0.3181
MIMAT0015378hsa-miR-3065-3p4193MDM2gagguuguuauaggACCACGACu |||||||| ucuguaccuacugaUGGUGCUGu2102345[hg19:12:69203010-69203032:+]0.68341457-18.05-1.0635
MIMAT0015069hsa-miR-31874193MDM2ggcgcgucggggUACCGGUu ||||||| cugucucaauaaAUGGCCAa2938703889[hg19:12:69237499-69237518:+]0.50231407-16.80-0.1182
MIMAT0015069hsa-miR-31874193MDM2ggcgcgucggggUACCGGUu ||||||| cugucucaauaaAUGGCCAa2938143833[hg19:12:69237499-69237518:+]0.50231407-16.80-0.1222
MIMAT0015069hsa-miR-31874193MDM2ggcgcgucggggUACCGGUu ||||||| cugucucaauaaAUGGCCAa2940284047[hg19:12:69237499-69237518:+]0.50231407-16.80-0.1074
MIMAT0015069hsa-miR-31874193MDM2ggcgcgucgggguACCGGUu |||||| uucuuuuuuaucuUGGCCAg28249268[hg19:12:69210593-69210612:+]0.74051206-13.24-0.2674
MIMAT0015072hsa-miR-320e4193MDM2ggaAGAGUU--GGGUCGAAa || ||: :||||||| accUCACAGAUUCCAGCUUc2165069[hg19:12:69203037-69203056:+]0.68861467-17.86-0.7991
MIMAT0015081hsa-miR-548x4193MDM2acUUUCAUUAACGUCAAAAAu |||| ||| :||||||| ugAAAG--AUU-UAGUUUUUu220635652[hg19:12:69234264-69234281:+]0.50221547-10.51-0.1357
MIMAT0015081hsa-miR-548x4193MDM2acUUUCAUUAACG----UCAAAAAu || | ||||: ||||||| uuAAUGGCAUUGUGAAAAGUUUUUa22052835307[hg19:12:69238912-69238936:+]0.51571467-9.28-0.1433
MIMAT0015081hsa-miR-548x4193MDM2acUUUCAUUAACGUCAAAAAu |||| ||| :||||||| ugAAAG--AUU-UAGUUUUUu220579596[hg19:12:69234264-69234281:+]0.50221547-10.51-0.1408
MIMAT0015081hsa-miR-548x4193MDM2acUUUCAUUAACG----UCAAAAAu || | ||||: ||||||| uuAAUGGCAUUGUGAAAAGUUUUUa22052275251[hg19:12:69238912-69238936:+]0.51571467-9.28-0.1481
MIMAT0015081hsa-miR-548x4193MDM2acUUUCAUUAACGUCAAAAAu |||| ||| :||||||| ugAAAG--AUU-UAGUUUUUu220793810[hg19:12:69234264-69234281:+]0.50221547-10.51-0.1222
MIMAT0015081hsa-miR-548x4193MDM2acUUUCAUUAACG----UCAAAAAu || | ||||: ||||||| uuAAUGGCAUUGUGAAAAGUUUUUa22054415465[hg19:12:69238912-69238936:+]0.51571467-9.28-0.1306
MIMAT0015090hsa-miR-1273d4193MDM2ugacGUCGGAGUUG---GAGUACCCAAg ::| :||||| :|:||||||| caaaUGGAUUCAACAUGUUUAUGGGUUa22242404267[hg19:12:69237869-69237896:+]0.52081607-19.75-0.3784
MIMAT0015090hsa-miR-1273d4193MDM2ugacGUCGGAGUUG---GAGUACCCAAg ::| :||||| :|:||||||| caaaUGGAUUCAACAUGUUUAUGGGUUa22241844211[hg19:12:69237869-69237896:+]0.52081607-19.75-0.3886
MIMAT0015090hsa-miR-1273d4193MDM2ugacGUCGGAGUUG---GAGUACCCAAg ::| :||||| :|:||||||| caaaUGGAUUCAACAUGUUUAUGGGUUa22243984425[hg19:12:69237869-69237896:+]0.52081607-19.75-0.3508
MIMAT0016844hsa-miR-42954193MDM2uuccUUUUGUA-ACGUGAc |:||| | |||||| guuaAGAACUUCUGCACUa215188206[hg19:12:69208410-69208428:+]0.61221226-10.08-1.0347
MIMAT0016858hsa-miR-43064193MDM2augaCGGAAAGAGAGGu |::| ||||||| cuuaGUUUCUCUCUCCa21413241340[hg19:12:69234953-69234969:+]0.51061497-17.07-0.2040
MIMAT0016858hsa-miR-43064193MDM2augaCGGAAAGAGAGGu |::| ||||||| cuuaGUUUCUCUCUCCa21412681284[hg19:12:69234953-69234969:+]0.51061497-17.07-0.2112
MIMAT0016858hsa-miR-43064193MDM2augaCGGAAAGAGAGGu |::| ||||||| cuuaGUUUCUCUCUCCa21414821498[hg19:12:69234953-69234969:+]0.51061497-17.07-0.1847
MIMAT0016860hsa-miR-43074193MDM2ccuUUGUCCUUUUUUGUAa :| | | || ||||| gauGAGAAGCAACAACAUa217293311[hg19:12:69210637-69210655:+]0.74051200-6.12-0.1044
MIMAT0016863hsa-miR-43114193MDM2guGUGAGUCGAGAGAAAg :::|: | ||||||| acUGUUUUGAUCUCUUUu21730333050[hg19:12:69236662-69236679:+]0.50611487-9.01-0.1013
MIMAT0016863hsa-miR-43114193MDM2gugugagucGAGAGAAAg :||||||| auagauuucUUCUCUUUa210109126[hg19:12:69233738-69233755:+]0.51101417-10.80-0.2391
MIMAT0016863hsa-miR-43114193MDM2guGUGAGUCGAGAGAAAg :::|: | ||||||| acUGUUUUGAUCUCUUUu21729772994[hg19:12:69236662-69236679:+]0.50611487-9.01-0.1048
MIMAT0016863hsa-miR-43114193MDM2gugugagucGAGAGAAAg :||||||| auagauuucUUCUCUUUa2105370[hg19:12:69233738-69233755:+]0.51101417-10.80-0.2460
MIMAT0016863hsa-miR-43114193MDM2gugugagucGAGAGAAAg :||||||| auagauuucUUCUCUUUa210267284[hg19:12:69233738-69233755:+]0.51101417-10.80-0.2171
MIMAT0016887hsa-miR-43254193MDM2aguGACUCUGUUCACGUu :| | | ||||||| acuUUAAAAGAAGUGCAa21621822199[hg19:12:69235811-69235828:+]0.51111477-10.24-0.1160
MIMAT0016887hsa-miR-43254193MDM2aguGACUCUGUUCACGUu :| | | ||||||| acuUUAAAAGAAGUGCAa21621262143[hg19:12:69235811-69235828:+]0.51111477-10.24-0.1199
MIMAT0016887hsa-miR-43254193MDM2aguGACUCUGUUCACGUu :| | | ||||||| acuUUAAAAGAAGUGCAa21623402357[hg19:12:69235811-69235828:+]0.51111477-10.24-0.1054
MIMAT0016896hsa-miR-42684193MDM2gugUAGGACUCUCCUCCUCGg ||: | || ||| ||| acgAUUAUAUGAUGAGAAGCa219283303[hg19:12:69210627-69210647:+]0.74051220-10.90-0.1838
MIMAT0016900hsa-miR-42704193MDM2cggGAGGGGACUG-AGGGACu ||:|:: |:| |||||| ggaCUUCUUGGGCAUCCCUGg218160180[hg19:12:69207408-69207408,69208383-69208402:+]0.64811256-23.15-0.5003
MIMAT0016910hsa-miR-42784193MDM2guucccguuuGGGGGAUc ||||||| ucuguuguuuCCCCCUAa2917411758[hg19:12:69235370-69235387:+]0.51041407-13.36-0.2185
MIMAT0016910hsa-miR-42784193MDM2guucccguuuGGGGGAUc ||||||| ucuguuguuuCCCCCUAa2916851702[hg19:12:69235370-69235387:+]0.51041407-13.36-0.2253
MIMAT0016910hsa-miR-42784193MDM2guucccguuuGGGGGAUc ||||||| ucuguuguuuCCCCCUAa2918991916[hg19:12:69235370-69235387:+]0.51041407-13.36-0.2002
MIMAT0016912hsa-miR-42824193MDM2aggaCCUACGUUUAAAAu | || :||||||| auuaGUAUUUAAAUUUUa215962979[hg19:12:69234591-69234608:+]0.52581507-5.04-0.3560
MIMAT0016912hsa-miR-42824193MDM2agGACCUA-CGUUUAAAAu :| ||| :||||||| uaUUUGAUCUUAAAUUUUu21743484366[hg19:12:69237977-69237995:+]0.51381477-5.67-0.1906
MIMAT0016912hsa-miR-42824193MDM2aggaccuacgUUUAAAAu ||||||| auauaaaguaAAAUUUUc2928462863[hg19:12:69236475-69236492:+]0.50611407-2.08-0.1230
MIMAT0016912hsa-miR-42824193MDM2aggaCCUACGUUUAAAAu | || :||||||| auuaGUAUUUAAAUUUUa215906923[hg19:12:69234591-69234608:+]0.52581507-5.04-0.3670
MIMAT0016912hsa-miR-42824193MDM2agGACCUA-CGUUUAAAAu :| ||| :||||||| uaUUUGAUCUUAAAUUUUu21742924310[hg19:12:69237977-69237995:+]0.51381477-5.67-0.1967
MIMAT0016912hsa-miR-42824193MDM2aggaccuacgUUUAAAAu ||||||| auauaaaguaAAAUUUUc2927902807[hg19:12:69236475-69236492:+]0.50611407-2.08-0.1271
MIMAT0016912hsa-miR-42824193MDM2aggaCCUACGUUUAAAAu | || :||||||| auuaGUAUUUAAAUUUUa21511201137[hg19:12:69234591-69234608:+]0.52581507-5.04-0.3264
MIMAT0016912hsa-miR-42824193MDM2agGACCUA-CGUUUAAAAu :| ||| :||||||| uaUUUGAUCUUAAAUUUUu21745064524[hg19:12:69237977-69237995:+]0.51381477-5.67-0.1743
MIMAT0016912hsa-miR-42824193MDM2aggaccuacgUUUAAAAu ||||||| auauaaaguaAAAUUUUc2930043021[hg19:12:69236475-69236492:+]0.50611407-2.08-0.1118
MIMAT0000078hsa-miR-23a4193MDM2ccuuUAGGGACCG---UUACACUa ||| | || ||||||| gaguAUCGGUAGCAUAAAUGUGAu21841534176[hg19:12:69237782-69237805:+]0.50561447-12.96-0.1197
MIMAT0000078hsa-miR-23a4193MDM2ccuuUAGGGACCG---UUACACUa ||| | || ||||||| gaguAUCGGUAGCAUAAAUGUGAu21840974120[hg19:12:69237782-69237805:+]0.50561447-12.96-0.1238
MIMAT0000078hsa-miR-23a4193MDM2ccuuUAGGGACCG---UUACACUa ||| | || ||||||| gaguAUCGGUAGCAUAAAUGUGAu21843114334[hg19:12:69237782-69237805:+]0.50561447-12.96-0.1089
MIMAT0000081hsa-miR-254193MDM2agucuggcUCUGUUCACGUUAc | | ||||||||| aaacuuuaAAAGAAGUGCAAUu21521242145[hg19:12:69235809-69235830:+]0.51021547-10.55-0.1005
MIMAT0000081hsa-miR-254193MDM2agucuggcucUGUUCACGUUAc | | ||||||| --------gcAAAUGUGCAAUa213114[hg19:12:69202988-69203001:+]0.68341447-8.08-0.3926
MIMAT0000086hsa-miR-29a4193MDM2auuggcuAAAGUCUACCACGAu || :| ||||||| aaggcucUUAUAUUUGGUGCUa21613681389[hg19:12:69234997-69235018:+]0.50761477-13.92-0.4055
MIMAT0000086hsa-miR-29a4193MDM2auugGCUAAA-GUCUACC-ACGAu || ||| ::|:||| |||| guugCGCUUUAUGGGUGGAUGCUg21953085331[hg19:12:69238937-69238960:+]0.51301250-16.82-0.1210
MIMAT0000086hsa-miR-29a4193MDM2auuggcuAAAGUCUACCACGAu || :| ||||||| aaggcucUUAUAUUUGGUGCUa21613121333[hg19:12:69234997-69235018:+]0.50761477-13.92-0.4173
MIMAT0000086hsa-miR-29a4193MDM2auugGCUAAA-GUCUACC-ACGAu || ||| ::|:||| |||| guugCGCUUUAUGGGUGGAUGCUg21952525275[hg19:12:69238937-69238960:+]0.51301250-16.82-0.1251
MIMAT0000086hsa-miR-29a4193MDM2auuggcuAAAGUCUACCACGAu || :| ||||||| aaggcucUUAUAUUUGGUGCUa21615261547[hg19:12:69234997-69235018:+]0.50761477-13.92-0.3740
MIMAT0000086hsa-miR-29a4193MDM2auugGCUAAA-GUCUACC-ACGAu || ||| ::|:||| |||| guugCGCUUUAUGGGUGGAUGCUg21954665489[hg19:12:69238937-69238960:+]0.51301250-16.82-0.1101
MIMAT0000086hsa-miR-29a4193MDM2auuggcuaAAGUCUACCACGAu | | ||||||||| ucuguaccUACUGAUGGUGCUg2152344[hg19:12:69203010-69203031:+]0.68341547-19.91-0.8062
MIMAT0000086hsa-miR-29a4193MDM2auUGGCUAAAGUCUACCACGau |:: | || | |||||| uuAUUAAAGUCUGUUGGUGCac321113134[hg19:12:69207361-69207382:+]0.68491320-10.37-0.1986
MIMAT0000090hsa-miR-324193MDM2acguugaaucaUUACACGUUAu |||||||||| --------gcaAAUGUGCAAUa212114[hg19:12:69202988-69203001:+]0.68341557-14.09-0.3957
MIMAT0000092hsa-miR-92a4193MDM2uguccggcccUGUUCACGUUAu | ||||||||| aaacuuuaaaAGAAGUGCAAUu21321242145[hg19:12:69235809-69235830:+]0.51021527-11.45-0.1026
MIMAT0000092hsa-miR-92a4193MDM2uguccggcCCUGUUCACGUUAu | | | ||||||| --------GCAAAUGUGCAAUa215114[hg19:12:69202988-69203001:+]0.68341467-10.58-0.3987
MIMAT0000095hsa-miR-964193MDM2ucgUUUUUACACGA---UCACGGUUu ::|:|| ||:| ||||||| cuaGGAGAUUUGUUUGGCGUGCCAAg221335360[hg19:12:69210679-69210704:+]0.72061517-16.91-0.3872
MIMAT0000095hsa-miR-964193MDM2ucguUUUUACACGAUCACG-GUUu |||:| ||:|:|||| ||| uauuAAAGUCUGUUGGUGCACAAa220114137[hg19:12:69207362-69207385:+]0.68491390-18.71-1.1081
MIMAT0000100hsa-miR-29b4193MDM2uugugacuAAAGUUUACCACGAu || :| ||||||| aaaggcucUUAUAUUUGGUGCUa21613671389[hg19:12:69234996-69235018:+]0.50761477-14.70-0.4055
MIMAT0000100hsa-miR-29b4193MDM2uugugacuAAAGUUUACCACGAu || :| ||||||| aaaggcucUUAUAUUUGGUGCUa21613111333[hg19:12:69234996-69235018:+]0.50761477-14.70-0.4173
MIMAT0000100hsa-miR-29b4193MDM2uugugacuAAAGUUUACCACGAu || :| ||||||| aaaggcucUUAUAUUUGGUGCUa21615251547[hg19:12:69234996-69235018:+]0.50761477-14.70-0.3740
MIMAT0000100hsa-miR-29b4193MDM2uugugacuaAAGUUUACCACGAu | | :|||||||| gucuguaccUACUGAUGGUGCUg2152244[hg19:12:69203009-69203031:+]0.68341507-17.74-0.8062
MIMAT0000100hsa-miR-29b4193MDM2uuGUGACUAAAGUUUACCACGau :|:| | || : |||||| guUAUUAAAGUCUGUUGGUGCac322112134[hg19:12:69207360-69207382:+]0.68491330-10.76-0.1986
MIMAT0000256hsa-miR-181a4193MDM2ugaguggcuguCGCAACUUACAa |: |||||||| cuauaguuaauGUAUUGAAUGUu21334203442[hg19:12:69237105-69237127:+]0.51131487-10.41-0.1007
MIMAT0000257hsa-miR-181b4193MDM2ugGGUGGCUGU--CGUUACUUACAa |:|: | :| |:| ||||||| gaCUAUAGUUAAUGUAUUGAAUGUu22234183442[hg19:12:69237103-69237127:+]0.51131527-12.73-0.1007
MIMAT0000258hsa-miR-181c4193MDM2ugAGUGGCUGUCCAACUU-ACAa || || |:| | |||| ||| uuUCUCCCAUAUG-UGAAUUGUa22137243745[hg19:12:69237353-69237374:+]0.52111220-10.81-0.2260
MIMAT0000258hsa-miR-181c4193MDM2ugAGUGGCUGUCCAACUUACAa | ::: |:: |||||||| uaUAGUUAAUGUAUUGAAUGUu22134213442[hg19:12:69237106-69237127:+]0.51131487-9.17-0.1017
MIMAT0000258hsa-miR-181c4193MDM2ugAGUGGCUGUCCAACUU-ACAa || || |:| | |||| ||| uuUCUCCCAUAUG-UGAAUUGUa22136683689[hg19:12:69237353-69237374:+]0.52111220-10.81-0.2330
MIMAT0000258hsa-miR-181c4193MDM2ugAGUGGCUGUCCAACUU-ACAa || || |:| | |||| ||| uuUCUCCCAUAUG-UGAAUUGUa22138823903[hg19:12:69237353-69237374:+]0.52111220-10.81-0.2071
MIMAT0000262hsa-miR-1874193MDM2ggcCGACGUUGUGUUCUGUGcu | |||| | ||||||| guuGGUGCACAAAAAGACACuu320125146[hg19:12:69207373-69207394:+]0.68491430-18.40-0.1815
MIMAT0000278hsa-miR-2214193MDM2cuUUGGG-UCGUCUGUUACAUCGa ||::: | : || ||||||| auAAUUUGACUUGAAUAUGUAGCu222170193[hg19:12:69233799-69233822:+]0.46901487-13.35-0.1003
MIMAT0000278hsa-miR-2214193MDM2cuUUGGG-UCGUCUGUUACAUCGa ||::: | : || ||||||| auAAUUUGACUUGAAUAUGUAGCu222114137[hg19:12:69233799-69233822:+]0.46901487-13.35-0.1042
MIMAT0000279hsa-miR-2224193MDM2ugggucaucggUCUACAUCGa | ||||||| auuugacuugaAUAUGUAGCu211117137[hg19:12:69233802-69233822:+]0.46901427-9.94-0.1031
MIMAT0000280hsa-miR-2234193MDM2accCCAUA--AACUGU-UUGACUGu ||| | ||| | ||||||| uaaGGUUUGCCUGAAAUAACUGACa22030873111[hg19:12:69236716-69236740:+]0.50611497-16.94-0.2969
MIMAT0000280hsa-miR-2234193MDM2accCCAUA--AACUGU-UUGACUGu ||| | ||| | ||||||| uaaGGUUUGCCUGAAAUAACUGACa22030313055[hg19:12:69236716-69236740:+]0.50611497-16.94-0.3055
MIMAT0000280hsa-miR-2234193MDM2accCCAUA--AACUGU-UUGACUGu ||| | ||| | ||||||| uaaGGUUUGCCUGAAAUAACUGACa22032453269[hg19:12:69236716-69236740:+]0.50611497-16.94-0.2735
MIMAT0000318hsa-miR-200b4193MDM2aguAGUAAUGG--UCCGUCAUAau |: |||:| :| |||||| ucuUUUUUAUCUUGGCCAGUAUau320250273[hg19:12:69210594-69210617:+]0.74051340-11.58-0.1353
MIMAT0000418hsa-miR-23b4193MDM2ccauUAGGGACCG---UUACACUa ||| | || ||||||| gaguAUCGGUAGCAUAAAUGUGAu21841534176[hg19:12:69237782-69237805:+]0.50561447-12.81-0.1197
MIMAT0000418hsa-miR-23b4193MDM2ccauUAGGGACCG---UUACACUa ||| | || ||||||| gaguAUCGGUAGCAUAAAUGUGAu21840974120[hg19:12:69237782-69237805:+]0.50561447-12.81-0.1238
MIMAT0000418hsa-miR-23b4193MDM2ccauUAGGGACCG---UUACACUa ||| | || ||||||| gaguAUCGGUAGCAUAAAUGUGAu21843114334[hg19:12:69237782-69237805:+]0.50561447-12.81-0.1089
MIMAT0000428hsa-miR-135a4193MDM2aguGUAUCCUUAU-UUUUCGGUAu | |:| | | |||||||| gacCCUGGUUAGACCAAAGCCAUu22179102[hg19:12:69203066-69203072,69207334-69207350:+]0.68941477-11.87-0.8578
MIMAT0000431hsa-miR-140-5p4193MDM2gaugguaucccaUUUUGGUGAc ||||||||| uuaauugcacacAAAACCACUu21133093330[hg19:12:69236938-69236959:+]0.50891507-12.26-0.1286
MIMAT0000431hsa-miR-140-5p4193MDM2gaugguaucccaUUUUGGUGAc ||||||||| uuaauugcacacAAAACCACUu21132533274[hg19:12:69236938-69236959:+]0.50891507-12.26-0.1329
MIMAT0000431hsa-miR-140-5p4193MDM2gaugguaucccaUUUUGGUGAc ||||||||| uuaauugcacacAAAACCACUu21134673488[hg19:12:69236938-69236959:+]0.50891507-12.26-0.1170
MIMAT0000432hsa-miR-1414193MDM2gguAGAAAUGGUCUGU-CACAAu ||||||: : ||| ||||| gguUCUUUAUAGUACACGUGUUg22042894311[hg19:12:69237918-69237940:+]0.51221350-16.05-0.1846
MIMAT0000432hsa-miR-1414193MDM2gguAGAAAUGGUCUGU-CACAAu ||||||: : ||| ||||| gguUCUUUAUAGUACACGUGUUg22042334255[hg19:12:69237918-69237940:+]0.51221350-16.05-0.1905
MIMAT0000432hsa-miR-1414193MDM2gguAGAAAUGGUCUGU-CACAAu ||||||: : ||| ||||| gguUCUUUAUAGUACACGUGUUg22044474469[hg19:12:69237918-69237940:+]0.51221350-16.05-0.1687
MIMAT0000437hsa-miR-1454193MDM2ucccuaaggacccuuUUGACCUg ||||||| uguuauuuaaaaacuAACUGGAa2919051927[hg19:12:69235534-69235556:+]0.52331407-11.42-0.3741
MIMAT0000437hsa-miR-1454193MDM2ucccuaaggacccuuUUGACCUg ||||||| uguuauuuaaaaacuAACUGGAa2918491871[hg19:12:69235534-69235556:+]0.52331407-11.42-0.3841
MIMAT0000437hsa-miR-1454193MDM2ucccuaaggacccuuUUGACCUg ||||||| uguuauuuaaaaacuAACUGGAa2920632085[hg19:12:69235534-69235556:+]0.52331407-11.42-0.3466
MIMAT0000441hsa-miR-94193MDM2aguaugucGAUCUAU-UGGUUUCu ||:| || ||||||| aagagaccCUGGUUAGACCAAAGc2167598[hg19:12:69203062-69203072,69207334-69207346:+]0.68941547-14.04-0.4611
MIMAT0000455hsa-miR-1854193MDM2aguccuugaCGGAAAGAGAGGu |::| ||||||| ugauccuuaGUUUCUCUCUCCa21413191340[hg19:12:69234948-69234969:+]0.51061497-17.07-0.2059
MIMAT0000455hsa-miR-1854193MDM2aguccuugaCGGAAAGAGAGGu |::| ||||||| ugauccuuaGUUUCUCUCUCCa21412631284[hg19:12:69234948-69234969:+]0.51061497-17.07-0.2132
MIMAT0000455hsa-miR-1854193MDM2aguccuugaCGGAAAGAGAGGu |::| ||||||| ugauccuuaGUUUCUCUCUCCa21414771498[hg19:12:69234948-69234969:+]0.51061497-17.07-0.1865
MIMAT0000458hsa-miR-1904193MDM2uggAUUAUAUAGU--UUGUAUAGu |:| | | || |||||||: ugaUGAGA-AGCAACAACAUAUUg220292314[hg19:12:69210636-69210658:+]0.74051320-6.04-0.2607
MIMAT0000459hsa-miR-193a-3p4193MDM2ugaccCUG-AAAC--A-UCCGGUCAa ||| |||| | |||||||| uuucaGACUUUUGCUUAAGGCCAGUu21818271852[hg19:12:69235456-69235481:+]0.53481547-20.98-0.1234
MIMAT0000459hsa-miR-193a-3p4193MDM2ugaccCUG-AAAC--A-UCCGGUCAa ||| |||| | |||||||| uuucaGACUUUUGCUUAAGGCCAGUu21817711796[hg19:12:69235456-69235481:+]0.53481547-20.98-0.1276
MIMAT0000459hsa-miR-193a-3p4193MDM2ugaccCUG-AAAC--A-UCCGGUCAa ||| |||| | |||||||| uuucaGACUUUUGCUUAAGGCCAGUu21819852010[hg19:12:69235456-69235481:+]0.53481547-20.98-0.1122
MIMAT0000459hsa-miR-193a-3p4193MDM2ugacccuGAAACAUCCGGUCAa :| | | ||||||| uucuuuuUUAUCUUGGCCAGUa216249270[hg19:12:69210593-69210614:+]0.74051477-12.32-1.3380
MIMAT0000460hsa-miR-1944193MDM2agGUGUACCUCAACGACA-AUGu ||: | | ||||||| ||| auCAUCUACA-UUGCUGUCUACa22126612682[hg19:12:69236290-69236311:+]0.50821220-17.70-0.1365
MIMAT0000460hsa-miR-1944193MDM2agGUGUACCUCAACGACA-AUGu ||: | | ||||||| ||| auCAUCUACA-UUGCUGUCUACa22126052626[hg19:12:69236290-69236311:+]0.50821220-17.70-0.1411
MIMAT0000460hsa-miR-1944193MDM2agGUGUACCUCAACGACA-AUGu ||: | | ||||||| ||| auCAUCUACA-UUGCUGUCUACa22128192840[hg19:12:69236290-69236311:+]0.50821220-17.70-0.1243
MIMAT0000617hsa-miR-200c4193MDM2agGUAGUAAU-GGGCC-GUCAUAau | |: ||| |::|| |||||| uuCUUUUUUAUCUUGGCCAGUAUau322249273[hg19:12:69210593-69210617:+]0.74051390-13.84-0.1353
MIMAT0000681hsa-miR-29c4193MDM2auuggcuAAAGUUUACCACGAu || :| ||||||| aaggcucUUAUAUUUGGUGCUa21613681389[hg19:12:69234997-69235018:+]0.50761477-13.90-0.4055
MIMAT0000681hsa-miR-29c4193MDM2auugGCUAAA-GUUUACC-ACGAu || ||| ::::||| |||| guugCGCUUUAUGGGUGGAUGCUg21953085331[hg19:12:69238937-69238960:+]0.51301210-14.61-0.1210
MIMAT0000681hsa-miR-29c4193MDM2auuggcuAAAGUUUACCACGAu || :| ||||||| aaggcucUUAUAUUUGGUGCUa21613121333[hg19:12:69234997-69235018:+]0.50761477-13.90-0.4173
MIMAT0000681hsa-miR-29c4193MDM2auugGCUAAA-GUUUACC-ACGAu || ||| ::::||| |||| guugCGCUUUAUGGGUGGAUGCUg21952525275[hg19:12:69238937-69238960:+]0.51301210-14.61-0.1251
MIMAT0000681hsa-miR-29c4193MDM2auuggcuAAAGUUUACCACGAu || :| ||||||| aaggcucUUAUAUUUGGUGCUa21615261547[hg19:12:69234997-69235018:+]0.50761477-13.90-0.3740
MIMAT0000681hsa-miR-29c4193MDM2auugGCUAAA-GUUUACC-ACGAu || ||| ::::||| |||| guugCGCUUUAUGGGUGGAUGCUg21954665489[hg19:12:69238937-69238960:+]0.51301210-14.61-0.1101
MIMAT0000681hsa-miR-29c4193MDM2auuggcuaAAGUUUACCACGAu | | :|||||||| ucuguaccUACUGAUGGUGCUg2152344[hg19:12:69203010-69203031:+]0.68341507-17.09-0.8062
MIMAT0000681hsa-miR-29c4193MDM2auUGGCUAAAGUUUACCACGau |:: | || : |||||| uuAUUAAAGUCUGUUGGUGCac321113134[hg19:12:69207361-69207382:+]0.68491280-9.65-0.1986
MIMAT0000682hsa-miR-200a4193MDM2uguAGCAAUGGUCUGU-CACAAu || |||: : ||| ||||| gguUCUUUAUAGUACACGUGUUg22042894311[hg19:12:69237918-69237940:+]0.51221270-11.93-0.1863
MIMAT0000682hsa-miR-200a4193MDM2uguAGCAAUGGUCUGU-CACAAu || |||: : ||| ||||| gguUCUUUAUAGUACACGUGUUg22042334255[hg19:12:69237918-69237940:+]0.51221270-11.93-0.1923
MIMAT0000682hsa-miR-200a4193MDM2uguAGCAAUGGUCUGU-CACAAu || |||: : ||| ||||| gguUCUUUAUAGUACACGUGUUg22044474469[hg19:12:69237918-69237940:+]0.51221270-11.93-0.1703
MIMAT0000684hsa-miR-302a4193MDM2aguggUUUUGU--ACCUUC-GUGAAu |||||| | ||| ||||| guugaAAAACAACUCUAAGACACUUu21917591784[hg19:12:69235388-69235413:+]0.51631250-10.00-0.1083
MIMAT0000684hsa-miR-302a4193MDM2aguggUUUUGU--ACCUUC-GUGAAu |||||| | ||| ||||| guugaAAAACAACUCUAAGACACUUu21917031728[hg19:12:69235388-69235413:+]0.51631250-10.00-0.1120
MIMAT0000707hsa-miR-3634193MDM2augucuaccuauggCACGUUAa ||||||| aaacuuuaaaagaaGUGCAAUu2921242145[hg19:12:69235809-69235830:+]0.51021407-9.16-0.1005
MIMAT0000707hsa-miR-3634193MDM2augucuaccuaUGGCACGUUAa | :||||||| --------gcaAAUGUGCAAUa212114[hg19:12:69202988-69203001:+]0.68341437-9.71-0.3957
MIMAT0000715hsa-miR-302b4193MDM2gaugaUUUUGU--ACCUUC-GUGAAu |||||| | ||| ||||| guugaAAAACAACUCUAAGACACUUu21917591784[hg19:12:69235388-69235413:+]0.51631250-10.38-0.1083
MIMAT0000715hsa-miR-302b4193MDM2gaugaUUUUGU--ACCUUC-GUGAAu |||||| | ||| ||||| guugaAAAACAACUCUAAGACACUUu21917031728[hg19:12:69235388-69235413:+]0.51631250-10.38-0.1120
MIMAT0000717hsa-miR-302c4193MDM2ggugacUUUGU--ACCUUC-GUGAAu ||||| | ||| ||||| guugaaAAACAACUCUAAGACACUUu21817591784[hg19:12:69235388-69235413:+]0.51631200-10.94-0.1083
MIMAT0000717hsa-miR-302c4193MDM2ggugacUUUGU--ACCUUC-GUGAAu ||||| | ||| ||||| guugaaAAACAACUCUAAGACACUUu21817031728[hg19:12:69235388-69235413:+]0.51631200-10.94-0.1120
MIMAT0000718hsa-miR-302d4193MDM2ugugagUUUGU--ACCUUC-GUGAAu ||||| | ||| ||||| guugaaAAACAACUCUAAGACACUUu21817591784[hg19:12:69235388-69235413:+]0.51631200-9.15-0.1083
MIMAT0000718hsa-miR-302d4193MDM2ugugagUUUGU--ACCUUC-GUGAAu ||||| | ||| ||||| guugaaAAACAACUCUAAGACACUUu21817031728[hg19:12:69235388-69235413:+]0.51631200-9.15-0.1120
MIMAT0000719hsa-miR-3674193MDM2agUGGUAACGAUUUCACGUUAa ||: | :||||||||| aaACUUUAAAAGAAGUGCAAUu22121242145[hg19:12:69235809-69235830:+]0.51021527-13.43-0.1016
MIMAT0000719hsa-miR-3674193MDM2agugguaaCGAUUUCACGUUAa || || ||||||| --------GCAAAUGUGCAAUa215114[hg19:12:69202988-69203001:+]0.68341547-9.05-0.4018
MIMAT0000726hsa-miR-3734193MDM2ugugggguUUUAGCUUC-GUGAAg || || ||| ||||| ugaaaaacAACUCUAAGACACUUu21617611784[hg19:12:69235390-69235413:+]0.51631230-12.91-0.1094
MIMAT0000726hsa-miR-3734193MDM2ugugggguUUUAGCUUC-GUGAAg || || ||| ||||| ugaaaaacAACUCUAAGACACUUu21617051728[hg19:12:69235390-69235413:+]0.51631230-12.91-0.1131
MIMAT0000727hsa-miR-374a4193MDM2guGAAUAGUCCAACAUAAUAUu |||: | | | ||||||: auCUUGGCCAG-UAUAUUAUGa221258278[hg19:12:69210602-69210622:+]0.74051340-10.06-0.3030
MIMAT0000727hsa-miR-374a4193MDM2gugaauaguccaacaUAAUAUu |||||| uauuaugacuaaacgAUUAUAu28271292[hg19:12:69210615-69210636:+]0.74051206-2.61-0.1449
MIMAT0000729hsa-miR-376a4193MDM2ugcaccuaaaaggaGAUACUa |||||| aaaagacacuuauaCUAUGAa28136156[hg19:12:69207384-69207404:+]0.68491206-7.87-0.1857
MIMAT0000730hsa-miR-3774193MDM2uguUUUCAACGGAAACACACUa |||| | ||||||| uauAAAG-AGAAAAUGUGUGAa220618638[hg19:12:69234247-69234267:+]0.50221417-10.46-0.3624
MIMAT0000730hsa-miR-3774193MDM2uguUUUCAACGGAAACACACUa |||| | ||||||| uauAAAG-AGAAAAUGUGUGAa220562582[hg19:12:69234247-69234267:+]0.50221417-10.46-0.3734
MIMAT0000730hsa-miR-3774193MDM2uguUUUCAACGGAAACACACUa |||| | ||||||| uauAAAG-AGAAAAUGUGUGAa220776796[hg19:12:69234247-69234267:+]0.50221417-10.46-0.3324
MIMAT0000733hsa-miR-3794193MDM2ggAUGCAAG-GUAUCAGAUGGu |::| || :|| ||||||| uuUGUGAUCAUAUUGUCUACCa22054005421[hg19:12:69239029-69239050:+]0.51771587-19.30-0.3191
MIMAT0000733hsa-miR-3794193MDM2ggAUGCAAG-GUAUCAGAUGGu |::| || :|| ||||||| uuUGUGAUCAUAUUGUCUACCa22053445365[hg19:12:69239029-69239050:+]0.51771587-19.30-0.3281
MIMAT0000733hsa-miR-3794193MDM2ggAUGCAAG-GUAUCAGAUGGu |::| || :|| ||||||| uuUGUGAUCAUAUUGUCUACCa22055585579[hg19:12:69239029-69239050:+]0.51771587-19.30-0.2944
MIMAT0000736hsa-miR-3814193MDM2ugucucucgaacgggAACAUAu |||||| agaagcaacaacauaUUGUAUa28297318[hg19:12:69210641-69210662:+]0.74051206-9.74-0.4506
MIMAT0000738hsa-miR-3834193MDM2ucGGUGUUAGUGGAAGACUAGa :| :|| ||||||||||| acUCUUAA--ACCUUCUGAUCc22113051324[hg19:12:69234934-69234953:+]0.53651617-19.64-0.1209
MIMAT0000738hsa-miR-3834193MDM2ucGGUGUUAGUGGAAGACUAGa :| :|| ||||||||||| acUCUUAA--ACCUUCUGAUCc22112491268[hg19:12:69234934-69234953:+]0.53651617-19.64-0.1255
MIMAT0000738hsa-miR-3834193MDM2ucGGUGUUAGUGGAAGACUAGa :| :|| ||||||||||| acUCUUAA--ACCUUCUGAUCc22114631482[hg19:12:69234934-69234953:+]0.53651617-19.64-0.1088
MIMAT0000758hsa-miR-135b4193MDM2aguguauccuuacuUUUCGGUAu |||||||| acccugguuagaccAAAGCCAUu21080102[hg19:12:69203067-69203072,69207334-69207350:+]0.68941457-11.56-0.8578
MIMAT0000763hsa-miR-338-3p4193MDM2guUGUUUUAG-UGACUACGACCu |::||: | | | ||||||| uaAUGAAGCCUAGUUAUGCUGGa22130113033[hg19:12:69236640-69236662:+]0.50611557-15.32-0.1381
MIMAT0000763hsa-miR-338-3p4193MDM2guUGUUUUAG-UGACUACGACCu |::||: | | | ||||||| uaAUGAAGCCUAGUUAUGCUGGa22129552977[hg19:12:69236640-69236662:+]0.50611557-15.32-0.1427
MIMAT0000763hsa-miR-338-3p4193MDM2guUGUUUUAG-UGACUACGACCu |::||: | | | ||||||| uaAUGAAGCCUAGUUAUGCUGGa22131693191[hg19:12:69236640-69236662:+]0.50611557-15.32-0.1257
MIMAT0001075hsa-miR-3844193MDM2auacUUGUUAAA----GAUCCUUa ||| || | ||||||| uucuAACUAUAUAACCCUAGGAAu2172952[hg19:12:69233658-69233681:+]0.55951437-10.77-0.1051
MIMAT0001075hsa-miR-3844193MDM2auaCUUGUUAAAGAUC--CUUa |||:|| |||||| ||| aagGAAUAAGUUCUAGCUGAAg21833553376[hg19:12:69236984-69237005:+]0.50751210-12.26-0.1146
MIMAT0001075hsa-miR-3844193MDM2auaCUUGUUAAAGAUC--CUUa |||:|| |||||| ||| aagGAAUAAGUUCUAGCUGAAg21832993320[hg19:12:69236984-69237005:+]0.50751210-12.26-0.1185
MIMAT0001075hsa-miR-3844193MDM2auaCUUGUUAAAGAUC--CUUa |||:|| |||||| ||| aagGAAUAAGUUCUAGCUGAAg21835133534[hg19:12:69236984-69237005:+]0.50751210-12.26-0.1042
MIMAT0001075hsa-miR-3844193MDM2auacUUGUUA-AAGAUCCUUa ||::|| ||||||||: uucaAAUGAUCUUCUAGGAGa217322342[hg19:12:69210666-69210686:+]0.72061470-14.25-0.2196
MIMAT0001536hsa-miR-4294193MDM2ugccAAAAUGG--UCUGUCAUAau |||||:| :| |||||| ucuuUUUUAUCUUGGCCAGUAUau319250273[hg19:12:69210594-69210617:+]0.74051410-10.85-0.1353
MIMAT0001627hsa-miR-4334193MDM2uguGGCUCCUCGGGUAGUACUa ::|: ||: :||:|||| aucUUGGCCAGUAUAUUAUGAc220258279[hg19:12:69210602-69210623:+]0.74051350-11.33-0.1117
MIMAT0002171hsa-miR-4104193MDM2uguccgguagacacAAUAUAa |||||| uuaugacuaaacgaUUAUAUg28273293[hg19:12:69210617-69210637:+]0.74051206-3.87-0.1648
MIMAT0002172hsa-miR-376b4193MDM2uuguaccuaaaaggaGAUACUa |||||| aaaaagacacuuauaCUAUGAa28135156[hg19:12:69207383-69207404:+]0.68491206-9.11-0.1857
MIMAT0002177hsa-miR-486-5p4193MDM2gagCCCCGUCGAGUCAUGUCcu | | :| | ||||||| cuaGAGAUACAUGAGUACAGua320204225[hg19:12:69208426-69208447:+]0.61301310-9.57-0.1138
MIMAT0002806hsa-miR-490-3p4193MDM2gucGUACCUCAGGAGGUCCAAc | |||| || ||||||| aucCCUGGA-UC--CCAGGUUa220173191[hg19:12:69208395-69208413:+]0.61131507-15.94-0.4004
MIMAT0002817hsa-miR-4954193MDM2uucuuCACGUGGUACAAACAAa || :::: |||||||| uuuuuGUUUGUU-UGUUUGUUu218656676[hg19:12:69234285-69234305:+]0.49921477-9.95-0.1806
MIMAT0002817hsa-miR-4954193MDM2uucuuCACGUGGUACAAACAAa || :::: |||||||| uuuuuGUUUGUU-UGUUUGUUu218600620[hg19:12:69234285-69234305:+]0.49921477-9.95-0.1871
MIMAT0002817hsa-miR-4954193MDM2uucuuCACGUGGUACAAACAAa || :::: |||||||| uuuuuGUUUGUU-UGUUUGUUu218814834[hg19:12:69234285-69234305:+]0.49921477-9.95-0.1632
MIMAT0002818hsa-miR-4964193MDM2cucuaaccgguacaUUAUGAGu ||||||| guuucucucuccaaAAUACUCu2913281349[hg19:12:69234957-69234978:+]0.51061407-10.01-0.1283
MIMAT0002818hsa-miR-4964193MDM2cucuaaccgguacaUUAUGAGu ||||||| guuucucucuccaaAAUACUCu2912721293[hg19:12:69234957-69234978:+]0.51061407-10.01-0.1332
MIMAT0002818hsa-miR-4964193MDM2cucuaaccgguacaUUAUGAGu ||||||| guuucucucuccaaAAUACUCu2914861507[hg19:12:69234957-69234978:+]0.51061407-10.01-0.1155
MIMAT0002819hsa-miR-193b4193MDM2ucgccCUG-AAAC---UCCCGGUCAa ||| |||| | ||||||| uuucaGACUUUUGCUUAAGGCCAGUu21818271852[hg19:12:69235456-69235481:+]0.53481517-18.68-0.1234
MIMAT0002819hsa-miR-193b4193MDM2ucgccCUG-AAAC---UCCCGGUCAa ||| |||| | ||||||| uuucaGACUUUUGCUUAAGGCCAGUu21817711796[hg19:12:69235456-69235481:+]0.53481517-18.68-0.1276
MIMAT0002819hsa-miR-193b4193MDM2ucgccCUG-AAAC---UCCCGGUCAa ||| |||| | ||||||| uuucaGACUUUUGCUUAAGGCCAGUu21819852010[hg19:12:69235456-69235481:+]0.53481517-18.68-0.1122
MIMAT0002819hsa-miR-193b4193MDM2ucgcccugaaacucCCGGUCAa ||||||| uucuuuuuuaucuuGGCCAGUa29249270[hg19:12:69210593-69210614:+]0.74051407-12.04-1.3380
MIMAT0002821hsa-miR-181d4193MDM2ugGGUGGCUGUU--GUUACUUACAa |:|: | :|| :| ||||||| gaCUAUAGUUAAUGUAUUGAAUGUu22234183442[hg19:12:69237103-69237127:+]0.51131527-12.61-0.1017
MIMAT0002875hsa-miR-5044193MDM2cuaucucaCGUCUGGUCCCAGa | | : ||||||| uccuucaaGAAUGACAGGGUCa21519741995[hg19:12:69235603-69235624:+]0.52781427-16.60-0.1086
MIMAT0002875hsa-miR-5044193MDM2cuaucucaCGUCUGGUCCCAGa | | : ||||||| uccuucaaGAAUGACAGGGUCa21519181939[hg19:12:69235603-69235624:+]0.52781427-16.60-0.1123
MIMAT0003218hsa-miR-92b4193MDM2ccuccggcccugcUCACGUUAu |||||||| aaacuuuaaaagaAGUGCAAUu21021242145[hg19:12:69235809-69235830:+]0.51021457-10.03-0.1026
MIMAT0003218hsa-miR-92b4193MDM2ccuccggcccugcuCACGUUAu ||||||| --------gcaaauGUGCAAUa29114[hg19:12:69202988-69203001:+]0.68341407-9.33-0.3987
MIMAT0004801hsa-miR-590-3p4193MDM2ugAUCGAAUAUGUAUUUUAAu || :| | |: ||||||| ugUAUUUAACAUUUAAAAUUu22036033623[hg19:12:69237232-69237252:+]0.50971557-4.61-0.2314
MIMAT0004801hsa-miR-590-3p4193MDM2ugAUCGAAUAUGUAUUUUAAu || :| | |: ||||||| ugUAUUUAACAUUUAAAAUUu22035473567[hg19:12:69237232-69237252:+]0.50971557-4.61-0.2385
MIMAT0004801hsa-miR-590-3p4193MDM2ugAUCGAAUAUGUAUUUUAAu || :| | |: ||||||| ugUAUUUAACAUUUAAAAUUu22037613781[hg19:12:69237232-69237252:+]0.50971557-4.61-0.2122
MIMAT0003879hsa-miR-7584193MDM2ccaaucaccuggUCCAGUGUUu | ||||||| guauaaacauaaAUGUCACAAa21121592180[hg19:12:69235788-69235809:+]0.51111427-11.50-0.5152
MIMAT0003879hsa-miR-7584193MDM2ccaaucaccuggUCCAGUGUUu | ||||||| guauaaacauaaAUGUCACAAa21121032124[hg19:12:69235788-69235809:+]0.51111427-11.50-0.5270
MIMAT0003879hsa-miR-7584193MDM2ccaaucaccuggUCCAGUGUUu | ||||||| guauaaacauaaAUGUCACAAa21123172338[hg19:12:69235788-69235809:+]0.51111427-11.50-0.4824
MIMAT0005796hsa-miR-12714193MDM2acucACGAACGAUCCACGGUUc ||:||| : ||||||| gauuUGUUUG--GCGUGCCAAg219341360[hg19:12:69210685-69210704:+]0.72061517-20.76-0.3842
MIMAT0004903hsa-miR-3004193MDM2ucucucucagacgggAACAUAu |||||| agaagcaacaacauaUUGUAUa28297318[hg19:12:69210641-69210662:+]0.74051206-6.95-0.4539
MIMAT0004929hsa-miR-190b4193MDM2uugggUUAUAGU--UUGUAUAGu |: | || |||||||: ugaugAGAAGCAACAACAUAUUg217292314[hg19:12:69210636-69210658:+]0.74051310-5.51-0.2584
MIMAT0004955hsa-miR-374b4193MDM2gugaAUCGU-CCAACA-UAAUAUa ||||| ||| |||||| ucggUAGCAUAAAUGUGAUUAUAa21941584181[hg19:12:69237787-69237810:+]0.50561216-10.17-0.1462
MIMAT0004955hsa-miR-374b4193MDM2gugaAUCGU-CCAACA-UAAUAUa ||||| ||| |||||| ucggUAGCAUAAAUGUGAUUAUAa21941024125[hg19:12:69237787-69237810:+]0.50561216-10.17-0.1511
MIMAT0004955hsa-miR-374b4193MDM2gugaAUCGU-CCAACA-UAAUAUa ||||| ||| |||||| ucggUAGCAUAAAUGUGAUUAUAa21943164339[hg19:12:69237787-69237810:+]0.50561216-10.17-0.1333
MIMAT0004955hsa-miR-374b4193MDM2guGAAUCGUCCAACAUAAUAUa |||:|| | | ||||||: auCUUGGCCAG-UAUAUUAUGa221258278[hg19:12:69210602-69210622:+]0.74051420-12.43-0.3030
MIMAT0004955hsa-miR-374b4193MDM2gugaaucguccaacaUAAUAUa |||||| uauuaugacuaaacgAUUAUAu28271292[hg19:12:69210615-69210636:+]0.74051206-3.22-0.1477
DNA & RNA Element - TRANSFAC
AccessionASDescriptionSpeciesEntrezPubmedBinding Info
G002854MO000023008MDM2Homo sapiens41937651818 0 0 R65235; HS$MDM2_23; Binding factors: hsa-miR-410-3p // 0 0 R63693; HS$MDM2_21; Binding factors: hsa-miR-193a-3p // 0 0 R66126; HS$MDM2_25; Binding factors: hsa-miR-25-3p // 0 0 R66128; HS$MDM2_26; Binding factors: hsa-miR-25-3p // 0 0 R66132; HS$MDM2_27; Binding factors: hsa-miR-32-5p // 0 0 R66133; HS$MDM2_28; Binding factors: hsa-miR-32-5p // 0 0 R68789; HS$MDM2_36; Binding factors: DEC1 // 0 0 R33688; HS$MDM2_05; Binding factors: Sp1-isoform1 // 0 0 R72745; HS$MDM2_41; Binding factors: hsa-miR-340-5p // 0 0 R61641; HS$MDM2_20; Binding factors: hsa-miR-18b-5p //-93 -74 R11385; HS$MDM2_01; Binding factors: p53 , p53 , p53 , p53-isoform1 , p63-isoform5 , p73alpha //-55 -36 R11386; HS$MDM2_02; Binding factors: p53 , p53 , p63-isoform5 , p73alpha //411 418 R69082; HS$MDM2_38; Binding factors: p53 , p53 //468 490 R66360; HS$MDM2_29; Binding factors: hsa-miR-339-5p //569 576 R69084; HS$MDM2_39; Binding factors: p53 , p53 //575 766 R66066; HS$MDM2_24; Binding factors: CTIP-2 //832 850 R66367; HS$MDM2_30; Binding factors: hsa-miR-339-5p
DNA & RNA Element - miRWalk
Gene NamemiRNAnameEntrez IDPathways
MDM2hsa-miR-143-3p4193hsa04110_Cell cycle
MDM2hsa-miR-145-5p4193hsa04110_Cell cycle
MDM2hsa-miR-18b-5p4193hsa04110_Cell cycle
MDM2hsa-miR-25-3p4193hsa04110_Cell cycle
MDM2hsa-miR-26b-5p4193hsa04110_Cell cycle
MDM2hsa-miR-32-5p4193hsa04110_Cell cycle
MDM2hsa-miR-39294193hsa04110_Cell cycle
MDM2hsa-miR-4844193hsa04110_Cell cycle
MDM2hsa-miR-504-5p4193hsa04110_Cell cycle
MDM2hsa-miR-605-5p4193hsa04110_Cell cycle
MDM2hsa-miR-92a-3p4193hsa04110_Cell cycle
MDM2hsa-miR-143-3p4193hsa04115_p53 signaling pathway
MDM2hsa-miR-145-5p4193hsa04115_p53 signaling pathway
MDM2hsa-miR-18b-5p4193hsa04115_p53 signaling pathway
MDM2hsa-miR-25-3p4193hsa04115_p53 signaling pathway
MDM2hsa-miR-26b-5p4193hsa04115_p53 signaling pathway
MDM2hsa-miR-32-5p4193hsa04115_p53 signaling pathway
MDM2hsa-miR-39294193hsa04115_p53 signaling pathway
MDM2hsa-miR-4844193hsa04115_p53 signaling pathway
MDM2hsa-miR-504-5p4193hsa04115_p53 signaling pathway
MDM2hsa-miR-605-5p4193hsa04115_p53 signaling pathway
MDM2hsa-miR-92a-3p4193hsa04115_p53 signaling pathway
MDM2hsa-miR-143-3p4193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-145-5p4193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-18b-5p4193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-25-3p4193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-26b-5p4193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-32-5p4193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-39294193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-4844193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-504-5p4193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-605-5p4193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-92a-3p4193hsa04120_Ubiquitin mediated proteolysis
MDM2hsa-miR-143-3p4193hsa04144_Endocytosis
MDM2hsa-miR-145-5p4193hsa04144_Endocytosis
MDM2hsa-miR-18b-5p4193hsa04144_Endocytosis
MDM2hsa-miR-25-3p4193hsa04144_Endocytosis
MDM2hsa-miR-26b-5p4193hsa04144_Endocytosis
MDM2hsa-miR-32-5p4193hsa04144_Endocytosis
MDM2hsa-miR-39294193hsa04144_Endocytosis
MDM2hsa-miR-4844193hsa04144_Endocytosis
MDM2hsa-miR-504-5p4193hsa04144_Endocytosis
MDM2hsa-miR-605-5p4193hsa04144_Endocytosis
MDM2hsa-miR-92a-3p4193hsa04144_Endocytosis
MDM2hsa-miR-143-3p4193hsa05200_Pathways in cancer
MDM2hsa-miR-145-5p4193hsa05200_Pathways in cancer
MDM2hsa-miR-18b-5p4193hsa05200_Pathways in cancer
MDM2hsa-miR-25-3p4193hsa05200_Pathways in cancer
MDM2hsa-miR-26b-5p4193hsa05200_Pathways in cancer
MDM2hsa-miR-32-5p4193hsa05200_Pathways in cancer
MDM2hsa-miR-39294193hsa05200_Pathways in cancer
MDM2hsa-miR-4844193hsa05200_Pathways in cancer
MDM2hsa-miR-504-5p4193hsa05200_Pathways in cancer
MDM2hsa-miR-605-5p4193hsa05200_Pathways in cancer
MDM2hsa-miR-92a-3p4193hsa05200_Pathways in cancer
MDM2hsa-miR-143-3p4193hsa05214_Glioma
MDM2hsa-miR-145-5p4193hsa05214_Glioma
MDM2hsa-miR-18b-5p4193hsa05214_Glioma
MDM2hsa-miR-25-3p4193hsa05214_Glioma
MDM2hsa-miR-26b-5p4193hsa05214_Glioma
MDM2hsa-miR-32-5p4193hsa05214_Glioma
MDM2hsa-miR-39294193hsa05214_Glioma
MDM2hsa-miR-4844193hsa05214_Glioma
MDM2hsa-miR-504-5p4193hsa05214_Glioma
MDM2hsa-miR-605-5p4193hsa05214_Glioma
MDM2hsa-miR-92a-3p4193hsa05214_Glioma
MDM2hsa-miR-143-3p4193hsa05215_Prostate cancer
MDM2hsa-miR-145-5p4193hsa05215_Prostate cancer
MDM2hsa-miR-18b-5p4193hsa05215_Prostate cancer
MDM2hsa-miR-25-3p4193hsa05215_Prostate cancer
MDM2hsa-miR-26b-5p4193hsa05215_Prostate cancer
MDM2hsa-miR-32-5p4193hsa05215_Prostate cancer
MDM2hsa-miR-39294193hsa05215_Prostate cancer
MDM2hsa-miR-4844193hsa05215_Prostate cancer
MDM2hsa-miR-504-5p4193hsa05215_Prostate cancer
MDM2hsa-miR-605-5p4193hsa05215_Prostate cancer
MDM2hsa-miR-92a-3p4193hsa05215_Prostate cancer
MDM2hsa-miR-143-3p4193hsa05218_Melanoma
MDM2hsa-miR-145-5p4193hsa05218_Melanoma
MDM2hsa-miR-18b-5p4193hsa05218_Melanoma
MDM2hsa-miR-25-3p4193hsa05218_Melanoma
MDM2hsa-miR-26b-5p4193hsa05218_Melanoma
MDM2hsa-miR-32-5p4193hsa05218_Melanoma
MDM2hsa-miR-39294193hsa05218_Melanoma
MDM2hsa-miR-4844193hsa05218_Melanoma
MDM2hsa-miR-504-5p4193hsa05218_Melanoma
MDM2hsa-miR-605-5p4193hsa05218_Melanoma
MDM2hsa-miR-92a-3p4193hsa05218_Melanoma
MDM2hsa-miR-143-3p4193hsa05219_Bladder cancer
MDM2hsa-miR-145-5p4193hsa05219_Bladder cancer
MDM2hsa-miR-18b-5p4193hsa05219_Bladder cancer
MDM2hsa-miR-25-3p4193hsa05219_Bladder cancer
MDM2hsa-miR-26b-5p4193hsa05219_Bladder cancer
MDM2hsa-miR-32-5p4193hsa05219_Bladder cancer
MDM2hsa-miR-39294193hsa05219_Bladder cancer
MDM2hsa-miR-4844193hsa05219_Bladder cancer
MDM2hsa-miR-504-5p4193hsa05219_Bladder cancer
MDM2hsa-miR-605-5p4193hsa05219_Bladder cancer
MDM2hsa-miR-92a-3p4193hsa05219_Bladder cancer
MDM2hsa-miR-143-3p4193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-145-5p4193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-18b-5p4193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-25-3p4193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-26b-5p4193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-32-5p4193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-39294193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-4844193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-504-5p4193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-605-5p4193hsa05220_Chronic myeloid leukemia
MDM2hsa-miR-92a-3p4193hsa05220_Chronic myeloid leukemia
DNA & RNA Element - RepTar
Gene NamemiRNABeginEndProfile
MDM2hsa-miR-10abeg:478end:491pic:3' GTGTTTAAGCCTAGATGTCCCAT 5'& || ||||||| &5' ----------GAG--ACAGGGT- 3'
MDM2hsa-miR-221beg:174end:194pic:3' CTTTGGGTCGTCTGT-----TACATCGA 5'& ||| |||||||| &5' -----------GACTTGAATATGTAGCT 3'
MDM2hsa-miR-4252beg:338end:357pic:3' ACCACGACTGA--GTCACCGG 5'& ||||. ||||||| &5' ----GCTGGAGTGCAGTGGC- 3'
MDM2hsa-miR-571beg:193end:212pic:3' GAGTGAGTCTACCGGTTGAGT 5'& || ||. ||||||| &5' -TC-CTTTACA--CCAACTC- 3'
MDM2hsa-miR-30bstarbeg:405end:422pic:3' CTTCATTTGTAGGTGGAGGGTC 5'& .| || .||||||| &5' -------GCCTCAGCCTCCCA- 3'
MDM2hsa-miR-384beg:42end:52pic:3' ATACTTGTTAAAGATCCTTA 5'& |||||||| &5' ------------CTAGGAAT 3'
MDM2hsa-miR-1255bbeg:188end:199pic:3' TTGGTGAAAGAAACGAGTAGGC 5'& |||||||| &5' -------------GCTCATCC- 3'
MDM2hsa-miR-1255abeg:188end:200pic:3' TTAGATGAAAGAAACGAGTAGGA 5'& ||||||||| &5' --------------GCTCATCCT 3'
MDM2hsa-miR-1827beg:371end:387pic:3' TAAGTTAGATGACGGAGT 5'& ||| || ||||||| &5' ---CAAGCT-CTGCCTC- 3'
MDM2hsa-miR-1827beg:396end:414pic:3' TAAGTTAGATGACGGAGT 5'& || ||| |||||||| &5' ---CATTCTCCTGCCTCA 3'
MDM2ebv-miR-BART5starbeg:351end:372pic:3' TC-CACTTGTCGCCGGGTG 5'& .| |||| | .|||.||| &5' GGCGTGATCT-TGGCTCAC 3'
MDM2hsa-miR-323b-5pbeg:46end:64pic:3' ACGCTTGAGTGGTGCCTGTTGGA 5'& |||.|.| |||||||| &5' ---GAATTTA-----GACAACCT 3'
MDM2hsa-miR-149starbeg:370end:389pic:3' CGTGTCGGGGGCAGGGAGGGA 5'& ||| |||.|. |||||| &5' GCA-AGCTCTG---CCTCCC- 3'
MDM2hsa-miR-149starbeg:392end:421pic:3' CGTGTC--GGGGGC--AG--GGAGGGA 5'& |||| |.||.| || |||||| &5' GCACCATTCTCCTGCCTCAGCCTCCC- 3'
MDM2hsa-miR-149starbeg:535end:555pic:3' CGTGTCGGG-GGCAG--GGAGGGA 5'& |||| || || |||||| &5' -----GCCCACC-TCGGCCTCCC- 3'
MDM2hcmv-miR-UL70-3pbeg:402end:421pic:3' GGCGCGCGGTCGGGTAGGGG 5'& || .|| .||||| |||| &5' CC-TGCCTCAGCC--TCCC- 3'
MDM2hsa-let-7abeg:396end:414pic:3' TTGATATGTTGGATGATGGAGT 5'& || || ||.||||| &5' -------CATTCTCCTGCCTCA 3'
MDM2hsa-let-7abeg:93end:103pic:3' TTGATATGTTGGATGATGGAGT 5'& |.||||| &5' ---------------TGCCTCA 3'
MDM2hsa-let-7abeg:362end:387pic:3' TTGAT--ATGTTGGATGATGGAGT 5'& ..|| |.||| || ||.|||| &5' GGCTCACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7bbeg:391end:414pic:3' TTGGTGTGTT-GGATGATGGAGT 5'& .|.||| .|| ||.||||| &5' --TCGCACCATTCTCCTGCCTCA 3'
MDM2hsa-let-7bbeg:362end:387pic:3' TTG-GTG-TGTTGGATGATGGAGT 5'& ..| ||| .||| || ||.|||| &5' GGCTCACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7cbeg:394end:414pic:3' TTGGTATGTTGGATGATGGAGT 5'& ||||| .|| ||.||||| &5' -ACCAT----TCTCCTGCCTCA 3'
MDM2hsa-let-7cbeg:365end:387pic:3' TTGGT-ATGTTGGATGATGGAGT 5'& .|| |.||| || ||.|||| &5' --TCACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7dbeg:362end:387pic:3' TTGAT--ACGTTGGATGATGGAGA 5'& ..|| ||||| || ||.|||| &5' GGCTCACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7dbeg:392end:413pic:3' TTGATACGTT---GGATGATGGAGA 5'& ||| .|| ||.|||| &5' ------GCACCATTCTCCTGCCTC- 3'
MDM2hsa-let-7ebeg:369end:387pic:3' TTGATATGTTGGAGGATGGAGT 5'& |.||| || ||.|||| &5' -----TGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7ebeg:396end:414pic:3' TTGATATGTTGGAGGATGGAGT 5'& || |||||.||||| &5' -------CATTCTCCTGCCTCA 3'
MDM2hsa-let-7fbeg:369end:387pic:3' TTGATATGTTAGATGATGGAGT 5'& |.||| || ||.|||| &5' -----TGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7fbeg:396end:414pic:3' TTGATATGTTAGATGATGGAGT 5'& || ||| ||.||||| &5' -------CATTCTCCTGCCTCA 3'
MDM2hsa-let-7gbeg:369end:387pic:3' TTGACATGTTTGATGATGGAGT 5'& |.|||.|| ||.|||| &5' -----TGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7gbeg:396end:414pic:3' TTGACATGTTTGATGATGGAGT 5'& || || ||.||||| &5' -------CATTCTCCTGCCTCA 3'
MDM2hsa-let-7gbeg:84end:103pic:3' TTGACATGTTTGATGATGGAGT 5'& ||. .|| |.||||| &5' ----GTGAGAAAA--TGCCTCA 3'
MDM2hsa-let-7ibeg:366end:387pic:3' TTGTCGTGTTTGATGATGGAGT 5'& || .|||.|| ||.|||| &5' --CACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7ibeg:392end:414pic:3' TTGTCGT-GTTTGATGATGGAGT 5'& ||| || || ||.||||| &5' ----GCACCATTCTCCTGCCTCA 3'
MDM2hsa-miR-10bbeg:471end:491pic:3' GTGTTTAAGCCAAGA-TGTCCCAT 5'& || || ||||||| &5' ------TTTAGTAGAGACAGGGT- 3'
MDM2hsa-miR-1183beg:405end:440pic:3' ACGG-GTGAGAGTGGT-------AGTGGATGTCAC 5'& ||| || ||| ||| | .|||||||| &5' -GCCTCAGCCTC-CCAATTAGCTTGGCCTACAGT- 3'
MDM2hsa-miR-1203beg:351end:370pic:3' CTCG-ACGTAGGACCGAGGCCC 5'& .|| || |||.|||||| &5' -GGCGTG-ATCTTGGCTC---- 3'
MDM2hsa-miR-1205beg:364end:384pic:3' GAGTTTCGTTTGGGACGTCT 5'& |||| ||||.|.|||| &5' CTCACTGCAAGCTCTGC--- 3'
MDM2hsa-miR-1206beg:566end:581pic:3' CGAATTTGTAGATGTACTTGT 5'& ||| .|||||.| &5' ------ACAG--GCATGAGC- 3'
MDM2hsa-miR-1224-5pbeg:377end:399pic:3' GGTGGAGGGCTCAGGAGTG 5'& | |||||||.||.| ||| &5' CTGCCTCCCGGGTTCGCAC 3'
MDM2hsa-miR-1224-5pbeg:513end:531pic:3' GGTGGAGGGCTCAGGAGTG 5'& | |.||||.|| |||| &5' CGATCTCCTGA--CCTC-- 3'
MDM2hsa-miR-1228starbeg:523end:544pic:3' GTGTGTGGA-CGG-GGGCGGGTG 5'& |||| |. .|||||||| &5' -----ACCTCGTGATCCGCCCAC 3'
MDM2hsa-miR-1233beg:475end:493pic:3' GACGCCCTCCTGTCCCGAGT 5'& |. || |||||||.|. &5' --GTA-GA-GACAGGGTTT- 3'
MDM2hsa-miR-1253beg:109end:124pic:3' ACGTCCGACTAGAAGAAGAGA 5'& |||. |||||||| &5' --------GATT-TCTTCTCT 3'
MDM2hsa-miR-1254beg:367end:394pic:3' TGACGTCCGAGGTCGAAGGTCCGA 5'& |||||| ||||. || ||.||.| &5' ACTGCAAGCTCTGCCTCCCGGGTT 3'
MDM2hsa-miR-1257beg:56end:77pic:3' CCAGTCTTGGGT----AGTAAGTGA 5'& ||||. |.|||||| &5' ------AACCTGAAATTTATTCAC- 3'
MDM2hsa-miR-125b-1starbeg:410end:435pic:3' TC-GAGGGTTC-TCGGATTGGGCA 5'& || ||||||| |||.|..||. &5' AGCCTCCCAATTAGCTTGGCCT-- 3'
MDM2hsa-miR-1262beg:319end:340pic:3' TAGGAAGATGTTTAAGTGGGTA 5'& .||.| || | |.||||| &5' GTCTTGCT-CTG--TTACCCA- 3'
MDM2hsa-miR-1273beg:311end:339pic:3' TTCTTTCTCAGAACGAAACAGCGGG 5'& .||| |||||||||| ||| ||| &5' GAGACCGAGTCTTGCTCTGTTACCC 3'
MDM2hsa-miR-1273dbeg:367end:395pic:3' TGACGTCGGAGTTGGAGTACCCAAG 5'& |||||| ||| .|||| |||||| &5' ACTGCAAGCTCTGCCTCCCGGGTTC 3'
MDM2hsa-miR-1285beg:484end:510pic:3' TCCAGAGTGAAACAA-CGGGTCT 5'& .|||.|||| |||| ||| .|| &5' GGGTTTCACCGTGTTAGCCAGGA 3'
MDM2hsa-miR-1295beg:416end:436pic:3' AGTGGGTCTAGACG--CCGGATT 5'& |||| ||. || |||||| &5' ---CCCA-ATTAGCTTGGCCTA- 3'
MDM2hsa-miR-138-2starbeg:137end:159pic:3' TTGGGACCACAGCACTTTATCG 5'& ||..|||| |||.|||||. &5' -ACTTTGGTA--GTGGAATAGT 3'
MDM2hsa-miR-142-3pbeg:354end:376pic:3' AGGTATTTCATCCTTTGTGATGT 5'& |.|.| || ||||.|| &5' --CGTGATCTTGGCT-CACTGCA 3'
MDM2hsa-miR-146b-3pbeg:478end:491pic:3' GGTCTTGACTCAGGTGTCCCGT 5'& ||| ||||||. &5' --------GAG---ACAGGGT- 3'
MDM2hsa-miR-150starbeg:327end:351pic:3' GACAGGGGGTCCGGA--CATGGTC 5'& |||| |||||||. ||.| &5' CTGTTACCCAGGCTGGAGTGC--- 3'
MDM2hsa-miR-150starbeg:377end:401pic:3' GACAGGGGGTCCGGACATGGTC 5'& ||| |.|||.||. | |||| &5' CTGCCTCCCGGGTTCGCACCA- 3'
MDM2hsa-miR-15astarbeg:494end:516pic:3' ACTCCGTCGTGTTATACCGGAC 5'& | | .||| ||. ||||.|| &5' -GTGTTAGC-CAGGATGGTCT- 3'
MDM2hsa-miR-184beg:229end:240pic:3' TGGGAATAGTCAAGAGGCAGGT 5'& |||.|||. &5' -------------CTCTGTCT- 3'
MDM2hsa-miR-187beg:555end:579pic:3' GGC-CGACGTT-GTGTTCTGTGCT 5'& | |||| .| .|| ||.||.|| &5' --GTGCTGGGATTAC-AGGCATGA 3'
MDM2hsa-miR-1909beg:392end:410pic:3' GCCACTCGTGGGCCGGGGACGC 5'& ||||| |.||||| &5' ------GCACCATTCTCCTGC- 3'
MDM2hsa-miR-190bbeg:63end:85pic:3' TTGGGTTATAGTTTGTATAGT 5'& ||...| ||| |.|||||| &5' AATTTAT--TCACATATATCA 3'
MDM2hsa-miR-196bstarbeg:341end:366pic:3' CTTC-CGTCACAGCACGACAGCT 5'& |.|| |||||| |||| |.|. &5' GGAGTGCAGTGGCGTGATCTTGG 3'
MDM2hsa-miR-202beg:398end:419pic:3' AAGGGTACGGGATATGGAGA 5'& |||.| ||||. .|||| &5' TTCTCCTGCCTCA-GCCTC- 3'
MDM2hsa-miR-205starbeg:46end:70pic:3' CTTGAAG-TGAGGTGACTTTAG 5'& |||.|| || | |||||||. &5' GAATTTAGACAAC-CTGAAATT 3'
MDM2hsa-miR-206beg:103end:127pic:3' GGTGTGTG-AAGGAATGTAAGGT 5'& ||||.| ||.||| | |..| &5' -CACATAGATTTCTT-CTCTTTA 3'
MDM2hsa-miR-20astarbeg:338end:354pic:3' GAAATTCACGAGTATTACGTCA 5'& ||| . |.|||||| &5' --------GCTGG-AGTGCAGT 3'
MDM2hsa-miR-20bstarbeg:553end:572pic:3' GACCTTCACGGGTATGATGTCA 5'& ||||||. . |.||||| &5' ----AAGTGCTGGGATTACAG- 3'
MDM2hsa-miR-2114beg:549end:570pic:3' CTGGCGAAGTTC-CTTCCCTGAT 5'& || | ||| | ||||.|| &5' --CC-CA--AAGTGCTGGGATTA 3'
MDM2hsa-miR-2117beg:3end:22pic:3' GACAGGAACCGTTTCTCTTGT 5'& |||||. |||||||. &5' CTGTCTAT----AAGAGAAT- 3'
MDM2hsa-miR-214starbeg:553end:576pic:3' CGTGTCGTTCAC-ATC----TGTCCGT 5'& ||||| |.| ||||||| &5' -------AAGTGCTGGGATTACAGGCA 3'
MDM2hsa-miR-216abeg:545end:570pic:3' AGTGTCAACGGT--------CGACTCTAAT 5'& ||| ||||.||||| &5' --------GCCTCCCAAAGTGCTGGGATTA 3'
MDM2hsa-miR-217beg:335end:355pic:3' AGGTTAGTCAAGGAC--TACGTCAT 5'& ||| ||| .||||||. &5' ------CAGG--CTGGAGTGCAGTG 3'
MDM2hsa-miR-218-1starbeg:569end:583pic:3' GGTACCACGAACTGC-CTTGGTA 5'& |.| ||.||| &5' -----------GGCATGAGCCA- 3'
MDM2hsa-miR-25beg:335end:355pic:3' AGTCTGGCTCTGTTCACGTTAC 5'& |||.|.| .||||||.|| &5' -CAGGCTG----GAGTGCAGTG 3'
MDM2hsa-miR-25starbeg:363end:386pic:3' GTTAACGGGT-----TCAGAGGCGGA 5'& ||.|| || |||.|||| &5' -----GCTCACTGCAAG-CTCTGCCT 3'
MDM2hsa-miR-26abeg:233end:258pic:3' TCGGATAGGAC---CTA---ATGAACTT 5'& ||.||.| || ||||||. &5' ---CTGTCTTAAATGAGAAGTACTTGG- 3'
MDM2hsa-miR-26bbeg:235end:258pic:3' TGGATAGGACTTA--ATGAACTT 5'& |.|| |||. ||||||. &5' -CTTAAA-TGAGAAGTACTTGG- 3'
MDM2hsa-miR-2861beg:533end:553pic:3' GGCGGGTGGCGGTCCGGGG 5'& ||||||||| .| ||||.| &5' CCGCCCACC-TC-GGCCTC 3'
MDM2hsa-miR-299-3pbeg:93end:112pic:3' TTCGCCAAATGGTA--GGGTGTAT 5'& |.|| ..|||||| &5' --------TGCCTCAATTCACATA 3'
MDM2hsa-miR-302abeg:240end:257pic:3' AGTGGTTTTGTAC-CTTCGTGAAT 5'& ||| ||||.||||. &5' ----------ATGAGAAGTACTTG 3'
MDM2hsa-miR-302cbeg:229end:257pic:3' GGTGACTTTG--TAC-CTTCGTGAAT 5'& | ||| ||| ||||.||||. &5' -CTCTGTCTTAAATGAGAAGTACTTG 3'
MDM2hsa-miR-302cstarbeg:479end:503pic:3' GTC-GTCCATGGG-GGTACAATTT 5'& || |||| ..| ||.|||||. &5' -AGACAGGGTTTCACCGTGTTAG- 3'
MDM2hsa-miR-30astarbeg:368end:391pic:3' CGACGTTTGTAGGCTGACTTTC 5'& ||||||.| ||.| || .| &5' -CTGCAAGC-TCTGCCTCCCGG 3'
MDM2hsa-miR-30bstarbeg:372end:391pic:3' CTTCATTTGTAGGTGGAGGGTC 5'& ||.| || ||||||.| &5' -----AAGC-TCTGCCTCCCGG 3'
MDM2hsa-miR-30c-1starbeg:405end:422pic:3' CCTCATTTGTTGGGA---GAGGGTC 5'& .||. |||||| &5' ----------GCCTCAGCCTCCCA- 3'
MDM2hsa-miR-30c-2starbeg:405end:422pic:3' TCTCATTTGTCGGAA---GAGGGTC 5'& |||| |||||| &5' ----------GCCTCAGCCTCCCA- 3'
MDM2hsa-miR-31beg:313end:330pic:3' TCGATAC-GGTCGTAGAACGGA 5'& | ||. .||||||. &5' ------GACCGA-GTCTTGCT- 3'
MDM2hsa-miR-3130-3pbeg:404end:428pic:3' AATGG-GTCAGAGGCCACGTCG 5'& |.|| ||| |||| .||| &5' -TGCCTCAGCCTCCCAATTAGC 3'
MDM2hsa-miR-3136beg:423end:442pic:3' TTACTGGGATGGATAAGTCAGTC 5'& .|. .|||| |||||| &5' ----GCTTGGCCTA--CAGTCA- 3'
MDM2hsa-miR-3138beg:367end:398pic:3' TGAGG---GAGATGGAGTGA-CAGGTGT 5'& ||| | ||||.|||| | ||.|.|| &5' ACTGCAAGCTCTGCCTCCCGGGTTCGCA 3'
MDM2hsa-miR-3138beg:397end:422pic:3' TGAGGGAGATGGAGTGACAGGTGT 5'& |.||.| ||.||||| ||| || &5' ATTCTC-CTGCCTCAGCCTCC-CA 3'
MDM2hsa-miR-3141beg:401end:421pic:3' AGGA-GGAGGTGGGCGGGAG 5'& |||| |||| .||. ||| &5' TCCTGCCTCAGCCT-CCC-- 3'
MDM2hsa-miR-3143beg:480end:503pic:3' GCTTTCTTCGCGAAATGTTACAATA 5'& ||.| |.| |.|| || .||||| &5' -GAGACAGG-GTTTCACCGTGTTA- 3'
MDM2hsa-miR-3147beg:393end:417pic:3' AGTGTGGGAGGAGTGACGG-GTTGG 5'& |.|||| |.||| ||||| ||.|| &5' -CGCACCATTCTC-CTGCCTCAGCC 3'
MDM2hsa-miR-3148beg:245end:266pic:3' TTCGTGTGTGGTCAAAAAAGGT 5'& |||.|| . |||||||.. &5' AAGTAC---TTGGTTTTTTTT- 3'
MDM2hsa-miR-3170beg:27end:49pic:3' TGACAGACAGAGTC-TTGGGGTC 5'& ||| || |||||.|| &5' ----TCTAACTATATAACCCTAG 3'
MDM2hsa-miR-3171beg:68end:84pic:3' CTATATATGTCTAAG-GTATGTAGA 5'& |||| ||||.||| &5' -----------ATTCACATATATC- 3'
MDM2hsa-miR-3172beg:31end:48pic:3' ATTCCTGACGTTTTGGGGT 5'& ||| .| |||||.| &5' -----ACTATATAACCCTA 3'
MDM2hsa-miR-3174beg:362end:389pic:3' CCGAG--ACGTA-GAGATTGAGTGAT 5'& ||||| |||| ||||. ||| | &5' GGCTCACTGCAAGCTCTGCCTCCC-- 3'
MDM2hsa-miR-3180-3pbeg:362end:387pic:3' CCGGA-GGCCTTCGAGGCGGGGT 5'& |||. |.| ||||||.|||.| &5' GGCTCACTGCAAGCTCTGCCTC- 3'
MDM2hsa-miR-3182beg:362end:379pic:3' CTGATGTGATGTCTTCG 5'& |.|| ||||.|| ||| &5' GGCT-CACTGCA--AGC 3'
MDM2hsa-miR-3187beg:442end:463pic:3' GGCGCGTCGG---GGTACCGGTT 5'& |.|| || || || ||||.|| &5' CTGC-CA-CCACACC-TGGCTAA 3'
MDM2hsa-miR-3187beg:533end:551pic:3' GGCGCGTCGGGGTACCGGTT 5'& |||| || ||.| |||| &5' CCGCCCA-CCTC--GGCC-- 3'
MDM2hsa-miR-3192beg:368end:392pic:3' AAGGTGACGA-TGT--TGGAGGGTCT 5'& |||||| .| .||||||.|. &5' ---CACTGCAAGCTCTGCCTCCCGGG 3'
MDM2hsa-miR-320ebeg:395end:416pic:3' GG-AAGAGT-TGG-GTCGAAA 5'& || ||||| .|| |||| &5' CCATTCTCCTGCCTCAGC--- 3'
MDM2hsa-miR-32beg:344end:355pic:3' ACGTTGAATCATTACACGTTAT 5'& |||||.|. &5' --------------GTGCAGTG 3'
MDM2hsa-miR-330-5pbeg:558end:580pic:3' CGGATTCT-GTGTCCGGGTCTCT 5'& ||..|| .|||||| ||| &5' --CTGGGATTACAGGCAT-GAG- 3'
MDM2hsa-miR-338-3pbeg:551end:566pic:3' GTTGTTTTAGTGACTACGACCT 5'& || .||||||. &5' ---------CAAA-GTGCTGGG 3'
MDM2hsa-miR-339-5pbeg:469end:490pic:3' GCACTCGAGGACC-TC-CTGTCCCT 5'& ||..| | || ||||||| &5' ------CTTTTAGTAGAGACAGGG- 3'
MDM2hsa-miR-363beg:335end:354pic:3' ATGTCT-ACCTATGGCACGTTAA 5'& |||. |||| |||||.| &5' --CAGGCTGGA----GTGCAGT- 3'
MDM2hsa-miR-363starbeg:521end:542pic:3' TTTAAC-GTAGCACTAGGTGGGC 5'& || | |||||||||.||| &5' ----TGACCTCGTGATCCGCCC- 3'
MDM2hsa-miR-367beg:331end:354pic:3' AGTGGTAACGATTTCACGTTAA 5'& |.||| |||..||||||.| &5' TTACCCAGGCTGGAGTGCAGT- 3'
MDM2hsa-miR-377starbeg:397end:419pic:3' CTTAAGTGGTTCCCGTTGGAGA 5'& |||| || ||.|||| &5' --ATTCTCCTGCCTCAGCCTC- 3'
MDM2hsa-miR-378bbeg:542end:565pic:3' AAGACGGAGG--TTCA-GGTCA 5'& || |||||| |||| | | &5' -TCGGCCTCCCAAAGTGCTGG- 3'
MDM2hsa-miR-378bbeg:376end:395pic:3' AAGACGGA-GGTTCAGGTCA 5'& ||||||| ||..||.| &5' -TCTGCCTCCCGGGTTC--- 3'
MDM2hsa-miR-379beg:429end:449pic:3' GGATGCAAGGTATCAGATGGT 5'& ||||| || |||.||| &5' CCTACAGTCA----TCTGCCA 3'
MDM2hsa-miR-423-5pbeg:508end:531pic:3' TTTCAGAGCGAGA-GACGGGGAGT 5'& .|||||| ||| ||| |||| &5' --GGTCTCGATCTCCTGA-CCTC- 3'
MDM2hsa-miR-4253beg:379end:400pic:3' TGGGGGACCTGTACG-GGA 5'& .||.|| ||. || || &5' GCCTCCCGGGTTCGCACC- 3'
MDM2hsa-miR-4253beg:535end:555pic:3' TGGG-GGACCTGTACGGGA 5'& .||| ||| |.| ||| &5' GCCCACCTCGGCCT-CCC- 3'
MDM2hsa-miR-4253beg:332end:351pic:3' TGGGG--GACCTGTACGGGA 5'& |||| ||||| .||| &5' ACCCAGGCTGGA-GTGC--- 3'
MDM2hsa-miR-425starbeg:508end:527pic:3' CCCGCCTGTGCTGTAAGGGCTA 5'& || | |||. |||.|| &5' ----GGTCTCGATC-TCCTGA- 3'
MDM2hsa-miR-4260beg:400end:414pic:3' ACCCTGAGGTACGGGGTTC 5'& |||| ||||.||. &5' -----CTCC-TGCCTCAG- 3'
MDM2hsa-miR-4265beg:333end:352pic:3' GGGTCTCGA-CTCGGGTGTC 5'& ||||| ||| |||. || &5' CCCAG-GCTGGAGTGCA--- 3'
MDM2hsa-miR-4267beg:328end:347pic:3' CACGGTGGC-TCGACCT 5'& ||..||| .|||||| &5' -TGTTACCCAGGCTGGA 3'
MDM2hsa-miR-4270beg:509end:535pic:3' CGGG---AGGGGACTGAGGGACT 5'& |.|. ||.|||||| | ||| &5' GTCTCGATCTCCTGACCTCGTGA 3'
MDM2hsa-miR-4273beg:3end:22pic:3' GACAGGTAGTCTCTTGTG 5'& |||||.|| ||||||. &5' CTGTCTATAAGAGAAT-- 3'
MDM2hsa-miR-4281beg:377end:397pic:3' GGGGGGAGGGGCCCTGGG 5'& |. |||||| || | | &5' -CTGCCTCCCGGGTTCGC 3'
MDM2hsa-miR-4281beg:402end:421pic:3' GGGGGGAGG-GGCCCTGGG 5'& ||. |||| || ||| &5' CCTGCCTCAGCCT---CCC 3'
MDM2hsa-miR-4281beg:533end:555pic:3' GGGGGGAGGGGCCCT-GGG 5'& || ||| ||.||| ||| &5' CCGCCCACCTCGGCCTCCC 3'
MDM2hsa-miR-4288beg:560end:576pic:3' CCTTTGAGTCGTCTGTT 5'& | |.| |||.|| &5' -GGGATTA--CAGGCA- 3'
MDM2hsa-miR-4296beg:310end:329pic:3' ACTC-GGACTC-GGGTGTA 5'& |||| || ||| |. | &5' TGAGACC-GAGTCTTGC-- 3'
MDM2hsa-miR-4296beg:422end:438pic:3' ACTCGGACTCGGGTGTA 5'& |||.|| |||.||| &5' --AGCTTG-GCCTACA- 3'
MDM2hsa-miR-4297beg:565end:581pic:3' GTGTCTGTCCTTCCGT 5'& .||||.|| || || &5' TACAGGCATGA--GC- 3'
MDM2hsa-miR-4303beg:403end:419pic:3' GACAGGAGTC-GAGTCTT 5'& ||| |||||| ||| &5' CTG-CCTCAGCCTC---- 3'
MDM2hsa-miR-4311beg:103end:126pic:3' GTGTG---AGTCGAGAGAAAG 5'& ||||. |. .||||||| &5' CACATAGATTTCTTCTCTTT- 3'
MDM2hsa-miR-4322beg:423end:439pic:3' GGGGTGCGCGACTCGGGTGTC 5'& ||| .|||.|||| &5' --------GCTTGGCCTACAG 3'
MDM2hsa-miR-4322beg:549end:572pic:3' GGGGTG-CGCGACTCGGGTGTC 5'& |||| |.||||.| ..|||| &5' -CCCAAAGTGCTGGGATTACAG 3'
MDM2hsa-miR-4325beg:331end:352pic:3' AGTGACTCTG--TTCACGTT 5'& |.|| ||.| .||||||. &5' TTACCCAGGCTGGAGTGCAG 3'
MDM2hsa-miR-4327beg:364end:380pic:3' GGTCAGGGGGT-ACGTTCGG 5'& |.|| |||||||. &5' -------CTCACTGCAAGCT 3'
MDM2hsa-miR-448beg:265end:281pic:3' TACCCTGTAGGATGTATACGTT 5'& ||.|| |||||.| &5' --------TCTTAAATATGTA- 3'
MDM2hsa-miR-449cstarbeg:335end:357pic:3' TGTCTCTCCTCACGTTGATCGTT 5'& |||. ||||||||. |.|| &5' -CAGGCTGGAGTGCAG-TGGC-- 3'
MDM2hsa-miR-486-3pbeg:367end:387pic:3' TAG-GACA--TGACTCGACGGGGC 5'& || ||| .|| |||||.| &5' -TCACTGCAAGCT---CTGCCTC- 3'
MDM2hsa-miR-486-3pbeg:395end:413pic:3' TAGGACATGACTCGACGGGGC 5'& || || |||||.| &5' --CCATT-CTC--CTGCCTC- 3'
MDM2hsa-miR-490-3pbeg:370end:394pic:3' GTCGTACCTCA-GGA-GGTCCAAC 5'& ||| ||| ||.|||| &5' --GCAAGCTCTGCCTCCCGGGTT- 3'
MDM2hsa-miR-493beg:424end:445pic:3' GGACCGTGTGTCATCTGGAAGT 5'& |.|||| .||||| |.|| &5' CTTGGCCTACAGTC-ATCT--- 3'
MDM2hsa-miR-499-5pbeg:316end:327pic:3' TTTGTAGTGACGTTCAGAATT 5'& |.||||||. &5' -----------CGAGTCTTG- 3'
MDM2hsa-miR-499-5pbeg:362end:382pic:3' TTTGTAGTGACGTTC-AGAATT 5'& ..| |||||||||| ||| &5' -GGC-TCACTGCAAGCTCT--- 3'
MDM2hsa-miR-500beg:547end:570pic:3' AGAGTGGGTCCATCGTTCCTAAT 5'& ||| || || || .|||||| &5' -CTC-CCAAAGT-GCTGGGATTA 3'
MDM2hsa-miR-508-3pbeg:423end:442pic:3' AGATGAGGTTTTCC-GATGTTAGT 5'& .||. || |||||.||| &5' ---GCTT-----GGCCTACAGTCA 3'
MDM2hsa-miR-519abeg:456end:476pic:3' TGTGAGATTTTCCTACGTGAAA 5'& |||| ||.||||| &5' -----CTAATTTTTTGTACTTT 3'
MDM2hsa-miR-520a-3pbeg:236end:256pic:3' TGTCAGGTTTCC-CTTCGTGAAA 5'& ..||| | ||||.|||| &5' -----TTAAATGAGAAGTACTT- 3'
MDM2hsa-miR-520d-5pbeg:454end:472pic:3' CTTTCCCGAA-GGGAAACATC 5'& |||| ...|||||| &5' -----GGCTAATTTTTTGTA- 3'
MDM2hsa-miR-520ebeg:234end:256pic:3' GGGAGTTTTTCCTTCGTGAAA 5'& .||.||| ||||.|||| &5' -TCTTAAATGAGAAGTACTT- 3'
MDM2hsa-miR-541beg:524end:545pic:3' TCAGGTCTAAGACACGGGTGGT 5'& || .| ||||||| &5' ---CCTCGTGATCCGCCCACC- 3'
MDM2hsa-miR-542-3pbeg:319end:337pic:3' AAAGTCAATAGTT--AGACAGTGT 5'& .|| |||||.|| &5' --------GTCTTGCTCTGTTAC- 3'
MDM2hsa-miR-548d-3pbeg:243end:263pic:3' CGTTTTCTTTGACACCAAAAAC 5'& |.||| ||| |||||||| &5' --AGAAGT-ACT-TGGTTTTT- 3'
MDM2hsa-miR-548jbeg:550end:571pic:3' TGGTTTC-TGGCGTTAATGAAAA 5'& |||||| .|.| .||||| &5' -CCAAAGTGCTGGGATTAC---- 3'
MDM2hsa-miR-564beg:486end:502pic:3' CGGACGACTGTGGCACGGA 5'& |.| |||||||.. &5' ----GTTT-CACCGTGTT- 3'
MDM2hsa-miR-583beg:109end:126pic:3' CATTACCCTGGA-AGGAGAAAC 5'& ||..| |.|||||| &5' -------GATTTCTTCTCTTT- 3'
MDM2hsa-miR-588beg:445end:463pic:3' CAAGATTGG-GTAACACCGGTT 5'& ||| || ||||.|| &5' ------ACCACACC-TGGCTAA 3'
MDM2hsa-miR-589beg:242end:263pic:3' GAGTCTCGTC-TGCACCAAGAGT 5'& ||| || || |||||.|. &5' ----GAGAAGTACTTGGTTTTT- 3'
MDM2hsa-miR-608beg:528end:547pic:3' TGCCTCGACAGGGTTGTGGTGGGGA 5'& |. ||| .| |||||.| &5' -----GTGATCC--GC-CCACCTC- 3'
MDM2hsa-miR-610beg:176end:196pic:3' AGGGTCGTGTGTAAATCGAGT 5'& |. | |.|| ||||||| &5' --CTTGA--ATATGTAGCTCA 3'
MDM2hsa-miR-622beg:324end:345pic:3' CGAGGT--TGGAGTCGTCTGACA 5'& ||||. ||| |||.||| &5' GCTCTGTTACC----CAGGCTG- 3'
MDM2hsa-miR-631beg:373end:394pic:3' CGACTCCAGACCC--GGTCCAGA 5'& || |||| ||.|||. &5' ----AGCTCTGCCTCCCGGGTT- 3'
MDM2hsa-miR-650beg:368end:388pic:3' CAGGACTCTCGCGACGGAGGA 5'& ||| ||| |||||||| &5' ---CTGCAAGCTCTGCCTCC- 3'
MDM2hsa-miR-654-3pbeg:555end:578pic:3' TTCCACTACCAGTC-GTCTGTAT 5'& ||| ||| |||.|||. &5' ---GTGCTGGGATTACAGGCATG 3'
MDM2hsa-miR-654-5pbeg:525end:545pic:3' CGTGTACAAGACGCCGGGTGGT 5'& | |.|| || ||||||| &5' -CTCGTGATCC---GCCCACC- 3'
MDM2hsa-miR-663beg:363end:386pic:3' CGCC-AG-GGCGCCGCGGGGCGGA 5'& || || |.|| ||.|.|||| &5' --GGCTCACTGCAA-GCTCTGCCT 3'
MDM2hsa-miR-664starbeg:487end:508pic:3' TAGGTTAGTAAAAG-GG----ATCGGTCA 5'& |||| || ||||||| &5' ----------TTTCACCGTGTTAGCCAG- 3'
MDM2hsa-miR-665beg:503end:526pic:3' TCC--CCGGAGTCGGAGGACCA 5'& ||| ||.|||. |||||| &5' AGGATGGTCTCGATCTCCTG-- 3'
MDM2hsa-miR-665beg:405end:420pic:3' TCCCCGGAGTCGGAGGACCA 5'& |||||||||||| &5' ----GCCTCAGCCTCC---- 3'
MDM2hsa-miR-759beg:215end:238pic:3' CAGTTTTAACAAACGTGAGACG 5'& |.||| ||| .||||||. &5' -TTAAATAA-TTTCTACTCTGT 3'
MDM2hsa-miR-762beg:400end:419pic:3' CGAGCCGGGGCCGGGGTCGGGG 5'& |.|| |||.|||||.| &5' ------CTCCTGCCTCAGCCTC 3'
MDM2hsa-miR-766beg:324end:349pic:3' CGACTCCGACACC----CCGACCTCA 5'& ||| |||| ||||||||| &5' GCT----CTGTTACCCAGGCTGGAGT 3'
MDM2hsa-miR-769-5pbeg:476end:494pic:3' TCGAGTCTTGGGTCTCCAGAGT 5'& .|||. ||| |||.||| &5' ----TAGAGA-CAG-GGTTTCA 3'
MDM2hsa-miR-770-5pbeg:544end:566pic:3' ACCGGGACTGTGCACCATGACCT 5'& ||||. || ||.||||. &5' -GGCCTCC-CAAA--GTGCTGGG 3'
MDM2hsa-miR-876-3pbeg:563end:584pic:3' ACTTAATGAAAC-ATTTGGTGGT 5'& |.||||| |.|.||||| &5' -GGATTACAGGCATGAGCCACC- 3'
MDM2hsa-miR-876-3pbeg:431end:452pic:3' ACTTAATGAAACATT-TGGTGGT 5'& ||| .|||||| &5' -----TACAGTCATCTGCCACCA 3'
MDM2hsa-miR-921beg:317end:346pic:3' CTTAGGACCAAGACA--GGGAGTGATC 5'& ||.||.|| ||||| ||| .||.| &5' GAGTCTTGC-TCTGTTACCCAGGCTGG 3'
MDM2hsa-miR-92abeg:335end:355pic:3' TGTCCGGCCCTGTTCACGTTAT 5'& |||||.|| ||||||.|. &5' -CAGGCTGG----AGTGCAGTG 3'
MDM2hsa-miR-92bbeg:336end:355pic:3' CCTCCGGCCCTGCTCACGTTAT 5'& ||||.|| ||||||.|. &5' --AGGCTGG----AGTGCAGTG 3'
MDM2hsa-miR-939beg:396end:422pic:3' GTGGGGGTCTCGGAGTCGAGGGGT 5'& ||..|.| |||||||| |||| &5' CATTCTCCT-GCCTCAGCCTCCCA 3'
MDM2hsa-miR-940beg:392end:412pic:3' CCCCTCGCCCCC--GGGACGGAA 5'& || .||||||| &5' -----GCACCATTCTCCTGCCT- 3'
MDM2hsa-miR-940beg:370end:386pic:3' CCCCTCGCCCCCGGGACGGAA 5'& || ||.|||||| &5' -----GCAA--GCTCTGCCT- 3'
MDM2hsa-miR-943beg:422end:442pic:3' GACCTCCTGCCGT-TGTCAGTC 5'& || .||| ||||||| &5' ----AGCTTGGCCTACAGTCA- 3'
MDM2hsa-miR-98beg:366end:387pic:3' TTGTTATGTTGAATGATGGAGT 5'& || |.||| ||.|||| &5' --CACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-miR-98beg:403end:414pic:3' TTGTTATGTTGAATGATGGAGT 5'& ||.||||| &5' --------------CTGCCTCA 3'
MDM2hsv1-miR-H11beg:224end:243pic:3' CGCAAGCGTGAAACAGGATT 5'& ||| .||| ||||.||| &5' ---TTC-TACTCTGTCTTAA 3'
MDM2hsv1-miR-H4beg:363end:385pic:3' ACGAACGGACAGTTTGAGATGG 5'& ||| ||| |||.||||.|| &5' -GCTCA-CTG-CAAGCTCTGCC 3'
MDM2hsv1-miR-H5-5pbeg:404end:421pic:3' CATCTCTACGGGCTTGGGGGGG 5'& ||||. |.||.||| &5' -------TGCCTCAGCCTCCC- 3'
MDM2hsv1-miR-H5-5pbeg:535end:555pic:3' CATCTCTACGGGC----TTGGGGGGG 5'& |||| ..||.||| &5' --------GCCCACCTCGGCCTCCC- 3'
MDM2hsv1-miR-H6-5pbeg:392end:417pic:3' ATGTGG---GGGGACGGAAGGTGG 5'& .|||| |.|||||| || .|| &5' -GCACCATTCTCCTGCC-TCAGCC 3'
MDM2hsv2-miR-H10beg:533end:555pic:3' GGCGGGTGGGGGCGT-GGG 5'& |||||||||.| || ||| &5' CCGCCCACCTCGGCCTCCC 3'
MDM2hsv2-miR-H11beg:224end:243pic:3' TTCGCAAGCGTGAAACAGGATT 5'& ||| .||| ||||.||| &5' -----TTC-TACTCTGTCTTAA 3'
MDM2hsv2-miR-H3beg:536end:558pic:3' GAGGGTTGGCGTCTGAGGGTTT 5'& ||| ||| |.| |||||||| &5' --CCC-ACCTCGGCCTCCCAAA 3'
MDM2hsv2-miR-H3beg:400end:423pic:3' GAGGGTTGGCGTCTGAGGGTTT 5'& ||||. .|| ||| ||||||| &5' CTCCT-GCCTCAGCCTCCCAA- 3'
MDM2hsv2-miR-H4-3pbeg:558end:578pic:3' CTCAAGCGATCC----GTTCGTGCC 5'& |||.|| ||.|||.| &5' ------GCTGGGATTACAGGCATG- 3'
MDM2hsv2-miR-H5beg:374end:389pic:3' CCAGTCCACCGGGCTCGGGGGGG 5'& ||.| |||.||| &5' ---------GCTCT-GCCTCCC- 3'
MDM2hsv2-miR-H5beg:405end:421pic:3' CCAGTCCACCGGGCTCGGGGGGG 5'& |||. ||||.||| &5' ---------GCCTCAGCCTCCC- 3'
MDM2kshv-miR-K12-2beg:419end:440pic:3' GTCTAGCTGGGCCTGATGTCAA 5'& || .|..|| ||||||| &5' ---ATTAGCTTGGCCTACAGT- 3'
MDM2kshv-miR-K12-7beg:550end:570pic:3' CGCGGTCGT-TGTACCCTAGT 5'& ||| .| ||||||.| &5' ---CCAAAGTGC-TGGGATTA 3'
MDM2sv40-miR-S1-3pbeg:468end:489pic:3' TGAGTCCCGTACTTTGTCCG 5'& |||. |.| ||.||||| &5' ACTTTTAGTA-GAGACAGG- 3'
MDM2hsa-miR-10abeg:636end:649pic:3' GTGTTTAAGCCTAGATGTCCCAT 5'& || ||||||| &5' ----------GAG--ACAGGGT- 3'
MDM2hsa-miR-221beg:332end:352pic:3' CTTTGGGTCGTCTGT-----TACATCGA 5'& ||| |||||||| &5' -----------GACTTGAATATGTAGCT 3'
MDM2hsa-miR-4252beg:496end:515pic:3' ACCACGACTGA--GTCACCGG 5'& ||||. ||||||| &5' ----GCTGGAGTGCAGTGGC- 3'
MDM2hsa-miR-571beg:351end:370pic:3' GAGTGAGTCTACCGGTTGAGT 5'& || ||. ||||||| &5' -TC-CTTTACA--CCAACTC- 3'
MDM2hsa-miR-30bstarbeg:563end:580pic:3' CTTCATTTGTAGGTGGAGGGTC 5'& .| || .||||||| &5' -------GCCTCAGCCTCCCA- 3'
MDM2hsa-miR-384beg:200end:210pic:3' ATACTTGTTAAAGATCCTTA 5'& |||||||| &5' ------------CTAGGAAT 3'
MDM2hsa-miR-1255bbeg:346end:357pic:3' TTGGTGAAAGAAACGAGTAGGC 5'& |||||||| &5' -------------GCTCATCC- 3'
MDM2hsa-miR-1255abeg:346end:358pic:3' TTAGATGAAAGAAACGAGTAGGA 5'& ||||||||| &5' --------------GCTCATCCT 3'
MDM2hsa-miR-1827beg:529end:545pic:3' TAAGTTAGATGACGGAGT 5'& ||| || ||||||| &5' ---CAAGCT-CTGCCTC- 3'
MDM2hsa-miR-1827beg:554end:572pic:3' TAAGTTAGATGACGGAGT 5'& || ||| |||||||| &5' ---CATTCTCCTGCCTCA 3'
MDM2ebv-miR-BART20-5pbeg:45end:67pic:3' CCTTACTTCTGTA------CGGACGAT 5'& |.||||| ||||||| &5' ------AGGACATCTTATGGCCTGCT- 3'
MDM2ebv-miR-BART5starbeg:509end:530pic:3' TC-CACTTGTCGCCGGGTG 5'& .| |||| | .|||.||| &5' GGCGTGATCT-TGGCTCAC 3'
MDM2hsa-miR-323b-5pbeg:204end:222pic:3' ACGCTTGAGTGGTGCCTGTTGGA 5'& |||.|.| |||||||| &5' ---GAATTTA-----GACAACCT 3'
MDM2hsa-miR-149starbeg:528end:547pic:3' CGTGTCGGGGGCAGGGAGGGA 5'& ||| |||.|. |||||| &5' GCA-AGCTCTG---CCTCCC- 3'
MDM2hsa-miR-149starbeg:550end:579pic:3' CGTGTC--GGGGGC--AG--GGAGGGA 5'& |||| |.||.| || |||||| &5' GCACCATTCTCCTGCCTCAGCCTCCC- 3'
MDM2hsa-miR-149starbeg:693end:713pic:3' CGTGTCGGG-GGCAG--GGAGGGA 5'& |||| || || |||||| &5' -----GCCCACC-TCGGCCTCCC- 3'
MDM2hcmv-miR-UL70-3pbeg:560end:579pic:3' GGCGCGCGGTCGGGTAGGGG 5'& || .|| .||||| |||| &5' CC-TGCCTCAGCC--TCCC- 3'
MDM2hsa-let-7abeg:554end:572pic:3' TTGATATGTTGGATGATGGAGT 5'& || || ||.||||| &5' -------CATTCTCCTGCCTCA 3'
MDM2hsa-let-7abeg:251end:261pic:3' TTGATATGTTGGATGATGGAGT 5'& |.||||| &5' ---------------TGCCTCA 3'
MDM2hsa-let-7abeg:520end:545pic:3' TTGAT--ATGTTGGATGATGGAGT 5'& ..|| |.||| || ||.|||| &5' GGCTCACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7bbeg:549end:572pic:3' TTGGTGTGTT-GGATGATGGAGT 5'& .|.||| .|| ||.||||| &5' --TCGCACCATTCTCCTGCCTCA 3'
MDM2hsa-let-7bbeg:520end:545pic:3' TTG-GTG-TGTTGGATGATGGAGT 5'& ..| ||| .||| || ||.|||| &5' GGCTCACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7cbeg:552end:572pic:3' TTGGTATGTTGGATGATGGAGT 5'& ||||| .|| ||.||||| &5' -ACCAT----TCTCCTGCCTCA 3'
MDM2hsa-let-7cbeg:523end:545pic:3' TTGGT-ATGTTGGATGATGGAGT 5'& .|| |.||| || ||.|||| &5' --TCACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7dbeg:520end:545pic:3' TTGAT--ACGTTGGATGATGGAGA 5'& ..|| ||||| || ||.|||| &5' GGCTCACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7dbeg:550end:571pic:3' TTGATACGTT---GGATGATGGAGA 5'& ||| .|| ||.|||| &5' ------GCACCATTCTCCTGCCTC- 3'
MDM2hsa-let-7ebeg:527end:545pic:3' TTGATATGTTGGAGGATGGAGT 5'& |.||| || ||.|||| &5' -----TGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7ebeg:554end:572pic:3' TTGATATGTTGGAGGATGGAGT 5'& || |||||.||||| &5' -------CATTCTCCTGCCTCA 3'
MDM2hsa-let-7fbeg:527end:545pic:3' TTGATATGTTAGATGATGGAGT 5'& |.||| || ||.|||| &5' -----TGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7fbeg:554end:572pic:3' TTGATATGTTAGATGATGGAGT 5'& || ||| ||.||||| &5' -------CATTCTCCTGCCTCA 3'
MDM2hsa-let-7gbeg:527end:545pic:3' TTGACATGTTTGATGATGGAGT 5'& |.|||.|| ||.|||| &5' -----TGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7gbeg:554end:572pic:3' TTGACATGTTTGATGATGGAGT 5'& || || ||.||||| &5' -------CATTCTCCTGCCTCA 3'
MDM2hsa-let-7gbeg:242end:261pic:3' TTGACATGTTTGATGATGGAGT 5'& ||. .|| |.||||| &5' ----GTGAGAAAA--TGCCTCA 3'
MDM2hsa-let-7ibeg:524end:545pic:3' TTGTCGTGTTTGATGATGGAGT 5'& || .|||.|| ||.|||| &5' --CACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-let-7ibeg:550end:572pic:3' TTGTCGT-GTTTGATGATGGAGT 5'& ||| || || ||.||||| &5' ----GCACCATTCTCCTGCCTCA 3'
MDM2hsa-miR-103-2starbeg:61end:86pic:3' GTTCCGTCGTG-ACAT--TTCTTCGA 5'& || .|| |||. |||||||| &5' ----GCTTTACATGTGCAAAGAAGCT 3'
MDM2hsa-miR-10bbeg:629end:649pic:3' GTGTTTAAGCCAAGA-TGTCCCAT 5'& || || ||||||| &5' ------TTTAGTAGAGACAGGGT- 3'
MDM2hsa-miR-1183beg:563end:598pic:3' ACGG-GTGAGAGTGGT-------AGTGGATGTCAC 5'& ||| || ||| ||| | .|||||||| &5' -GCCTCAGCCTC-CCAATTAGCTTGGCCTACAGT- 3'
MDM2hsa-miR-1203beg:509end:528pic:3' CTCG-ACGTAGGACCGAGGCCC 5'& .|| || |||.|||||| &5' -GGCGTG-ATCTTGGCTC---- 3'
MDM2hsa-miR-1205beg:522end:542pic:3' GAGTTTCGTTTGGGACGTCT 5'& |||| ||||.|.|||| &5' CTCACTGCAAGCTCTGC--- 3'
MDM2hsa-miR-1206beg:724end:739pic:3' CGAATTTGTAGATGTACTTGT 5'& ||| .|||||.| &5' ------ACAG--GCATGAGC- 3'
MDM2hsa-miR-1224-5pbeg:535end:557pic:3' GGTGGAGGGCTCAGGAGTG 5'& | |||||||.||.| ||| &5' CTGCCTCCCGGGTTCGCAC 3'
MDM2hsa-miR-1224-5pbeg:671end:689pic:3' GGTGGAGGGCTCAGGAGTG 5'& | |.||||.|| |||| &5' CGATCTCCTGA--CCTC-- 3'
MDM2hsa-miR-1228starbeg:681end:702pic:3' GTGTGTGGA-CGG-GGGCGGGTG 5'& |||| |. .|||||||| &5' -----ACCTCGTGATCCGCCCAC 3'
MDM2hsa-miR-1233beg:633end:651pic:3' GACGCCCTCCTGTCCCGAGT 5'& |. || |||||||.|. &5' --GTA-GA-GACAGGGTTT- 3'
MDM2hsa-miR-1253beg:267end:282pic:3' ACGTCCGACTAGAAGAAGAGA 5'& |||. |||||||| &5' --------GATT-TCTTCTCT 3'
MDM2hsa-miR-1254beg:525end:552pic:3' TGACGTCCGAGGTCGAAGGTCCGA 5'& |||||| ||||. || ||.||.| &5' ACTGCAAGCTCTGCCTCCCGGGTT 3'
MDM2hsa-miR-1257beg:214end:235pic:3' CCAGTCTTGGGT----AGTAAGTGA 5'& ||||. |.|||||| &5' ------AACCTGAAATTTATTCAC- 3'
MDM2hsa-miR-125b-1starbeg:568end:593pic:3' TC-GAGGGTTC-TCGGATTGGGCA 5'& || ||||||| |||.|..||. &5' AGCCTCCCAATTAGCTTGGCCT-- 3'
MDM2hsa-miR-1262beg:477end:498pic:3' TAGGAAGATGTTTAAGTGGGTA 5'& .||.| || | |.||||| &5' GTCTTGCT-CTG--TTACCCA- 3'
MDM2hsa-miR-1273beg:469end:497pic:3' TTCTTTCTCAGAACGAAACAGCGGG 5'& .||| |||||||||| ||| ||| &5' GAGACCGAGTCTTGCTCTGTTACCC 3'
MDM2hsa-miR-1273dbeg:525end:553pic:3' TGACGTCGGAGTTGGAGTACCCAAG 5'& |||||| ||| .|||| |||||| &5' ACTGCAAGCTCTGCCTCCCGGGTTC 3'
MDM2hsa-miR-1285beg:642end:668pic:3' TCCAGAGTGAAACAA-CGGGTCT 5'& .|||.|||| |||| ||| .|| &5' GGGTTTCACCGTGTTAGCCAGGA 3'
MDM2hsa-miR-1295beg:574end:594pic:3' AGTGGGTCTAGACG--CCGGATT 5'& |||| ||. || |||||| &5' ---CCCA-ATTAGCTTGGCCTA- 3'
MDM2hsa-miR-138-2starbeg:295end:317pic:3' TTGGGACCACAGCACTTTATCG 5'& ||..|||| |||.|||||. &5' -ACTTTGGTA--GTGGAATAGT 3'
MDM2hsa-miR-142-3pbeg:512end:534pic:3' AGGTATTTCATCCTTTGTGATGT 5'& |.|.| || ||||.|| &5' --CGTGATCTTGGCT-CACTGCA 3'
MDM2hsa-miR-146b-3pbeg:636end:649pic:3' GGTCTTGACTCAGGTGTCCCGT 5'& ||| ||||||. &5' --------GAG---ACAGGGT- 3'
MDM2hsa-miR-148abeg:20end:33pic:3' TGTTTCAAGACATC-ACGTGACT 5'& |.| ||||.|| &5' -----------TGGTTGCATTG- 3'
MDM2hsa-miR-150starbeg:485end:509pic:3' GACAGGGGGTCCGGA--CATGGTC 5'& |||| |||||||. ||.| &5' CTGTTACCCAGGCTGGAGTGC--- 3'
MDM2hsa-miR-150starbeg:535end:559pic:3' GACAGGGGGTCCGGACATGGTC 5'& ||| |.|||.||. | |||| &5' CTGCCTCCCGGGTTCGCACCA- 3'
MDM2hsa-miR-15astarbeg:652end:674pic:3' ACTCCGTCGTGTTATACCGGAC 5'& | | .||| ||. ||||.|| &5' -GTGTTAGC-CAGGATGGTCT- 3'
MDM2hsa-miR-15astarbeg:43end:65pic:3' ACTCCGTCGTGTT--ATACCGGAC 5'& ||| ||| ||||||||| &5' -----CAGGACATCTTATGGCCTG 3'
MDM2hsa-miR-184beg:387end:398pic:3' TGGGAATAGTCAAGAGGCAGGT 5'& |||.|||. &5' -------------CTCTGTCT- 3'
MDM2hsa-miR-187beg:713end:737pic:3' GGC-CGACGTT-GTGTTCTGTGCT 5'& | |||| .| .|| ||.||.|| &5' --GTGCTGGGATTAC-AGGCATGA 3'
MDM2hsa-miR-1909beg:550end:568pic:3' GCCACTCGTGGGCCGGGGACGC 5'& ||||| |.||||| &5' ------GCACCATTCTCCTGC- 3'
MDM2hsa-miR-190bbeg:221end:243pic:3' TTGGGTTATAGTTTGTATAGT 5'& ||...| ||| |.|||||| &5' AATTTAT--TCACATATATCA 3'
MDM2hsa-miR-196bstarbeg:499end:524pic:3' CTTC-CGTCACAGCACGACAGCT 5'& |.|| |||||| |||| |.|. &5' GGAGTGCAGTGGCGTGATCTTGG 3'
MDM2hsa-miR-19astarbeg:24end:47pic:3' ACATCACGTTGATA----CGTTTTGA 5'& |||| ||||||| &5' -----TGCATTGTCCATGGCAAAAC- 3'
MDM2hsa-miR-202beg:556end:577pic:3' AAGGGTACGGGATATGGAGA 5'& |||.| ||||. .|||| &5' TTCTCCTGCCTCA-GCCTC- 3'
MDM2hsa-miR-2052beg:25end:47pic:3' TGTAATGACAATAGTTTTGT 5'& .||||. ||||||| &5' GCATTGTCCATGGCAAAACA 3'
MDM2hsa-miR-205starbeg:204end:228pic:3' CTTGAAG-TGAGGTGACTTTAG 5'& |||.|| || | |||||||. &5' GAATTTAGACAAC-CTGAAATT 3'
MDM2hsa-miR-206beg:261end:285pic:3' GGTGTGTG-AAGGAATGTAAGGT 5'& ||||.| ||.||| | |..| &5' -CACATAGATTTCTT-CTCTTTA 3'
MDM2hsa-miR-20astarbeg:496end:512pic:3' GAAATTCACGAGTATTACGTCA 5'& ||| . |.|||||| &5' --------GCTGG-AGTGCAGT 3'
MDM2hsa-miR-20bstarbeg:711end:730pic:3' GACCTTCACGGGTATGATGTCA 5'& ||||||. . |.||||| &5' ----AAGTGCTGGGATTACAG- 3'
MDM2hsa-miR-2114beg:707end:728pic:3' CTGGCGAAGTTC-CTTCCCTGAT 5'& || | ||| | ||||.|| &5' --CC-CA--AAGTGCTGGGATTA 3'
MDM2hsa-miR-2117beg:161end:180pic:3' GACAGGAACCGTTTCTCTTGT 5'& |||||. |||||||. &5' CTGTCTAT----AAGAGAAT- 3'
MDM2hsa-miR-214starbeg:711end:734pic:3' CGTGTCGTTCAC-ATC----TGTCCGT 5'& ||||| |.| ||||||| &5' -------AAGTGCTGGGATTACAGGCA 3'
MDM2hsa-miR-216abeg:703end:728pic:3' AGTGTCAACGGT--------CGACTCTAAT 5'& ||| ||||.||||| &5' --------GCCTCCCAAAGTGCTGGGATTA 3'
MDM2hsa-miR-217beg:493end:513pic:3' AGGTTAGTCAAGGAC--TACGTCAT 5'& ||| ||| .||||||. &5' ------CAGG--CTGGAGTGCAGTG 3'
MDM2hsa-miR-218-1starbeg:727end:741pic:3' GGTACCACGAACTGC-CTTGGTA 5'& |.| ||.||| &5' -----------GGCATGAGCCA- 3'
MDM2hsa-miR-25beg:493end:513pic:3' AGTCTGGCTCTGTTCACGTTAC 5'& |||.|.| .||||||.|| &5' -CAGGCTG----GAGTGCAGTG 3'
MDM2hsa-miR-25starbeg:521end:544pic:3' GTTAACGGGT-----TCAGAGGCGGA 5'& ||.|| || |||.|||| &5' -----GCTCACTGCAAG-CTCTGCCT 3'
MDM2hsa-miR-26abeg:391end:416pic:3' TCGGATAGGAC---CTA---ATGAACTT 5'& ||.||.| || ||||||. &5' ---CTGTCTTAAATGAGAAGTACTTGG- 3'
MDM2hsa-miR-26bbeg:393end:416pic:3' TGGATAGGACTTA--ATGAACTT 5'& |.|| |||. ||||||. &5' -CTTAAA-TGAGAAGTACTTGG- 3'
MDM2hsa-miR-2861beg:691end:711pic:3' GGCGGGTGGCGGTCCGGGG 5'& ||||||||| .| ||||.| &5' CCGCCCACC-TC-GGCCTC 3'
MDM2hsa-miR-299-3pbeg:251end:270pic:3' TTCGCCAAATGGTA--GGGTGTAT 5'& |.|| ..|||||| &5' --------TGCCTCAATTCACATA 3'
MDM2hsa-miR-302abeg:398end:415pic:3' AGTGGTTTTGTAC-CTTCGTGAAT 5'& ||| ||||.||||. &5' ----------ATGAGAAGTACTTG 3'
MDM2hsa-miR-302cbeg:387end:415pic:3' GGTGACTTTG--TAC-CTTCGTGAAT 5'& | ||| ||| ||||.||||. &5' -CTCTGTCTTAAATGAGAAGTACTTG 3'
MDM2hsa-miR-302cstarbeg:637end:661pic:3' GTC-GTCCATGGG-GGTACAATTT 5'& || |||| ..| ||.|||||. &5' -AGACAGGGTTTCACCGTGTTAG- 3'
MDM2hsa-miR-30astarbeg:526end:549pic:3' CGACGTTTGTAGGCTGACTTTC 5'& ||||||.| ||.| || .| &5' -CTGCAAGC-TCTGCCTCCCGG 3'
MDM2hsa-miR-30bstarbeg:530end:549pic:3' CTTCATTTGTAGGTGGAGGGTC 5'& ||.| || ||||||.| &5' -----AAGC-TCTGCCTCCCGG 3'
MDM2hsa-miR-30c-1starbeg:563end:580pic:3' CCTCATTTGTTGGGA---GAGGGTC 5'& .||. |||||| &5' ----------GCCTCAGCCTCCCA- 3'
MDM2hsa-miR-30c-2starbeg:563end:580pic:3' TCTCATTTGTCGGAA---GAGGGTC 5'& |||| |||||| &5' ----------GCCTCAGCCTCCCA- 3'
MDM2hsa-miR-31beg:471end:488pic:3' TCGATAC-GGTCGTAGAACGGA 5'& | ||. .||||||. &5' ------GACCGA-GTCTTGCT- 3'
MDM2hsa-miR-3130-3pbeg:562end:586pic:3' AATGG-GTCAGAGGCCACGTCG 5'& |.|| ||| |||| .||| &5' -TGCCTCAGCCTCCCAATTAGC 3'
MDM2hsa-miR-3136beg:581end:600pic:3' TTACTGGGATGGATAAGTCAGTC 5'& .|. .|||| |||||| &5' ----GCTTGGCCTA--CAGTCA- 3'
MDM2hsa-miR-3138beg:525end:556pic:3' TGAGG---GAGATGGAGTGA-CAGGTGT 5'& ||| | ||||.|||| | ||.|.|| &5' ACTGCAAGCTCTGCCTCCCGGGTTCGCA 3'
MDM2hsa-miR-3138beg:555end:580pic:3' TGAGGGAGATGGAGTGACAGGTGT 5'& |.||.| ||.||||| ||| || &5' ATTCTC-CTGCCTCAGCCTCC-CA 3'
MDM2hsa-miR-3141beg:559end:579pic:3' AGGA-GGAGGTGGGCGGGAG 5'& |||| |||| .||. ||| &5' TCCTGCCTCAGCCT-CCC-- 3'
MDM2hsa-miR-3143beg:638end:661pic:3' GCTTTCTTCGCGAAATGTTACAATA 5'& ||.| |.| |.|| || .||||| &5' -GAGACAGG-GTTTCACCGTGTTA- 3'
MDM2hsa-miR-3147beg:551end:575pic:3' AGTGTGGGAGGAGTGACGG-GTTGG 5'& |.|||| |.||| ||||| ||.|| &5' -CGCACCATTCTC-CTGCCTCAGCC 3'
MDM2hsa-miR-3148beg:403end:424pic:3' TTCGTGTGTGGTCAAAAAAGGT 5'& |||.|| . |||||||.. &5' AAGTAC---TTGGTTTTTTTT- 3'
MDM2hsa-miR-3170beg:185end:207pic:3' TGACAGACAGAGTC-TTGGGGTC 5'& ||| || |||||.|| &5' ----TCTAACTATATAACCCTAG 3'
MDM2hsa-miR-3171beg:226end:242pic:3' CTATATATGTCTAAG-GTATGTAGA 5'& |||| ||||.||| &5' -----------ATTCACATATATC- 3'
MDM2hsa-miR-3172beg:189end:206pic:3' ATTCCTGACGTTTTGGGGT 5'& ||| .| |||||.| &5' -----ACTATATAACCCTA 3'
MDM2hsa-miR-3174beg:520end:547pic:3' CCGAG--ACGTA-GAGATTGAGTGAT 5'& ||||| |||| ||||. ||| | &5' GGCTCACTGCAAGCTCTGCCTCCC-- 3'
MDM2hsa-miR-3180-3pbeg:520end:545pic:3' CCGGA-GGCCTTCGAGGCGGGGT 5'& |||. |.| ||||||.|||.| &5' GGCTCACTGCAAGCTCTGCCTC- 3'
MDM2hsa-miR-3182beg:520end:537pic:3' CTGATGTGATGTCTTCG 5'& |.|| ||||.|| ||| &5' GGCT-CACTGCA--AGC 3'
MDM2hsa-miR-3187beg:600end:621pic:3' GGCGCGTCGG---GGTACCGGTT 5'& |.|| || || || ||||.|| &5' CTGC-CA-CCACACC-TGGCTAA 3'
MDM2hsa-miR-3187beg:691end:709pic:3' GGCGCGTCGGGGTACCGGTT 5'& |||| || ||.| |||| &5' CCGCCCA-CCTC--GGCC-- 3'
MDM2hsa-miR-3192beg:526end:550pic:3' AAGGTGACGA-TGT--TGGAGGGTCT 5'& |||||| .| .||||||.|. &5' ---CACTGCAAGCTCTGCCTCCCGGG 3'
MDM2hsa-miR-31starbeg:25end:43pic:3' TACCGTTATACAACCGTATCGT 5'& ||| ||| |||.||| &5' ---GCAT--TGTC--CATGGCA 3'
MDM2hsa-miR-320ebeg:553end:574pic:3' GG-AAGAGT-TGG-GTCGAAA 5'& || ||||| .|| |||| &5' CCATTCTCCTGCCTCAGC--- 3'
MDM2hsa-miR-32beg:502end:513pic:3' ACGTTGAATCATTACACGTTAT 5'& |||||.|. &5' --------------GTGCAGTG 3'
MDM2hsa-miR-330-5pbeg:716end:738pic:3' CGGATTCT-GTGTCCGGGTCTCT 5'& ||..|| .|||||| ||| &5' --CTGGGATTACAGGCAT-GAG- 3'
MDM2hsa-miR-338-3pbeg:709end:724pic:3' GTTGTTTTAGTGACTACGACCT 5'& || .||||||. &5' ---------CAAA-GTGCTGGG 3'
MDM2hsa-miR-339-5pbeg:627end:648pic:3' GCACTCGAGGACC-TC-CTGTCCCT 5'& ||..| | || ||||||| &5' ------CTTTTAGTAGAGACAGGG- 3'
MDM2hsa-miR-363beg:493end:512pic:3' ATGTCT-ACCTATGGCACGTTAA 5'& |||. |||| |||||.| &5' --CAGGCTGGA----GTGCAGT- 3'
MDM2hsa-miR-363starbeg:679end:700pic:3' TTTAAC-GTAGCACTAGGTGGGC 5'& || | |||||||||.||| &5' ----TGACCTCGTGATCCGCCC- 3'
MDM2hsa-miR-367beg:489end:512pic:3' AGTGGTAACGATTTCACGTTAA 5'& |.||| |||..||||||.| &5' TTACCCAGGCTGGAGTGCAGT- 3'
MDM2hsa-miR-377starbeg:555end:577pic:3' CTTAAGTGGTTCCCGTTGGAGA 5'& |||| || ||.|||| &5' --ATTCTCCTGCCTCAGCCTC- 3'
MDM2hsa-miR-378bbeg:700end:723pic:3' AAGACGGAGG--TTCA-GGTCA 5'& || |||||| |||| | | &5' -TCGGCCTCCCAAAGTGCTGG- 3'
MDM2hsa-miR-378bbeg:534end:553pic:3' AAGACGGA-GGTTCAGGTCA 5'& ||||||| ||..||.| &5' -TCTGCCTCCCGGGTTC--- 3'
MDM2hsa-miR-379beg:587end:607pic:3' GGATGCAAGGTATCAGATGGT 5'& ||||| || |||.||| &5' CCTACAGTCA----TCTGCCA 3'
MDM2hsa-miR-423-5pbeg:666end:689pic:3' TTTCAGAGCGAGA-GACGGGGAGT 5'& .|||||| ||| ||| |||| &5' --GGTCTCGATCTCCTGA-CCTC- 3'
MDM2hsa-miR-4253beg:537end:558pic:3' TGGGGGACCTGTACG-GGA 5'& .||.|| ||. || || &5' GCCTCCCGGGTTCGCACC- 3'
MDM2hsa-miR-4253beg:693end:713pic:3' TGGG-GGACCTGTACGGGA 5'& .||| ||| |.| ||| &5' GCCCACCTCGGCCT-CCC- 3'
MDM2hsa-miR-4253beg:490end:509pic:3' TGGGG--GACCTGTACGGGA 5'& |||| ||||| .||| &5' ACCCAGGCTGGA-GTGC--- 3'
MDM2hsa-miR-425starbeg:666end:685pic:3' CCCGCCTGTGCTGTAAGGGCTA 5'& || | |||. |||.|| &5' ----GGTCTCGATC-TCCTGA- 3'
MDM2hsa-miR-4260beg:558end:572pic:3' ACCCTGAGGTACGGGGTTC 5'& |||| ||||.||. &5' -----CTCC-TGCCTCAG- 3'
MDM2hsa-miR-4265beg:491end:510pic:3' GGGTCTCGA-CTCGGGTGTC 5'& ||||| ||| |||. || &5' CCCAG-GCTGGAGTGCA--- 3'
MDM2hsa-miR-4267beg:486end:505pic:3' CACGGTGGC-TCGACCT 5'& ||..||| .|||||| &5' -TGTTACCCAGGCTGGA 3'
MDM2hsa-miR-4270beg:667end:693pic:3' CGGG---AGGGGACTGAGGGACT 5'& |.|. ||.|||||| | ||| &5' GTCTCGATCTCCTGACCTCGTGA 3'
MDM2hsa-miR-4273beg:161end:180pic:3' GACAGGTAGTCTCTTGTG 5'& |||||.|| ||||||. &5' CTGTCTATAAGAGAAT-- 3'
MDM2hsa-miR-4281beg:535end:555pic:3' GGGGGGAGGGGCCCTGGG 5'& |. |||||| || | | &5' -CTGCCTCCCGGGTTCGC 3'
MDM2hsa-miR-4281beg:560end:579pic:3' GGGGGGAGG-GGCCCTGGG 5'& ||. |||| || ||| &5' CCTGCCTCAGCCT---CCC 3'
MDM2hsa-miR-4281beg:691end:713pic:3' GGGGGGAGGGGCCCT-GGG 5'& || ||| ||.||| ||| &5' CCGCCCACCTCGGCCTCCC 3'
MDM2hsa-miR-4288beg:718end:734pic:3' CCTTTGAGTCGTCTGTT 5'& | |.| |||.|| &5' -GGGATTA--CAGGCA- 3'
MDM2hsa-miR-4294beg:104end:125pic:3' GGGACG-ACATCTGAGGG 5'& ||| |. ||||||| || &5' CCCAGTATGTAGACAACC 3'
MDM2hsa-miR-4296beg:468end:487pic:3' ACTC-GGACTC-GGGTGTA 5'& |||| || ||| |. | &5' TGAGACC-GAGTCTTGC-- 3'
MDM2hsa-miR-4296beg:580end:596pic:3' ACTCGGACTCGGGTGTA 5'& |||.|| |||.||| &5' --AGCTTG-GCCTACA- 3'
MDM2hsa-miR-4297beg:723end:739pic:3' GTGTCTGTCCTTCCGT 5'& .||||.|| || || &5' TACAGGCATGA--GC- 3'
MDM2hsa-miR-4303beg:561end:577pic:3' GACAGGAGTC-GAGTCTT 5'& ||| |||||| ||| &5' CTG-CCTCAGCCTC---- 3'
MDM2hsa-miR-4307beg:86end:103pic:3' CCTTTGTCCTTTTTTGTAA 5'& |||| ||||| ||.| &5' -GAAA-AGGAATAAGC--- 3'
MDM2hsa-miR-4311beg:261end:284pic:3' GTGTG---AGTCGAGAGAAAG 5'& ||||. |. .||||||| &5' CACATAGATTTCTTCTCTTT- 3'
MDM2hsa-miR-4322beg:581end:597pic:3' GGGGTGCGCGACTCGGGTGTC 5'& ||| .|||.|||| &5' --------GCTTGGCCTACAG 3'
MDM2hsa-miR-4322beg:707end:730pic:3' GGGGTG-CGCGACTCGGGTGTC 5'& |||| |.||||.| ..|||| &5' -CCCAAAGTGCTGGGATTACAG 3'
MDM2hsa-miR-4325beg:489end:510pic:3' AGTGACTCTG--TTCACGTT 5'& |.|| ||.| .||||||. &5' TTACCCAGGCTGGAGTGCAG 3'
MDM2hsa-miR-4327beg:522end:538pic:3' GGTCAGGGGGT-ACGTTCGG 5'& |.|| |||||||. &5' -------CTCACTGCAAGCT 3'
MDM2hsa-miR-448beg:423end:439pic:3' TACCCTGTAGGATGTATACGTT 5'& ||.|| |||||.| &5' --------TCTTAAATATGTA- 3'
MDM2hsa-miR-449cstarbeg:493end:515pic:3' TGTCTCTCCTCACGTTGATCGTT 5'& |||. ||||||||. |.|| &5' -CAGGCTGGAGTGCAG-TGGC-- 3'
MDM2hsa-miR-486-3pbeg:525end:545pic:3' TAG-GACA--TGACTCGACGGGGC 5'& || ||| .|| |||||.| &5' -TCACTGCAAGCT---CTGCCTC- 3'
MDM2hsa-miR-486-3pbeg:553end:571pic:3' TAGGACATGACTCGACGGGGC 5'& || || |||||.| &5' --CCATT-CTC--CTGCCTC- 3'
MDM2hsa-miR-490-3pbeg:528end:552pic:3' GTCGTACCTCA-GGA-GGTCCAAC 5'& ||| ||| ||.|||| &5' --GCAAGCTCTGCCTCCCGGGTT- 3'
MDM2hsa-miR-493beg:582end:603pic:3' GGACCGTGTGTCATCTGGAAGT 5'& |.|||| .||||| |.|| &5' CTTGGCCTACAGTC-ATCT--- 3'
MDM2hsa-miR-493starbeg:56end:79pic:3' TTACTTTCGGATG----GTACATGTT 5'& .||||.| |||||.||| &5' ------GGCCTGCTTTACATGTGCAA 3'
MDM2hsa-miR-499-5pbeg:474end:485pic:3' TTTGTAGTGACGTTCAGAATT 5'& |.||||||. &5' -----------CGAGTCTTG- 3'
MDM2hsa-miR-499-5pbeg:520end:540pic:3' TTTGTAGTGACGTTC-AGAATT 5'& ..| |||||||||| ||| &5' -GGC-TCACTGCAAGCTCT--- 3'
MDM2hsa-miR-500beg:705end:728pic:3' AGAGTGGGTCCATCGTTCCTAAT 5'& ||| || || || .|||||| &5' -CTC-CCAAAGT-GCTGGGATTA 3'
MDM2hsa-miR-508-3pbeg:581end:600pic:3' AGATGAGGTTTTCC-GATGTTAGT 5'& .||. || |||||.||| &5' ---GCTT-----GGCCTACAGTCA 3'
MDM2hsa-miR-519abeg:614end:634pic:3' TGTGAGATTTTCCTACGTGAAA 5'& |||| ||.||||| &5' -----CTAATTTTTTGTACTTT 3'
MDM2hsa-miR-520a-3pbeg:394end:414pic:3' TGTCAGGTTTCC-CTTCGTGAAA 5'& ..||| | ||||.|||| &5' -----TTAAATGAGAAGTACTT- 3'
MDM2hsa-miR-520d-5pbeg:612end:630pic:3' CTTTCCCGAA-GGGAAACATC 5'& |||| ...|||||| &5' -----GGCTAATTTTTTGTA- 3'
MDM2hsa-miR-520ebeg:392end:414pic:3' GGGAGTTTTTCCTTCGTGAAA 5'& .||.||| ||||.|||| &5' -TCTTAAATGAGAAGTACTT- 3'
MDM2hsa-miR-541beg:682end:703pic:3' TCAGGTCTAAGACACGGGTGGT 5'& || .| ||||||| &5' ---CCTCGTGATCCGCCCACC- 3'
MDM2hsa-miR-542-3pbeg:477end:495pic:3' AAAGTCAATAGTT--AGACAGTGT 5'& .|| |||||.|| &5' --------GTCTTGCTCTGTTAC- 3'
MDM2hsa-miR-548d-3pbeg:401end:421pic:3' CGTTTTCTTTGACACCAAAAAC 5'& |.||| ||| |||||||| &5' --AGAAGT-ACT-TGGTTTTT- 3'
MDM2hsa-miR-548jbeg:708end:729pic:3' TGGTTTC-TGGCGTTAATGAAAA 5'& |||||| .|.| .||||| &5' -CCAAAGTGCTGGGATTAC---- 3'
MDM2hsa-miR-557beg:57end:80pic:3' TCTGTTCCGGGTGG-----GCACGTTTG 5'& |||| |. .||||||| &5' ------GGCCTGCTTTACATGTGCAAA- 3'
MDM2hsa-miR-564beg:57end:77pic:3' CGGACGACTGTG-GCACGGA 5'& ||||||| .|| .|||| &5' GCCTGCTT-TACATGTGC-- 3'
MDM2hsa-miR-564beg:644end:660pic:3' CGGACGACTGTGGCACGGA 5'& |.| |||||||.. &5' ----GTTT-CACCGTGTT- 3'
MDM2hsa-miR-583beg:267end:284pic:3' CATTACCCTGGA-AGGAGAAAC 5'& ||..| |.|||||| &5' -------GATTTCTTCTCTTT- 3'
MDM2hsa-miR-586beg:10end:32pic:3' CCTGGATTTTTATGTTACGTAT 5'& |||||||||||. ||||| &5' -GACCTAAAAATGGT-TGCAT- 3'
MDM2hsa-miR-588beg:603end:621pic:3' CAAGATTGG-GTAACACCGGTT 5'& ||| || ||||.|| &5' ------ACCACACC-TGGCTAA 3'
MDM2hsa-miR-589beg:400end:421pic:3' GAGTCTCGTC-TGCACCAAGAGT 5'& ||| || || |||||.|. &5' ----GAGAAGTACTTGGTTTTT- 3'
MDM2hsa-miR-608beg:686end:705pic:3' TGCCTCGACAGGGTTGTGGTGGGGA 5'& |. ||| .| |||||.| &5' -----GTGATCC--GC-CCACCTC- 3'
MDM2hsa-miR-610beg:334end:354pic:3' AGGGTCGTGTGTAAATCGAGT 5'& |. | |.|| ||||||| &5' --CTTGA--ATATGTAGCTCA 3'
MDM2hsa-miR-612beg:89end:113pic:3' TTCCTCGAGTCTTCGGGACGGGTCG 5'& ||||| |||||||||||||. &5' AAGGAAT----AAGCCCTGCCCAGT 3'
MDM2hsa-miR-622beg:482end:503pic:3' CGAGGT--TGGAGTCGTCTGACA 5'& ||||. ||| |||.||| &5' GCTCTGTTACC----CAGGCTG- 3'
MDM2hsa-miR-625beg:137end:157pic:3' CCTGATATCTTGAAAGGGGGA 5'& .||| |||||||. &5' --GCTAACTTA-TTTCCCCT- 3'
MDM2hsa-miR-631beg:531end:552pic:3' CGACTCCAGACCC--GGTCCAGA 5'& || |||| ||.|||. &5' ----AGCTCTGCCTCCCGGGTT- 3'
MDM2hsa-miR-632beg:99end:122pic:3' AGGGT---GTCCTTCGTCTGTG 5'& ||| ||| |.||||| &5' -CCCTGCCCAGTATGTAGACA- 3'
MDM2hsa-miR-650beg:526end:546pic:3' CAGGACTCTCGCGACGGAGGA 5'& ||| ||| |||||||| &5' ---CTGCAAGCTCTGCCTCC- 3'
MDM2hsa-miR-654-3pbeg:713end:736pic:3' TTCCACTACCAGTC-GTCTGTAT 5'& ||| ||| |||.|||. &5' ---GTGCTGGGATTACAGGCATG 3'
MDM2hsa-miR-654-5pbeg:683end:703pic:3' CGTGTACAAGACGCCGGGTGGT 5'& | |.|| || ||||||| &5' -CTCGTGATCC---GCCCACC- 3'
MDM2hsa-miR-663beg:521end:544pic:3' CGCC-AG-GGCGCCGCGGGGCGGA 5'& || || |.|| ||.|.|||| &5' --GGCTCACTGCAA-GCTCTGCCT 3'
MDM2hsa-miR-664starbeg:645end:666pic:3' TAGGTTAGTAAAAG-GG----ATCGGTCA 5'& |||| || ||||||| &5' ----------TTTCACCGTGTTAGCCAG- 3'
MDM2hsa-miR-665beg:661end:684pic:3' TCC--CCGGAGTCGGAGGACCA 5'& ||| ||.|||. |||||| &5' AGGATGGTCTCGATCTCCTG-- 3'
MDM2hsa-miR-665beg:563end:578pic:3' TCCCCGGAGTCGGAGGACCA 5'& |||||||||||| &5' ----GCCTCAGCCTCC---- 3'
MDM2hsa-miR-759beg:373end:396pic:3' CAGTTTTAACAAACGTGAGACG 5'& |.||| ||| .||||||. &5' -TTAAATAA-TTTCTACTCTGT 3'
MDM2hsa-miR-762beg:558end:577pic:3' CGAGCCGGGGCCGGGGTCGGGG 5'& |.|| |||.|||||.| &5' ------CTCCTGCCTCAGCCTC 3'
MDM2hsa-miR-766beg:482end:507pic:3' CGACTCCGACACC----CCGACCTCA 5'& ||| |||| ||||||||| &5' GCT----CTGTTACCCAGGCTGGAGT 3'
MDM2hsa-miR-769-5pbeg:634end:652pic:3' TCGAGTCTTGGGTCTCCAGAGT 5'& .|||. ||| |||.||| &5' ----TAGAGA-CAG-GGTTTCA 3'
MDM2hsa-miR-770-5pbeg:702end:724pic:3' ACCGGGACTGTGCACCATGACCT 5'& ||||. || ||.||||. &5' -GGCCTCC-CAAA--GTGCTGGG 3'
MDM2hsa-miR-876-3pbeg:721end:742pic:3' ACTTAATGAAAC-ATTTGGTGGT 5'& |.||||| |.|.||||| &5' -GGATTACAGGCATGAGCCACC- 3'
MDM2hsa-miR-876-3pbeg:589end:610pic:3' ACTTAATGAAACATT-TGGTGGT 5'& ||| .|||||| &5' -----TACAGTCATCTGCCACCA 3'
MDM2hsa-miR-891bbeg:10end:31pic:3' AGTTACTGAGTCCAT-TCAACGT 5'& ||| .|||||| &5' -----GACCTAAAAATGGTTGCA 3'
MDM2hsa-miR-921beg:475end:504pic:3' CTTAGGACCAAGACA--GGGAGTGATC 5'& ||.||.|| ||||| ||| .||.| &5' GAGTCTTGC-TCTGTTACCCAGGCTGG 3'
MDM2hsa-miR-92abeg:493end:513pic:3' TGTCCGGCCCTGTTCACGTTAT 5'& |||||.|| ||||||.|. &5' -CAGGCTGG----AGTGCAGTG 3'
MDM2hsa-miR-92bbeg:494end:513pic:3' CCTCCGGCCCTGCTCACGTTAT 5'& ||||.|| ||||||.|. &5' --AGGCTGG----AGTGCAGTG 3'
MDM2hsa-miR-934beg:105end:122pic:3' GGTCACAGAGGTCAT-CATCTGT 5'& |||||| ||||||| &5' ---------CCAGTATGTAGACA 3'
MDM2hsa-miR-939beg:554end:580pic:3' GTGGGGGTCTCGGAGTCGAGGGGT 5'& ||..|.| |||||||| |||| &5' CATTCTCCT-GCCTCAGCCTCCCA 3'
MDM2hsa-miR-940beg:550end:570pic:3' CCCCTCGCCCCC--GGGACGGAA 5'& || .||||||| &5' -----GCACCATTCTCCTGCCT- 3'
MDM2hsa-miR-940beg:528end:544pic:3' CCCCTCGCCCCCGGGACGGAA 5'& || ||.|||||| &5' -----GCAA--GCTCTGCCT- 3'
MDM2hsa-miR-943beg:580end:600pic:3' GACCTCCTGCCGT-TGTCAGTC 5'& || .||| ||||||| &5' ----AGCTTGGCCTACAGTCA- 3'
MDM2hsa-miR-98beg:524end:545pic:3' TTGTTATGTTGAATGATGGAGT 5'& || |.||| ||.|||| &5' --CACTGCAAGCT-CTGCCTC- 3'
MDM2hsa-miR-98beg:561end:572pic:3' TTGTTATGTTGAATGATGGAGT 5'& ||.||||| &5' --------------CTGCCTCA 3'
MDM2hsv1-miR-H11beg:382end:401pic:3' CGCAAGCGTGAAACAGGATT 5'& ||| .||| ||||.||| &5' ---TTC-TACTCTGTCTTAA 3'
MDM2hsv1-miR-H4beg:521end:543pic:3' ACGAACGGACAGTTTGAGATGG 5'& ||| ||| |||.||||.|| &5' -GCTCA-CTG-CAAGCTCTGCC 3'
MDM2hsv1-miR-H5-5pbeg:562end:579pic:3' CATCTCTACGGGCTTGGGGGGG 5'& ||||. |.||.||| &5' -------TGCCTCAGCCTCCC- 3'
MDM2hsv1-miR-H5-5pbeg:693end:713pic:3' CATCTCTACGGGC----TTGGGGGGG 5'& |||| ..||.||| &5' --------GCCCACCTCGGCCTCCC- 3'
MDM2hsv1-miR-H6-5pbeg:550end:575pic:3' ATGTGG---GGGGACGGAAGGTGG 5'& .|||| |.|||||| || .|| &5' -GCACCATTCTCCTGCC-TCAGCC 3'
MDM2hsv2-miR-H10beg:691end:713pic:3' GGCGGGTGGGGGCGT-GGG 5'& |||||||||.| || ||| &5' CCGCCCACCTCGGCCTCCC 3'
MDM2hsv2-miR-H11beg:382end:401pic:3' TTCGCAAGCGTGAAACAGGATT 5'& ||| .||| ||||.||| &5' -----TTC-TACTCTGTCTTAA 3'
MDM2hsv2-miR-H3beg:694end:716pic:3' GAGGGTTGGCGTCTGAGGGTTT 5'& ||| ||| |.| |||||||| &5' --CCC-ACCTCGGCCTCCCAAA 3'
MDM2hsv2-miR-H3beg:558end:581pic:3' GAGGGTTGGCGTCTGAGGGTTT 5'& ||||. .|| ||| ||||||| &5' CTCCT-GCCTCAGCCTCCCAA- 3'
MDM2hsv2-miR-H4-3pbeg:716end:736pic:3' CTCAAGCGATCC----GTTCGTGCC 5'& |||.|| ||.|||.| &5' ------GCTGGGATTACAGGCATG- 3'
MDM2hsv2-miR-H5beg:532end:547pic:3' CCAGTCCACCGGGCTCGGGGGGG 5'& ||.| |||.||| &5' ---------GCTCT-GCCTCCC- 3'
MDM2hsv2-miR-H5beg:563end:579pic:3' CCAGTCCACCGGGCTCGGGGGGG 5'& |||. ||||.||| &5' ---------GCCTCAGCCTCCC- 3'
MDM2kshv-miR-K12-2beg:577end:598pic:3' GTCTAGCTGGGCCTGATGTCAA 5'& || .|..|| ||||||| &5' ---ATTAGCTTGGCCTACAGT- 3'
MDM2kshv-miR-K12-7beg:708end:728pic:3' CGCGGTCGT-TGTACCCTAGT 5'& ||| .| ||||||.| &5' ---CCAAAGTGC-TGGGATTA 3'
MDM2sv40-miR-S1-3pbeg:626end:647pic:3' TGAGTCCCGTACTTTGTCCG 5'& |||. |.| ||.||||| &5' ACTTTTAGTA-GAGACAGG- 3'
MDM2hsa-miR-1285beg:102end:112pic:3' TCCAGAGTGAAACAACGGGTCT 5'& ||||||| &5' --------------TGCCCAG- 3'
DNA & RNA Element - SomamiR
Gene NameMutationMutation IDmiR IDChromosomeLocationRefAltmirsitemirseedSeed ClassSample NameCancer Type
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268achr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268bchr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-140-5pchr1268809063GAgacgcacACCACTttCAGUGGUUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-147bchr1268809063GAgaCGCACACcactttGUGUGCGGm7aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203a-5pchr1268809063GAgacgcacACCACTttAGUGGUUCm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203b-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-210-3pchr1268809063GAgACGCACAccactttCUGUGCGUm7bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3650chr1268809063GAgacgCACACCactttAGGUGUGUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3677-5pchr1268809063GAgacgcacGCCACTttCAGUGGCCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3688-5pchr1268809063GAgacgcacGCCACTttAGUGGCAAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4455chr1268809063GAgacgCACACCactttAGGGUGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4460chr1268809063GAgacgcacACCACTttAUAGUGGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-5693chr1268809063GAgacgcacGCCACTttGCAGUGGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-648chr1268809063GAgacGCACACcactttAAGUGUGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-6718-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-7978chr1268809063GAgacgcACACCActttUCUGGUGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-891a-3pchr1268809063GAgacgcacGCCACTttAGUGGCACm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-933chr1268809063GAgaCGCACAccactttUGUGCGCAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268achr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268bchr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-140-5pchr1268809063GAgacgcacACCACTttCAGUGGUUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-147bchr1268809063GAgaCGCACACcactttGUGUGCGGm7aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203a-5pchr1268809063GAgacgcacACCACTttAGUGGUUCm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203b-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-210-3pchr1268809063GAgACGCACAccactttCUGUGCGUm7bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3650chr1268809063GAgacgCACACCactttAGGUGUGUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3677-5pchr1268809063GAgacgcacGCCACTttCAGUGGCCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3688-5pchr1268809063GAgacgcacGCCACTttAGUGGCAAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4455chr1268809063GAgacgCACACCactttAGGGUGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4460chr1268809063GAgacgcacACCACTttAUAGUGGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-5693chr1268809063GAgacgcacGCCACTttGCAGUGGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-648chr1268809063GAgacGCACACcactttAAGUGUGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-6718-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-7978chr1268809063GAgacgcACACCActttUCUGGUGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-891a-3pchr1268809063GAgacgcacGCCACTttAGUGGCACm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-933chr1268809063GAgaCGCACAccactttUGUGCGCAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268achr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268bchr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-140-5pchr1268809063GAgacgcacACCACTttCAGUGGUUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-147bchr1268809063GAgaCGCACACcactttGUGUGCGGm7aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203a-5pchr1268809063GAgacgcacACCACTttAGUGGUUCm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203b-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-210-3pchr1268809063GAgACGCACAccactttCUGUGCGUm7bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3650chr1268809063GAgacgCACACCactttAGGUGUGUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3677-5pchr1268809063GAgacgcacGCCACTttCAGUGGCCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3688-5pchr1268809063GAgacgcacGCCACTttAGUGGCAAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4455chr1268809063GAgacgCACACCactttAGGGUGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4460chr1268809063GAgacgcacACCACTttAUAGUGGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-5693chr1268809063GAgacgcacGCCACTttGCAGUGGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-648chr1268809063GAgacGCACACcactttAAGUGUGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-6718-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-7978chr1268809063GAgacgcACACCActttUCUGGUGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-891a-3pchr1268809063GAgacgcacGCCACTttAGUGGCACm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-933chr1268809063GAgaCGCACAccactttUGUGCGCAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268achr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268bchr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-140-5pchr1268809063GAgacgcacACCACTttCAGUGGUUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-147bchr1268809063GAgaCGCACACcactttGUGUGCGGm7aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203a-5pchr1268809063GAgacgcacACCACTttAGUGGUUCm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203b-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-210-3pchr1268809063GAgACGCACAccactttCUGUGCGUm7bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3650chr1268809063GAgacgCACACCactttAGGUGUGUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3677-5pchr1268809063GAgacgcacGCCACTttCAGUGGCCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3688-5pchr1268809063GAgacgcacGCCACTttAGUGGCAAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4455chr1268809063GAgacgCACACCactttAGGGUGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4460chr1268809063GAgacgcacACCACTttAUAGUGGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-5693chr1268809063GAgacgcacGCCACTttGCAGUGGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-648chr1268809063GAgacGCACACcactttAAGUGUGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-6718-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-7978chr1268809063GAgacgcACACCActttUCUGGUGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-891a-3pchr1268809063GAgacgcacGCCACTttAGUGGCACm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-933chr1268809063GAgaCGCACAccactttUGUGCGCAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268achr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-1268bchr1268809063GAgacgCACGCCactttCGGGCGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-140-5pchr1268809063GAgacgcacACCACTttCAGUGGUUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-147bchr1268809063GAgaCGCACACcactttGUGUGCGGm7aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203a-5pchr1268809063GAgacgcacACCACTttAGUGGUUCm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-203b-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-210-3pchr1268809063GAgACGCACAccactttCUGUGCGUm7bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3650chr1268809063GAgacgCACACCactttAGGUGUGUm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3677-5pchr1268809063GAgacgcacGCCACTttCAGUGGCCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-3688-5pchr1268809063GAgacgcacGCCACTttAGUGGCAAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4455chr1268809063GAgacgCACACCactttAGGGUGUGm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-4460chr1268809063GAgacgcacACCACTttAUAGUGGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-5693chr1268809063GAgacgcacGCCACTttGCAGUGGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-648chr1268809063GAgacGCACACcactttAAGUGUGCm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-6718-5pchr1268809063GAgacgcacACCACTttUAGUGGUCm6bHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-7978chr1268809063GAgacgcACACCActttUCUGGUGUm6cHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-891a-3pchr1268809063GAgacgcacGCCACTttAGUGGCACm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68809063G>ACOSN5718615hsa-miR-933chr1268809063GAgaCGCACAccactttUGUGCGCAm6aHX27T[liver][NS][carcinoma][NS]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-1301-3pchr1268840922GTgctcaCTGCAActtcUUGCAGCUm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-143-5pchr1268840922GTgctcACTGCAacttcGGUGCAGUm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-17-3pchr1268840922GTgctcACTGCAacttcACUGCAGUm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-219a-1-3pchr1268840922GTgctcactTCAACTtcAGAGUUGAm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-34a-5pchr1268840922GTgctCACTGCaacttcUGGCAGUGm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-34c-5pchr1268840922GTgctCACTGCaacttcAGGCAGUGm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-3609chr1268840922GTgcTCACTTcaacttcCAAAGUGAm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-3616-5pchr1268840922GTgctCACTTCAacttcAUGAAGUGm7bAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-373-3pchr1268840922GTgctCACTTCaacttcGAAGUGCUm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-4276chr1268840922GTgcTCACTGcaacttcCUCAGUGAm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-4423-5pchr1268840922GTgctcactGCAACTtcAGUUGCCUm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-449achr1268840922GTgctCACTGCaacttcUGGCAGUGm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-449b-5pchr1268840922GTgctCACTGCaacttcAGGCAGUGm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-4519chr1268840922GTgctCACTGCaacttcCAGCAGUGm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-4635chr1268840922GTgctcaCTTCAActtcUCUUGAAGm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-4670-3pchr1268840922GTgctcACTTCAacttcUGAAGUUAm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-4684-3pchr1268840922GTgctcacTGCAACttcUGUUGCAAm6bAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-4709-3pchr1268840922GTgctcaCTTCAActtcUUGAAGAGm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-4795-5pchr1268840922GTgctCACTTCaacttcAGAAGUGGm6bAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-495-5pchr1268840922GTgctcactGCAACTTcGAAGUUGCm7bAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-5047chr1268840922GTgctcaCTGCAActtcUUGCAGCUm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-5190chr1268840922GTgcTCACTGcaacttcCCAGUGACm6bAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-5585-5pchr1268840922GTgctcACTTCAacttcUGAAGUACm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-5693chr1268840922GTgctCACTGCaacttcGCAGUGGCm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-573chr1268840922GTgctCACTTCAacttcCUGAAGUGm7bAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-595chr1268840922GTgctCACTTCaacttcGAAGUGUGm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-6499-3pchr1268840922GTgctCACTGCaacttcAGCAGUGUm6bAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-6501-5pchr1268840922GTgctcactGCAACTtcAGUUGCCAm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-6516-5pchr1268840922GTgctcACTGCAActtcUUUGCAGUm7bAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-653-5pchr1268840922GTgctcacTTCAACttcGUGUUGAAm6cAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-6864-5pchr1268840922GTgctcaCTTCAActtcUUGAAGGGm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-8062chr1268840922GTgcTCACTGcaacttcCAGUGAUUm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68840922G>TCOSN9474242hsa-miR-8079chr1268840922GTgcTCACTGcaacttcCAGUGAUCm6aAOCS-001-1-7[ovary][NS][other][neoplasm]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-103a-3pchr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-107chr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-1226-3pchr1268808481GCccggaTGGTGAggagUCACCAGCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-1229-3pchr1268808481GCccggatGGTGAGgagCUCUCACCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-1266-5pchr1268808481GCccggatgCTGAGGagCCUCAGGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-181a-3pchr1268808481GCccgGATGGTgaggagACCAUCGAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-181c-3pchr1268808481GCccgGATGGTgaggagAACCAUCGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-197-3pchr1268808481GCccggaTGGTGAggagUUCACCACm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-3065-3pchr1268808481GCccggaTGCTGAggagUCAGCACCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-324-5pchr1268808481GCccGGATGCtgaggagCGCAUCCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-338-3pchr1268808481GCccggATGCTGaggagUCCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-3617-3pchr1268808481GCccggaTGCTGAggagCAUCAGCAm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-3619-5pchr1268808481GCccggaTGCTGAggagUCAGCAGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-4291chr1268808481GCccggaTGCTGAggagUUCAGCAGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-4310chr1268808481GCccggATGCTGaggagGCAGCAUUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-4330chr1268808481GCccggatgCTGAGGagCCUCAGAUm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-512-5pchr1268808481GCccggatGCTGAGgagCACUCAGCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-545-3pchr1268808481GCccggaTGCTGAggagUCAGCAAAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6511a-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6511b-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6784-3pchr1268808481GCccggatGGTGAGgagUCUCACCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6787-3pchr1268808481GCccggatGCTGAGgagUCUCAGCUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6862-3pchr1268808481GCccggatGGTGAGGagCCUCACCCm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-7153-3pchr1268808481GCccggATGGTGaggagCACCAUGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-7157-5pchr1268808481GCccggATGCTGAggagUCAGCAUUm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-767-5pchr1268808481GCccggATGGTGaggagUGCACCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-103a-3pchr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-107chr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-1226-3pchr1268808481GCccggaTGGTGAggagUCACCAGCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-1229-3pchr1268808481GCccggatGGTGAGgagCUCUCACCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-1266-5pchr1268808481GCccggatgCTGAGGagCCUCAGGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-181a-3pchr1268808481GCccgGATGGTgaggagACCAUCGAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-181c-3pchr1268808481GCccgGATGGTgaggagAACCAUCGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-197-3pchr1268808481GCccggaTGGTGAggagUUCACCACm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-3065-3pchr1268808481GCccggaTGCTGAggagUCAGCACCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-324-5pchr1268808481GCccGGATGCtgaggagCGCAUCCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-338-3pchr1268808481GCccggATGCTGaggagUCCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-3617-3pchr1268808481GCccggaTGCTGAggagCAUCAGCAm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-3619-5pchr1268808481GCccggaTGCTGAggagUCAGCAGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-4291chr1268808481GCccggaTGCTGAggagUUCAGCAGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-4310chr1268808481GCccggATGCTGaggagGCAGCAUUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-4330chr1268808481GCccggatgCTGAGGagCCUCAGAUm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-512-5pchr1268808481GCccggatGCTGAGgagCACUCAGCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-545-3pchr1268808481GCccggaTGCTGAggagUCAGCAAAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6511a-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6511b-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6784-3pchr1268808481GCccggatGGTGAGgagUCUCACCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6787-3pchr1268808481GCccggatGCTGAGgagUCUCAGCUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6862-3pchr1268808481GCccggatGGTGAGGagCCUCACCCm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-7153-3pchr1268808481GCccggATGGTGaggagCACCAUGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-7157-5pchr1268808481GCccggATGCTGAggagUCAGCAUUm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-767-5pchr1268808481GCccggATGGTGaggagUGCACCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-103a-3pchr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-107chr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-1226-3pchr1268808481GCccggaTGGTGAggagUCACCAGCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-1229-3pchr1268808481GCccggatGGTGAGgagCUCUCACCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-1266-5pchr1268808481GCccggatgCTGAGGagCCUCAGGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-181a-3pchr1268808481GCccgGATGGTgaggagACCAUCGAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-181c-3pchr1268808481GCccgGATGGTgaggagAACCAUCGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-197-3pchr1268808481GCccggaTGGTGAggagUUCACCACm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-3065-3pchr1268808481GCccggaTGCTGAggagUCAGCACCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-324-5pchr1268808481GCccGGATGCtgaggagCGCAUCCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-338-3pchr1268808481GCccggATGCTGaggagUCCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-3617-3pchr1268808481GCccggaTGCTGAggagCAUCAGCAm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-3619-5pchr1268808481GCccggaTGCTGAggagUCAGCAGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-4291chr1268808481GCccggaTGCTGAggagUUCAGCAGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-4310chr1268808481GCccggATGCTGaggagGCAGCAUUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-4330chr1268808481GCccggatgCTGAGGagCCUCAGAUm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-512-5pchr1268808481GCccggatGCTGAGgagCACUCAGCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-545-3pchr1268808481GCccggaTGCTGAggagUCAGCAAAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6511a-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6511b-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6784-3pchr1268808481GCccggatGGTGAGgagUCUCACCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6787-3pchr1268808481GCccggatGCTGAGgagUCUCAGCUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-6862-3pchr1268808481GCccggatGGTGAGGagCCUCACCCm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-7153-3pchr1268808481GCccggATGGTGaggagCACCAUGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-7157-5pchr1268808481GCccggATGCTGAggagUCAGCAUUm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM1476865hsa-miR-767-5pchr1268808481GCccggATGGTGaggagUGCACCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-103a-3pchr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-107chr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-1226-3pchr1268808481GCccggaTGGTGAggagUCACCAGCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-1229-3pchr1268808481GCccggatGGTGAGgagCUCUCACCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-1266-5pchr1268808481GCccggatgCTGAGGagCCUCAGGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-181a-3pchr1268808481GCccgGATGGTgaggagACCAUCGAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-181c-3pchr1268808481GCccgGATGGTgaggagAACCAUCGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-197-3pchr1268808481GCccggaTGGTGAggagUUCACCACm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-3065-3pchr1268808481GCccggaTGCTGAggagUCAGCACCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-324-5pchr1268808481GCccGGATGCtgaggagCGCAUCCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-338-3pchr1268808481GCccggATGCTGaggagUCCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-3617-3pchr1268808481GCccggaTGCTGAggagCAUCAGCAm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-3619-5pchr1268808481GCccggaTGCTGAggagUCAGCAGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-4291chr1268808481GCccggaTGCTGAggagUUCAGCAGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-4310chr1268808481GCccggATGCTGaggagGCAGCAUUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-4330chr1268808481GCccggatgCTGAGGagCCUCAGAUm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-512-5pchr1268808481GCccggatGCTGAGgagCACUCAGCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-545-3pchr1268808481GCccggaTGCTGAggagUCAGCAAAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6511a-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6511b-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6784-3pchr1268808481GCccggatGGTGAGgagUCUCACCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6787-3pchr1268808481GCccggatGCTGAGgagUCUCAGCUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6862-3pchr1268808481GCccggatGGTGAGGagCCUCACCCm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-7153-3pchr1268808481GCccggATGGTGaggagCACCAUGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-7157-5pchr1268808481GCccggATGCTGAggagUCAGCAUUm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-767-5pchr1268808481GCccggATGGTGaggagUGCACCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-103a-3pchr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-107chr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-1226-3pchr1268808481GCccggaTGGTGAggagUCACCAGCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-1229-3pchr1268808481GCccggatGGTGAGgagCUCUCACCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-1266-5pchr1268808481GCccggatgCTGAGGagCCUCAGGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-181a-3pchr1268808481GCccgGATGGTgaggagACCAUCGAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-181c-3pchr1268808481GCccgGATGGTgaggagAACCAUCGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-197-3pchr1268808481GCccggaTGGTGAggagUUCACCACm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-3065-3pchr1268808481GCccggaTGCTGAggagUCAGCACCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-324-5pchr1268808481GCccGGATGCtgaggagCGCAUCCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-338-3pchr1268808481GCccggATGCTGaggagUCCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-3617-3pchr1268808481GCccggaTGCTGAggagCAUCAGCAm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-3619-5pchr1268808481GCccggaTGCTGAggagUCAGCAGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-4291chr1268808481GCccggaTGCTGAggagUUCAGCAGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-4310chr1268808481GCccggATGCTGaggagGCAGCAUUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-4330chr1268808481GCccggatgCTGAGGagCCUCAGAUm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-512-5pchr1268808481GCccggatGCTGAGgagCACUCAGCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-545-3pchr1268808481GCccggaTGCTGAggagUCAGCAAAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6511a-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6511b-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6784-3pchr1268808481GCccggatGGTGAGgagUCUCACCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6787-3pchr1268808481GCccggatGCTGAGgagUCUCAGCUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6862-3pchr1268808481GCccggatGGTGAGGagCCUCACCCm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-7153-3pchr1268808481GCccggATGGTGaggagCACCAUGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-7157-5pchr1268808481GCccggATGCTGAggagUCAGCAUUm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-767-5pchr1268808481GCccggATGGTGaggagUGCACCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-103a-3pchr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-107chr1268808481GCccggATGCTGaggagAGCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-1226-3pchr1268808481GCccggaTGGTGAggagUCACCAGCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-1229-3pchr1268808481GCccggatGGTGAGgagCUCUCACCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-1266-5pchr1268808481GCccggatgCTGAGGagCCUCAGGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-181a-3pchr1268808481GCccgGATGGTgaggagACCAUCGAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-181c-3pchr1268808481GCccgGATGGTgaggagAACCAUCGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-197-3pchr1268808481GCccggaTGGTGAggagUUCACCACm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-3065-3pchr1268808481GCccggaTGCTGAggagUCAGCACCm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-324-5pchr1268808481GCccGGATGCtgaggagCGCAUCCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-338-3pchr1268808481GCccggATGCTGaggagUCCAGCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-3617-3pchr1268808481GCccggaTGCTGAggagCAUCAGCAm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-3619-5pchr1268808481GCccggaTGCTGAggagUCAGCAGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-4291chr1268808481GCccggaTGCTGAggagUUCAGCAGm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-4310chr1268808481GCccggATGCTGaggagGCAGCAUUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-4330chr1268808481GCccggatgCTGAGGagCCUCAGAUm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-512-5pchr1268808481GCccggatGCTGAGgagCACUCAGCm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-545-3pchr1268808481GCccggaTGCTGAggagUCAGCAAAm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6511a-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6511b-3pchr1268808481GCccggaTGGTGAGGagCCUCACCAm8aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6784-3pchr1268808481GCccggatGGTGAGgagUCUCACCCm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6787-3pchr1268808481GCccggatGCTGAGgagUCUCAGCUm6bTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-6862-3pchr1268808481GCccggatGGTGAGGagCCUCACCCm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-7153-3pchr1268808481GCccggATGGTGaggagCACCAUGGm6aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-7157-5pchr1268808481GCccggATGCTGAggagUCAGCAUUm7aTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808481G>CCOSM431746hsa-miR-767-5pchr1268808481GCccggATGGTGaggagUGCACCAUm6cTCGA-E2-A158-01[breast][NS][carcinoma][NS]
MDM2chr12:g.68808487A>CCOSM1197268hsa-let-7i-3pchr1268808487ACggtgagGCGCAGgtaCUGCGCAAm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-1281chr1268808487ACggtGAGGCGcaggtaUCGCCUCCm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-1539chr1268808487ACggtgagGCGCAGGtaUCCUGCGCm7bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-191-3pchr1268808487ACggtgagGCGCAGgtaGCUGCGCUm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-2682-3pchr1268808487ACggtGAGGCGcaggtaCGCCUCUUm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-3193chr1268808487ACggtgaggCGCAGGtaUCCUGCGUm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-3692-5pchr1268808487ACggtgaggAGCAGGtaCCUGCUGGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-370-3pchr1268808487ACggtgaggAGCAGGtaGCCUGCUGm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4268chr1268808487ACggtGAGGAGCaggtaGGCUCCUCm7bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4279chr1268808487ACggtGAGGAGcaggtaCUCUCCUCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4448chr1268808487ACggtgAGGAGCaggtaGGCUCCUUm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4520-5pchr1268808487ACggtgaggCGCAGGtaCCUGCGUGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4787-3pchr1268808487ACggtgaGGCGCAggtaGAUGCGCCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-5193chr1268808487ACggtGAGGAGcaggtaUCCUCCUCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-566chr1268808487ACggtgAGGCGCaggtaGGGCGCCUm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6068chr1268808487ACggtgaggCGCAGGtaCCUGCGAGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6072chr1268808487ACggTGAGGAgcaggtaUCCUCAUCm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-668-5pchr1268808487ACggtGAGGCGCAggtaUGCGCCUCm8aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-670-3pchr1268808487ACggTGAGGAgcaggtaUUUCCUCAm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6720-3pchr1268808487ACggtgAGGCGCaggtaCGCGCCUGm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6749-3pchr1268808487ACggtGAGGAGcaggtaCUCCUCCCm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6772-3pchr1268808487ACggtgAGGAGCAggtaUUGCUCCUm7bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6780a-3pchr1268808487ACggtGAGGAGcaggtaCUCCUCUGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6792-3pchr1268808487ACggtGAGGAGcaggtaCUCCUCCAm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6828-3pchr1268808487ACggtgagGAGCAGgtaAUCUGCUCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6893-3pchr1268808487ACggtgaggAGCAGGtaCCCUGCUGm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-767-3pchr1268808487ACggtgagGAGCAGgtaUCUGCUCAm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-let-7i-3pchr1268808487ACggtgagGCGCAGgtaCUGCGCAAm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-1281chr1268808487ACggtGAGGCGcaggtaUCGCCUCCm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-1539chr1268808487ACggtgagGCGCAGGtaUCCUGCGCm7bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-191-3pchr1268808487ACggtgagGCGCAGgtaGCUGCGCUm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-2682-3pchr1268808487ACggtGAGGCGcaggtaCGCCUCUUm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-3193chr1268808487ACggtgaggCGCAGGtaUCCUGCGUm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-3692-5pchr1268808487ACggtgaggAGCAGGtaCCUGCUGGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-370-3pchr1268808487ACggtgaggAGCAGGtaGCCUGCUGm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4268chr1268808487ACggtGAGGAGCaggtaGGCUCCUCm7bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4279chr1268808487ACggtGAGGAGcaggtaCUCUCCUCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4448chr1268808487ACggtgAGGAGCaggtaGGCUCCUUm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4520-5pchr1268808487ACggtgaggCGCAGGtaCCUGCGUGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4787-3pchr1268808487ACggtgaGGCGCAggtaGAUGCGCCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-5193chr1268808487ACggtGAGGAGcaggtaUCCUCCUCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-566chr1268808487ACggtgAGGCGCaggtaGGGCGCCUm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6068chr1268808487ACggtgaggCGCAGGtaCCUGCGAGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6072chr1268808487ACggTGAGGAgcaggtaUCCUCAUCm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-668-5pchr1268808487ACggtGAGGCGCAggtaUGCGCCUCm8aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-670-3pchr1268808487ACggTGAGGAgcaggtaUUUCCUCAm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6720-3pchr1268808487ACggtgAGGCGCaggtaCGCGCCUGm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6749-3pchr1268808487ACggtGAGGAGcaggtaCUCCUCCCm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6772-3pchr1268808487ACggtgAGGAGCAggtaUUGCUCCUm7bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6780a-3pchr1268808487ACggtGAGGAGcaggtaCUCCUCUGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6792-3pchr1268808487ACggtGAGGAGcaggtaCUCCUCCAm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6828-3pchr1268808487ACggtgagGAGCAGgtaAUCUGCUCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6893-3pchr1268808487ACggtgaggAGCAGGtaCCCUGCUGm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-767-3pchr1268808487ACggtgagGAGCAGgtaUCUGCUCAm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-let-7i-3pchr1268808487ACggtgagGCGCAGgtaCUGCGCAAm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-1281chr1268808487ACggtGAGGCGcaggtaUCGCCUCCm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-1539chr1268808487ACggtgagGCGCAGGtaUCCUGCGCm7bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-191-3pchr1268808487ACggtgagGCGCAGgtaGCUGCGCUm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-2682-3pchr1268808487ACggtGAGGCGcaggtaCGCCUCUUm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-3193chr1268808487ACggtgaggCGCAGGtaUCCUGCGUm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-3692-5pchr1268808487ACggtgaggAGCAGGtaCCUGCUGGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-370-3pchr1268808487ACggtgaggAGCAGGtaGCCUGCUGm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4268chr1268808487ACggtGAGGAGCaggtaGGCUCCUCm7bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4279chr1268808487ACggtGAGGAGcaggtaCUCUCCUCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4448chr1268808487ACggtgAGGAGCaggtaGGCUCCUUm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4520-5pchr1268808487ACggtgaggCGCAGGtaCCUGCGUGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-4787-3pchr1268808487ACggtgaGGCGCAggtaGAUGCGCCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-5193chr1268808487ACggtGAGGAGcaggtaUCCUCCUCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-566chr1268808487ACggtgAGGCGCaggtaGGGCGCCUm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6068chr1268808487ACggtgaggCGCAGGtaCCUGCGAGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6072chr1268808487ACggTGAGGAgcaggtaUCCUCAUCm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-668-5pchr1268808487ACggtGAGGCGCAggtaUGCGCCUCm8aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-670-3pchr1268808487ACggTGAGGAgcaggtaUUUCCUCAm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6720-3pchr1268808487ACggtgAGGCGCaggtaCGCGCCUGm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6749-3pchr1268808487ACggtGAGGAGcaggtaCUCCUCCCm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6772-3pchr1268808487ACggtgAGGAGCAggtaUUGCUCCUm7bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6780a-3pchr1268808487ACggtGAGGAGcaggtaCUCCUCUGm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6792-3pchr1268808487ACggtGAGGAGcaggtaCUCCUCCAm6aH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6828-3pchr1268808487ACggtgagGAGCAGgtaAUCUGCUCm6cH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-6893-3pchr1268808487ACggtgaggAGCAGGtaCCCUGCUGm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68808487A>CCOSM1197268hsa-miR-767-3pchr1268808487ACggtgagGAGCAGgtaUCUGCUCAm6bH2122[lung][NS][carcinoma][non_small_cell_carcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044442hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-let-7i-3pchr1268809215TCgcaaaTGCGCAatacCUGCGCAAm6bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-1250-3pchr1268809215TCgcAAATGTgcaatacACAUUUUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-130a-5pchr1268809215TCgcaAATGTGcaatacUUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23a-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23b-3pchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-23cchr1268809215TCgcaAATGTGcaatacAUCACAUUm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-25-3pchr1268809215TCgcaaatGTGCAATacCAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-323a-3pchr1268809215TCgcaAATGTGcaatacCACAUUACm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-32-5pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-363-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-367-3pchr1268809215TCgcaaatGTGCAATacAAUUGCACm7bTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-4325chr1268809215TCgcaaatGTGCAAtacUUGCACUUm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-507chr1268809215TCgcaaatGTGCAAtacUUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-557chr1268809215TCgcaaatGTGCAAtacGUUUGCACm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-5589-3pchr1268809215TCgcaaATGTGCAatacUGCACAUGm7aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-7703chr1268809215TCgcaaatGTGCAAtacUUGCACUCm6aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92a-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-92b-3pchr1268809215TCgcaaatGTGCAATAcUAUUGCACm8aTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809215T>CCOSM4044443hsa-miR-933chr1268809215TCgcaaaTGCGCAatacUGUGCGCAm6cTCGA-BR-6452-01[stomach][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396088hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG_0006_Pr_P_F0[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7a-2-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-let-7g-3pchr1268809231CGaacatgtCTGTACctCUGUACAGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-1324chr1268809231CGaacaTGTCTGtacctCCAGACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-216b-3pchr1268809231CGaacatGTGTGTacctACACACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3166chr1268809231CGaacaTGTCTGtacctCGCAGACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-329-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3617-5pchr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-362-3pchr1268809231CGaacatGTGTGTacctAACACACCm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-377-3pchr1268809231CGaacaTGTGTGtacctAUCACACAm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3913-3pchr1268809231CGaacATGTCTgtacctAGACAUCAm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-3941chr1268809231CGaacatGTGTGTAcctUUACACACm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4643chr1268809231CGaaCATGTGTgtacctGACACAUGm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-466chr1268809231CGaacATGTGTgtacctAUACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4672chr1268809231CGaacatgTGTGTAcctUUACACAGm6bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4717-3pchr1268809231CGaaCATGTGTgtacctACACAUGGm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4731-3pchr1268809231CGaacaTGTGTGtacctCACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4789-3pchr1268809231CGaacATGTGTGtacctCACACAUAm7aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-4801chr1268809231CGaacatgTGTGTAcctUACACAAGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-499b-5pchr1268809231CGaacatGTCTGTacctACAGACUUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5589-3pchr1268809231CGaaCATGTGtgtacctUGCACAUGm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-5683chr1268809231CGaacatgTCTGTAcctUACAGAUGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-603chr1268809231CGaacaTGTGTGtacctCACACACUm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-641chr1268809231CGaacATGTCTgtacctAAAGACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642a-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-642b-3pchr1268809231CGaacATGTGTgtacctAGACACAUm6cCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-6768-5pchr1268809231CGaacaTGTGTGtacctCACACAGGm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-8485chr1268809231CGaacaTGTGTGTacctCACACACAm7bCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809231C>GCOSM3396087hsa-miR-942-3pchr1268809231CGaaCATGTGtgtacctCACAUGGCm6aCPCG0006-F1[prostate][NS][carcinoma][adenocarcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-1295b-3pchr1268809240CTgtaCCTATTgatggtAAUAGGCCm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199a-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199b-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-2115-3pchr1268809240CTgtacctaCTGATGgtCAUCAGAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-222-5pchr1268809240CTgtacCTACTGAtggtCUCAGUAGm7bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3129-5pchr1268809240CTgtacCTACTGatggtGCAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3617-3pchr1268809240CTgtacctaCTGATGgtCAUCAGCAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4711-5pchr1268809240CTgtacctaCTGATGgtUGCAUCAGm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4797-3pchr1268809240CTgtaccTACTGAtggtUCUCAGUAm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-5094chr1268809240CTgtacctACTGATggtAAUCAGUGm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-545-5pchr1268809240CTgtaccTACTGAtggtUCAGUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6800-5pchr1268809240CTgtACCTACtgatggtGUAGGUGAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6826-5pchr1268809240CTgtaCCTATTGAtggtUCAAUAGGm8aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-936chr1268809240CTgtacCTACTGatggtACAGUAGAm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-95-5pchr1268809240CTgtaccTATTGAtggtUCAAUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-1295b-3pchr1268809240CTgtaCCTATTgatggtAAUAGGCCm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199a-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199b-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-2115-3pchr1268809240CTgtacctaCTGATGgtCAUCAGAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-222-5pchr1268809240CTgtacCTACTGAtggtCUCAGUAGm7bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3129-5pchr1268809240CTgtacCTACTGatggtGCAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3617-3pchr1268809240CTgtacctaCTGATGgtCAUCAGCAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4711-5pchr1268809240CTgtacctaCTGATGgtUGCAUCAGm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4797-3pchr1268809240CTgtaccTACTGAtggtUCUCAGUAm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-5094chr1268809240CTgtacctACTGATggtAAUCAGUGm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-545-5pchr1268809240CTgtaccTACTGAtggtUCAGUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6800-5pchr1268809240CTgtACCTACtgatggtGUAGGUGAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6826-5pchr1268809240CTgtaCCTATTGAtggtUCAAUAGGm8aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-936chr1268809240CTgtacCTACTGatggtACAGUAGAm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-95-5pchr1268809240CTgtaccTATTGAtggtUCAAUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-1295b-3pchr1268809240CTgtaCCTATTgatggtAAUAGGCCm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199a-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199b-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-2115-3pchr1268809240CTgtacctaCTGATGgtCAUCAGAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-222-5pchr1268809240CTgtacCTACTGAtggtCUCAGUAGm7bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3129-5pchr1268809240CTgtacCTACTGatggtGCAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3617-3pchr1268809240CTgtacctaCTGATGgtCAUCAGCAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4711-5pchr1268809240CTgtacctaCTGATGgtUGCAUCAGm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4797-3pchr1268809240CTgtaccTACTGAtggtUCUCAGUAm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-5094chr1268809240CTgtacctACTGATggtAAUCAGUGm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-545-5pchr1268809240CTgtaccTACTGAtggtUCAGUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6800-5pchr1268809240CTgtACCTACtgatggtGUAGGUGAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6826-5pchr1268809240CTgtaCCTATTGAtggtUCAAUAGGm8aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-936chr1268809240CTgtacCTACTGatggtACAGUAGAm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-95-5pchr1268809240CTgtaccTATTGAtggtUCAAUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-1295b-3pchr1268809240CTgtaCCTATTgatggtAAUAGGCCm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199a-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199b-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-2115-3pchr1268809240CTgtacctaCTGATGgtCAUCAGAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-222-5pchr1268809240CTgtacCTACTGAtggtCUCAGUAGm7bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3129-5pchr1268809240CTgtacCTACTGatggtGCAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3617-3pchr1268809240CTgtacctaCTGATGgtCAUCAGCAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4711-5pchr1268809240CTgtacctaCTGATGgtUGCAUCAGm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4797-3pchr1268809240CTgtaccTACTGAtggtUCUCAGUAm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-5094chr1268809240CTgtacctACTGATggtAAUCAGUGm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-545-5pchr1268809240CTgtaccTACTGAtggtUCAGUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6800-5pchr1268809240CTgtACCTACtgatggtGUAGGUGAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6826-5pchr1268809240CTgtaCCTATTGAtggtUCAAUAGGm8aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-936chr1268809240CTgtacCTACTGatggtACAGUAGAm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-95-5pchr1268809240CTgtaccTATTGAtggtUCAAUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-1295b-3pchr1268809240CTgtaCCTATTgatggtAAUAGGCCm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199a-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199b-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-2115-3pchr1268809240CTgtacctaCTGATGgtCAUCAGAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-222-5pchr1268809240CTgtacCTACTGAtggtCUCAGUAGm7bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3129-5pchr1268809240CTgtacCTACTGatggtGCAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3617-3pchr1268809240CTgtacctaCTGATGgtCAUCAGCAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4711-5pchr1268809240CTgtacctaCTGATGgtUGCAUCAGm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4797-3pchr1268809240CTgtaccTACTGAtggtUCUCAGUAm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-5094chr1268809240CTgtacctACTGATggtAAUCAGUGm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-545-5pchr1268809240CTgtaccTACTGAtggtUCAGUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6800-5pchr1268809240CTgtACCTACtgatggtGUAGGUGAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6826-5pchr1268809240CTgtaCCTATTGAtggtUCAAUAGGm8aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-936chr1268809240CTgtacCTACTGatggtACAGUAGAm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-95-5pchr1268809240CTgtaccTATTGAtggtUCAAUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-1295b-3pchr1268809240CTgtaCCTATTgatggtAAUAGGCCm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199a-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-199b-3pchr1268809240CTgtacCTACTGatggtACAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-2115-3pchr1268809240CTgtacctaCTGATGgtCAUCAGAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-222-5pchr1268809240CTgtacCTACTGAtggtCUCAGUAGm7bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3129-5pchr1268809240CTgtacCTACTGatggtGCAGUAGUm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-3617-3pchr1268809240CTgtacctaCTGATGgtCAUCAGCAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4711-5pchr1268809240CTgtacctaCTGATGgtUGCAUCAGm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-4797-3pchr1268809240CTgtaccTACTGAtggtUCUCAGUAm6cK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-5094chr1268809240CTgtacctACTGATggtAAUCAGUGm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-545-5pchr1268809240CTgtaccTACTGAtggtUCAGUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6800-5pchr1268809240CTgtACCTACtgatggtGUAGGUGAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-6826-5pchr1268809240CTgtaCCTATTGAtggtUCAAUAGGm8aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-936chr1268809240CTgtacCTACTGatggtACAGUAGAm6bK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68809240C>TCOSM249344hsa-miR-95-5pchr1268809240CTgtaccTATTGAtggtUCAAUAAAm6aK76[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM1133403hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302b-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-302d-5pchr1268813586AGagttaTTAAAGTctgACUUUAACm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-412-3pchr1268813586AGagttatTGAAGTctgACUUCACCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-617chr1268813586AGagttattGAAGTCTgAGACUUCCm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6505-3pchr1268813586AGagttattGAAGTCtgUGACUUCUm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-676-5pchr1268813586AGagttaTTGAAGtctgUCUUCAACm6bTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-6826-5pchr1268813586AGagtTATTGAagtctgUCAAUAGGm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-889-3pchr1268813586AGagtTATTAAagtctgUUAAUAUCm6aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813586A>GCOSM416094hsa-miR-95-5pchr1268813586AGagTTATTGAagtctgUCAAUAAAm7aTCGA-BT-A20T-01[urinary_tract][bladder][carcinoma][NS]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662731hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1206chr1268813600CAgttggTGAACAaaaaUGUUCAUGm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-1226-3pchr1268813600CAgtTGGTGAacaaaaaUCACCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-124-5pchr1268813600CAgttggTGAACAaaaaCGUGUUCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-197-3pchr1268813600CAgtTGGTGAAcaaaaaUUCACCACm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19a-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-19b-3pchr1268813600CAgttggTGCACAaaaaUGUGCAAAm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-2113chr1268813600CAgttggtGCACAAAaaAUUUGUGCm7bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-218-5pchr1268813600CAgttggtGCACAAaaaUUGUGCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29a-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29b-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-29c-3pchr1268813600CAgtTGGTGCacaaaaaUAGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3130-3pchr1268813600CAgttGGTGCAcaaaaaGCUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-375chr1268813600CAgttggtGAACAAAaaUUUGUUCGm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-3944-5pchr1268813600CAgttggTGCACAaaaaUGUGCAGCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-412-3pchr1268813600CAgttGGTGAAcaaaaaACUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-4677-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-500a-3pchr1268813600CAgttGGTGCAcaaaaaAUGCACCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5010-3pchr1268813600CAgttggtgCACAAAAaUUUUGUGUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-501-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-502-3pchr1268813600CAgttGGTGCAcaaaaaAAUGCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-5096chr1268813600CAgttGGTGAAcaaaaaGUUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-593-5pchr1268813600CAgtTGGTGCacaaaaaAGGCACCAm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6739-3pchr1268813600CAgttggtGAACAAaaaAUUGUUCUm6bccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6754-3pchr1268813600CAgttGGTGAAcaaaaaUCUUCACCm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6802-3pchr1268813600CAgttGGTGAAcaaaaaUUCACCCCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-6853-3pchr1268813600CAgttggTGAACAaaaaUGUUCAUUm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-7156-5pchr1268813600CAgttggtGAACAAaaaUUGUUCUCm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-758-3pchr1268813600CAgttggtgCACAAAaaUUUGUGACm6accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-767-5pchr1268813600CAgtTGGTGCAcaaaaaUGCACCAUm7accRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68813600C>ACOSM1662732hsa-miR-8068chr1268813600CAgttggtgAACAAAaaUGUUUGUUm6cccRCC-92[kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-1282chr1268816849GAactAAACGAttatatUCGUUUGCm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-219a-2-3pchr1268816849GAactaaACAATTatatAGAAUUGUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-302fchr1268816849GAactaaaCAATTAtatUAAUUGCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-4445-5pchr1268816849GAactaAACAATtatatAGAUUGUUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-487b-3pchr1268816849GAactaaACGATTatatAAUCGUACm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-6739-3pchr1268816849GAactaAACAATtatatAUUGUUCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-1282chr1268816849GAactAAACGAttatatUCGUUUGCm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-219a-2-3pchr1268816849GAactaaACAATTatatAGAAUUGUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-302fchr1268816849GAactaaaCAATTAtatUAAUUGCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-4445-5pchr1268816849GAactaAACAATtatatAGAUUGUUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-487b-3pchr1268816849GAactaaACGATTatatAAUCGUACm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-6739-3pchr1268816849GAactaAACAATtatatAUUGUUCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-1282chr1268816849GAactAAACGAttatatUCGUUUGCm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-219a-2-3pchr1268816849GAactaaACAATTatatAGAAUUGUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-302fchr1268816849GAactaaaCAATTAtatUAAUUGCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-4445-5pchr1268816849GAactaAACAATtatatAGAUUGUUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-487b-3pchr1268816849GAactaaACGATTatatAAUCGUACm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-6739-3pchr1268816849GAactaAACAATtatatAUUGUUCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-1282chr1268816849GAactAAACGAttatatUCGUUUGCm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-219a-2-3pchr1268816849GAactaaACAATTatatAGAAUUGUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-302fchr1268816849GAactaaaCAATTAtatUAAUUGCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-4445-5pchr1268816849GAactaAACAATtatatAGAUUGUUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-487b-3pchr1268816849GAactaaACGATTatatAAUCGUACm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM942904hsa-miR-6739-3pchr1268816849GAactaAACAATtatatAUUGUUCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-1282chr1268816849GAactAAACGAttatatUCGUUUGCm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-219a-2-3pchr1268816849GAactaaACAATTatatAGAAUUGUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-302fchr1268816849GAactaaaCAATTAtatUAAUUGCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-4445-5pchr1268816849GAactaAACAATtatatAGAUUGUUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-487b-3pchr1268816849GAactaaACGATTatatAAUCGUACm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-6739-3pchr1268816849GAactaAACAATtatatAUUGUUCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-1282chr1268816849GAactAAACGAttatatUCGUUUGCm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-219a-2-3pchr1268816849GAactaaACAATTatatAGAAUUGUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-302fchr1268816849GAactaaaCAATTAtatUAAUUGCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-4445-5pchr1268816849GAactaAACAATtatatAGAUUGUUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-487b-3pchr1268816849GAactaaACGATTatatAAUCGUACm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-6739-3pchr1268816849GAactaAACAATtatatAUUGUUCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-1282chr1268816849GAactAAACGAttatatUCGUUUGCm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-219a-2-3pchr1268816849GAactaaACAATTatatAGAAUUGUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-302fchr1268816849GAactaaaCAATTAtatUAAUUGCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-4445-5pchr1268816849GAactaAACAATtatatAGAUUGUUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-487b-3pchr1268816849GAactaaACGATTatatAAUCGUACm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-6739-3pchr1268816849GAactaAACAATtatatAUUGUUCUm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-1282chr1268816849GAactAAACGAttatatUCGUUUGCm6aTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-219a-2-3pchr1268816849GAactaaACAATTatatAGAAUUGUm6cTCGA-BS-A0UV-01[endometrium][NS][carcinoma][endometrioid_carcinoma]
MDM2chr12:g.68816849G>ACOSM1586722hsa-miR-302fchr1268816849GAactaaaCAATTAtatUAAUUGCUm6aTCGA-BS-A0UV-01